Displaying publications 1 - 20 of 250 in total

Abstract:
Sort:
  1. Zainuddin A, Chua KH, Tan JK, Jaafar F, Makpol S
    J Physiol Biochem, 2017 Feb;73(1):59-65.
    PMID: 27743340 DOI: 10.1007/s13105-016-0524-2
    Human diploid fibroblasts (HDFs) proliferation in culture has been used as a model of aging at the cellular level. Growth arrest is one of the most important mechanisms responsible for replicative senescence. Recent researches have been focusing on the function of vitamin E in modulating cellular signaling and gene expression. Therefore, the aim of this study was to elucidate the effect of palm γ-tocotrienol (vitamin E) in modulating cellular aging through p16INK4a pathway in HDF cells. Primary culture of senescent HDFs was incubated with 70 μM of palm γ-tocotrienol for 24 hours. Silencing of p16INK4a was carried out by siRNA transfection. RNA was extracted from the different treatment groups and gene expression analysis was carried out by real-time reverse transcription polymerase chain reaction. Proteins that were regulated by p16INK4a were determined by western blot technique. The finding of this study showed that p16INK4a mRNA was overexpressed in senescent HDFs, and hypophosphorylated-pRb and cyclin D1 protein expressions were increased (p 
  2. Jones SU, Chua KH, Chew CH, Yeo CC, Abdullah FH, Othman N, et al.
    PeerJ, 2021;9:e11195.
    PMID: 33889447 DOI: 10.7717/peerj.11195
    Background: Staphylococcus aureus is one of the important pathogens causing nosocomial infection. spa typing allows identification of S. aureus clones in hospital isolates and is useful for epidemiological studies and nosocomial infection control. This study aims to investigate the spa types in Malaysian S. aureus isolates obtained from various clinical specimens.

    Method: A total of 89 methicillin-resistant S. aureus (MRSA) [pus (n = 55), blood (n = 27), respiratory (n = 5), eye (n = 2)] isolates and 109 methicillin-susceptible S. aureus (MSSA) [pus (n = 79), blood (n = 24), respiratory (n = 3), eye (n = 2) and urine (n = 1)] isolates were subjected to spa typing with sequences analysed using BioNumerics version 7.

    Results: The spa sequence was successfully amplified from 77.8% of the strains (154/198) and 47 known spa types were detected. The distribution of known spa types in MRSA (36.2%, 17/47) was less diverse than in MSSA (70.2%, 33/47). The most predominant spa types were t032 (50%) in MRSA, and t127 (19%) and t091 (16.7%) in MSSA, respectively. spa type t091 in MSSA was significantly associated with skin and soft tissue infections (p = 0.0199).

    Conclusion: The previously uncommon spa type t032 was detected in the Malaysian MRSA strains, which also corresponded to the most common spa type in Europe and Australia, and has replaced the dominant spa type t037 which was reported in Malaysia in 2010.

  3. Chan XY, Chua KH, Yin WF, Puthucheary SD, Chan KG
    Genome Announc, 2014;2(6).
    PMID: 25540357 DOI: 10.1128/genomeA.01360-14
    Aeromonas hydrophila is a quorum-sensing (QS) bacterium that causes diarrhea in humans upon infection. Here, we report the genome of pathogenic Aeromonas hydrophila strain 187, which possesses a QS gene responsible for signaling molecule N-acyl homoserine lactone (AHL) synthesis and has been found to be located at contig 36.
  4. Kuan SW, Chua KH, Tan EW, Tan LK, Loch A, Kee BP
    PeerJ, 2022;10:e13265.
    PMID: 35441061 DOI: 10.7717/peerj.13265
    Cardiomyopathy (CMP) constitutes a diverse group of myocardium diseases affecting the pumping ability of the heart. Genetic predisposition is among the major factors affecting the development of CMP. Globally, there are over 100 genes in autosomal and mitochondrial DNA (mtDNA) that have been reported to be associated with the pathogenesis of CMP. However, most of the genetic studies have been conducted in Western countries, with limited data being available for the Asian population. Therefore, this study aims to investigate the mutation spectrum in the mitochondrial genome of 145 CMP patients in Malaysia. Long-range PCR was employed to amplify the entire mtDNA, and whole mitochondrial genome sequencing was conducted on the MiSeq platform. Raw data was quality checked, mapped, and aligned to the revised Cambridge Reference Sequence (rCRS). Variants were named, annotated, and filtered. The sequencing revealed 1,077 variants, including 18 novel and 17 CMP and/or mitochondrial disease-associated variants after filtering. In-silico predictions suggested that three of the novel variants (m.8573G>C, m.11916T>A and m.11918T>G) in this study are potentially pathogenic. Two confirmed pathogenic variants (m.1555A>G and m.11778G>A) were also found in the CMP patients. The findings of this study shed light on the distribution of mitochondrial mutations in Malaysian CMP patients. Further functional studies are required to elucidate the role of these variants in the development of CMP.
  5. Che Hamzah AM, Chew CH, Al-Trad EI, Puah SM, Chua KH, A Rahman NI, et al.
    Sci Rep, 2024 Feb 12;14(1):3485.
    PMID: 38347106 DOI: 10.1038/s41598-024-54182-x
    Despite the importance of methicillin-resistant Staphylococcus aureus (MRSA) as a priority nosocomial pathogen, the genome sequences of Malaysian MRSA isolates are currently limited to a small pool of samples. Here, we present the genome sequence analyses of 88 clinical MRSA isolates obtained from the main tertiary hospital in Terengganu, Malaysia in 2016-2020, to obtain in-depth insights into their characteristics. The EMRSA-15 (ST22-SCCmec IV) clone of the clonal complex 22 (CC22) lineage was predominant with a total of 61 (69.3%) isolates. Earlier reports from other Malaysian hospitals indicated the predominance of the ST239 clone, but only two (2.3%) isolates were identified in this study. Two Indian-origin clones, the Bengal Bay clone ST772-SCCmec V (n = 2) and ST672 (n = 10) were also detected, with most of the ST672 isolates obtained in 2020 (n = 7). Two new STs were found, with one isolate each, and were designated ST7879 and ST7883. From the core genome phylogenetic tree, the HSNZ MRSA isolates could be grouped into seven clades. Antimicrobial phenotype-genotype concordance was high (> 95%), indicating the accuracy of WGS in predicting most resistances. Majority of the MRSA isolates were found to harbor more than 10 virulence genes, demonstrating their pathogenic nature.
  6. Puah SM, Puthucheary SDA, Chua KH
    Jpn J Infect Dis, 2022 Jan 31.
    PMID: 35095023 DOI: 10.7883/yoken.JJID.2021.477
    Genus Plesiomonas, represented by a single species, P. shigelloides is a Gram-negative bacillus associated with gastrointestinal and extraintestinal disease in humans. In this study, 44 clinical isolates (gastrointestinal n=41; extraintestinal n=3) were genetically confirmed as P. shigelloides using the hug gene. All 20 virulence genes were detected in gastrointestinal isolates, ranging from 7.7% to 100%, however, only 12 genes were detected in extra-gastrointestinal isolates, ranging from 33.3% to 100%. The phlA gene was significantly (p=0.0216) associated with gastrointestinal isolates. The results of this study suggest that the presence of phlA may play a role in gastrointestinal-related infections. On the other hand, pilF, tolC and fur were detected in both gastrointestinal and extraintestinal clinical isolates and further investigations are warrants to elucidate their role in the pathogenesis of P. shigelloides.
  7. Puah SM, Chua KH, Tan JA
    Int J Environ Res Public Health, 2016 Feb;13(2):199.
    PMID: 26861367 DOI: 10.3390/ijerph13020199
    Staphylococcus aureus is one of the leading causes of food poisoning. Its pathogenicity results from the possession of virulence genes that produce different toxins which result in self-limiting to severe illness often requiring hospitalization. In this study of 200 sushi and sashimi samples, S. aureus contamination was confirmed in 26% of the food samples. The S. aureus isolates were further characterized for virulence genes and antibiotic susceptibility. A high incidence of virulence genes was identified in 96.2% of the isolates and 20 different virulence gene profiles were confirmed. DNA amplification showed that 30.8% (16/52) of the S. aureus carried at least one SE gene which causes staphylococcal food poisoning. The most common enterotoxin gene was seg (11.5%) and the egc cluster was detected in 5.8% of the isolates. A combination of hla and hld was the most prevalent coexistence virulence genes and accounted for 59.6% of all isolates. Antibiotic resistance studies showed tetracycline resistance to be the most common at 28.8% while multi-drug resistance was found to be low at 3.8%. In conclusion, the high rate of S. aureus in the sampled sushi and sashimi indicates the need for food safety guidelines.
  8. Halim NH, Chong ET, Goh LP, Chuah JA, See EU, Chua KH, et al.
    Asian Pac J Cancer Prev, 2016;17(4):1925-31.
    PMID: 27221877
    BACKGROUND: The XRCC1 protein facilitates various DNA repair pathways; single-nucleotide polymorphisms (SNPs) in this gene are associated with a risk of gastrointestinal cancer (GIC) with inconsistent results, but no data have been previously reported for the Sabah, North Borneo, population. We accordingly investigated the XRCC1 Arg194Trp and Arg399Gln SNPs in terms of GIC risk in Sabah.

    MATERIALS AND METHODS: We performed genotyping for both SNPs for 250 GIC patients and 572 healthy volunteers using a polymerase chain reaction- restriction fragment length polymorphism approach. We validated heterozygosity and homozygosity for both SNPs using direct sequencing.

    RESULTS: The presence of a variant 194Trp allele in the Arg194Trp SNP was significantly associated with a higher risk of GIC, especially with gastric and colorectal cancers. We additionally found that the variant 399Gln allele in Arg399Gln SNP was associated with a greater risk of developing gastric cancer. Our combined analysis revealed that inheritance of variant alleles in both SNPs increased the GIC risk in Sabah population. Based on our etiological analysis, we found that subjects ≥50 years and males who carrying the variant 194Trp allele, and Bajau subjects carrying the 399Gln allele had a significantly increased risk of GIC.

    CONCLUSIONS: Our findings suggest that inheritance of variant alleles in XRCC1 Arg194Trp and Arg399Gln SNPs may act as biomarkers for the early detection of GIC, especially for gastric and colorectal cancers in the Sabah population.

  9. Fatimah SS, Ng SL, Chua KH, Hayati AR, Tan AE, Tan GC
    Hum. Cell, 2010 Nov;23(4):141-51.
    PMID: 21166885 DOI: 10.1111/j.1749-0774.2010.00096.x
    Human amniotic epithelial cells (hAECs) are potentially one of the key players in tissue engineering due to their easy availability. The aim of the present study was to develop an optimal isolation and transportation technique, as well as to determine the immunophenotype and epithelial gene expression of hAECs. Amnion was mechanically peeled off from the chorion and digested with trypsin-ethylenediaminetetraacetic acid. The isolated hAECs were cultured in medium containing 10 ng/mL epidermal growth factor until P4. The epithelial gene expression, cell surface antigen and protein expression of hAECs were analyzed by quantitative polymerase chain reaction, flow cytometry and immunocytochemistry. hAECs were also cultured in adipogenic, osteogenic and neurogenic induction media. The best cell yield of hAECs was seen in the digestion of 15 pieces of amnion (2 × 2 cm) and isolated 30 min after digestion with trypsin. F12:Dulbecco's modified eagle medium was the best medium for short term storage at 4 °C. hAECs expressed CD9, CD44, CD73 and CD90, and negligibly expressed CD31, CD34, CD45 and CD117. After serial passage, CK3, CK19 and involucrin gene expressions were upregulated, while p63, CK1 and CK14 gene expressions were downregulated. Sustained gene expressions of integrin β1 and CK18 were observed. At initial culture, these cells might have stem-like properties. However, they differentiated after serial passage. Nonetheless, hAECs have epithelial stem cell characteristics and have the potential to differentiate into corneal epithelial cells. Further investigations are still needed to elucidate the mechanism of differentiation involved and to optimize the culture condition for long term in vitro culture.
  10. Adha PR, Chua KH, Mazlyzam AL, Low KC, Aminuddin BS, Ruszymah BH
    Med J Malaysia, 2008 Jul;63 Suppl A:30-1.
    PMID: 19024968
    A major factor limiting survival following extensive thermal injury is insufficient availability of donor sites to provide enough skin for the required grafting procedures. Limitation of autologous grafting promotes the usage of allograft skin substitutes to promote wound healing. Here, we investigated the wound healing potential of allograft single layered tissue engineered skin which comprises of either keratinocytes (SLTES-K) or fibroblast (SLTES-F) with fibrin as the delivery system. Results from gross and microscopic evaluation showed our single layered tissue engineered skin constructed with keratinocytes or fibroblast after gamma radiation with the dosage of 2Gy could serve as allograft for the treatment of skin loss.
  11. Chai HC, Chua KH
    Diagnostics (Basel), 2022 Nov 29;12(12).
    PMID: 36552996 DOI: 10.3390/diagnostics12122989
    Blood remains the specimen of preference for malaria diagnosis, whether it is for microscopic, nucleic acid-based or biomarker detection of Plasmodium present in a patient. However, concerning the disadvantages of blood drawing, specimens that can be non-invasively collected under non-hygienic settings would come in handy for malaria diagnosis in endemic areas with limited resources. Although the current approaches using saliva or urine might not be as sensitive and specific as using blood, the potential of these two specimens should not be underestimated and efforts in developing diagnostic methods for Plasmodium detection specifically in these two specimens should continue without giving up. This review not only compiles and summarizes the sensitivity and specificity achieved by various detection approaches when using these samples for malaria diagnosis, it also intends to enhance the possibility of using saliva and urine for diagnostic purposes by describing how Plasmodium nucleic acid and antigens may likely be present in these samples. This review may hopefully encourage and motivate researchers in developing saliva- and urine-based diagnostic methods for Plasmodium detection to facilitate the control and eradication of malaria. In summary, the presence of Plasmodium DNA and antigens in urine and saliva makes these two specimens relevant and useful for malaria diagnosis.
  12. Abdul Rahman H, Manzor NF, Tan GC, Tan AE, Chua KH
    Med J Malaysia, 2008 Jul;63 Suppl A:57-8.
    PMID: 19024982
    Angiogenic induction was made to promote angiogenesis by differentiating stem cells towards endothelial cells. However, the stemness property of induced cells has not been revealed yet. Hence, we aim to evaluate the differential mRNA expression of stemness genes in human chorion-derived stem cells (CDSC) after being cultured in EDM50 comprised bFGF and VEGF. Results indicated that CDSC cultured in EMD50 expressed significantly higher mRNA level of Sox-2, FZD9, BST-1 and Nestin. In addition Oct-4, FGF-4 and ABCG-2 were also upregulated. Our finding suggested that CDSC after angiogenic induction enhanced its stem cell properties. This could be contributed for the mechanism of stem cell therapy in ischemic problem.
  13. Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
  14. Ngui R, Hassan NA, Chang LY, Teh SJC, Chua KH, Kee BP, et al.
    Trop Biomed, 2020 Mar 01;37(1):155-164.
    PMID: 33612726
    Toxoplasma gondii is an obligate intracellular protozoan parasite that causes toxoplasmosis in humans. To date, little is known about T. gondii infection among the indigenous community, particularly in East Malaysia. This study was conducted to determine the status of T. gondii infection and to investigate associated risk factors among the indigenous community of Sarawak, East Malaysia. The sociodemographic data was obtained using a pretested questionnaire. A serological test was done to detect the presence of specific IgM and IgG antibodies against T. gondii in serum samples. A nested polymerase chain reaction (PCR) was used to determine acute infection among seropositive individuals. The overall seroprevalence of T. gondii infection was 50% (95% CI = 43.3 - 56.7). From this subset, 40.1%, 5.7%, and 4.2% were positive for anti-T. Gondii IgG antibodies, IgM, and both IgG and IgM, respectively. Four seropositive samples were amplified through PCR. None of the pregnant women tested positive for T. gondii infection based on the serological and PCR assays. A significant association was found between age, low monthly household income, unemployment, usage of untreated water and close contact with T. gondii seropositive cats. These results provide basic information on T. gondii infection and may be useful for policymakers to initiate prevention and control programs, especially amongst pregnant women and women of childbearing age in the indigenous community.
  15. Chia LL, Jantan I, Chua KH
    Curr Pharm Biotechnol, 2017;18(7):560-568.
    PMID: 28786357 DOI: 10.2174/1389201018666170808144703
    BACKGROUND: Tocotrienols (T3) are the naturally occurring vitamin E derivatives that possess antioxidant properties and therapeutic potential in diabetic complications. The bioactivities of the derivatives are determined by the number and arrangement of methyl substitution on the structure.

    OBJECTIVE: The objective of this study was to determine the effects of T3 derivatives, σ-T3, γ-T3 and α-T3 on insulin secretion of rat pancreatic islets in a dynamic culture.

    METHOD: Pancreatic islets isolated from male Wistar rats were treated with T3 for 1 h at 37°C in a microfluidic system with continuous operation that provided a stable cell culture environment. Glucose (2.8 mM and 16.7 mM, as basal and stimulant, respectively) and potassium chloride (KCl) (30 mM) were added to the treatment in calcium free medium. The supernatant was collected for insulin measurements.

    RESULTS: Short-term exposure (1 h) of σ-T3 to β cells in the stimulant glucose condition significantly potentiated insulin secretion in a dose-dependent manner. γ-T3 and α-T3 also displayed dosedependent effect but were less effective in the activation of insulin secretion. Essentially, KCl, a pancreatic β cell membrane depolarizing agent, added into the treatment further enhanced the insulin secretion of σ-T3, γ-T3 and α-T3 with ED50 values of 504, 511 and 588 µM, respectively.

    CONCLUSION: The findings suggest the potential of σ-T3 in regulating glucose-stimulated insulin secretion (GSIS) in response to the intracellular calcium especially in the presence of KCl.

  16. Makpol S, Durani LW, Chua KH, Mohd Yusof YA, Ngah WZ
    J Biomed Biotechnol, 2011;2011:506171.
    PMID: 21541185 DOI: 10.1155/2011/506171
    This study determined the molecular mechanisms of tocotrienol-rich fraction (TRF) in preventing cellular senescence of human diploid fibroblasts (HDFs). Primary culture of HDFs at various passages were incubated with 0.5 mg/mL TRF for 24 h. Telomere shortening with decreased telomerase activity was observed in senescent HDFs while the levels of damaged DNA and number of cells in G(0)/G(1) phase were increased and S phase cells were decreased. Incubation with TRF reversed the morphology of senescent HDFs to resemble that of young cells with decreased activity of SA-β-gal, damaged DNA, and cells in G(0)/G(1) phase while cells in the S phase were increased. Elongated telomere length and restoration of telomerase activity were observed in TRF-treated senescent HDFs. These findings confirmed the ability of tocotrienol-rich fraction in preventing HDFs cellular ageing by restoring telomere length and telomerase activity, reducing damaged DNA, and reversing cell cycle arrest associated with senescence.
  17. Nur Azlina MF, Kamisah Y, Chua KH, Qodriyah HM
    PMID: 23970937 DOI: 10.1155/2013/804796
    The present study aims to distinguish the effect of tocotrienol on an important gastric protective factor, prostaglandin E2 (PGE2), in stress-induced gastric injury. Twenty-eight Wistar rats were divided into four groups of seven rats each. Two control groups were fed commercial rat diet, and two treatment groups were fed the same diet but with additional dose of omeprazole (20 mg/kg) or tocotrienol (60 mg/kg). After 28 days, rats from one control group and both treated groups were subjected to water-immersion restraint stress for 3.5 hours once. The rats were then sacrificed, their stomach isolated and gastric juice collected, lesions examined, and gastric PGE2 content and cyclooxygenase (COX) mRNA expression were determined. Both the regimes significantly attenuated the total lesion area in the stomach compared to the control. Gastric acidity, which was increased in stress, was significantly reduced in rats supplemented with omeprazole and tocotrienol. The PGE2 content was also significantly higher in the rats given tocotrienol supplementation compared to the control followed by an increase in COX-1 mRNA expression. We conclude that tocotrienol supplementation protected rat gastric mucosa against stress-induced lesions possibly by reducing gastric acidity and preserving gastric PGE2 by increasing COX-1 mRNA.
  18. Munirah S, Aminuddin BS, Chua KH, Fuzina NH, Isa MR, Ruszymah BH
    Med J Malaysia, 2004 May;59 Suppl B:9-10.
    PMID: 15468793
    Autologous cells are usually preferred in treating damaged tissue to avoid risks of immunological rejection and transmitting infectious diseases. Since only limited amount of tissue can be obtained without causing morbidity at the donor site, in vitro expansion of isolated cell is essential in order to acquire sufficient number of cells to reconstruct neocartilage. The aim of this study was to examine whether serial expanded chondrocytes can be use to generate neocartilage in vivo.
  19. Che Hamzah AM, Yeo CC, Puah SM, Chua KH, A Rahman NI, Abdullah FH, et al.
    J Med Microbiol, 2019 Sep;68(9):1299-1305.
    PMID: 31140965 DOI: 10.1099/jmm.0.000993
    The spread of multidrug-resistant Staphylococcus aureus is a public health concern. The inducible macrolide-lincosamide-streptogrammin B (iMLSB ) phenotype (or inducible clindamycin resistance) is associated with false clindamycin susceptibility in routine laboratory testing and may lead to treatment failure. Tigecycline resistance remains rare in S. aureus worldwide. This study aims to determine the antimicrobial susceptibility profiles of clinical isolates of S. aureus obtained from the main tertiary hospital in Terengganu state, Malaysia, from July 2016 to June 2017. The antimicrobial susceptibilities of 90 methicillin-resistant S. aureus (MRSA) and 109 methicillin-susceptible S. aureus (MSSA) isolates were determined by disc diffusion with the iMLSB phenotype determined by D-test. Multidrug resistance (MDR) and the iMLSB phenotype were more prevalent in MRSA (84.4 and 46.7  %, respectively) compared to MSSA isolates. All five tigecycline-resistant isolates were MRSA. The high incidence of MDR and the iMLSB phenotype and the emergence of tigecycline resistance in the Terengganu S. aureus isolates warrants continuous vigilance.
  20. Safinaz MK, Norzana AG, Hairul Nizam MH, Ropilah AR, Faridah HA, Chua KH, et al.
    Cell Tissue Bank, 2014 Dec;15(4):619-26.
    PMID: 24633432 DOI: 10.1007/s10561-014-9436-y
    The purpose of this study was to compare the use of autologous fibrin to human amniotic membrane (HAM) as a scaffold in cultivating autologous conjunctiva for transplantation in treatment of conjunctival defect. An experimental study was performed using 18 adult New Zealand white strain rabbits which were divided into 3 groups. Each group consists of 6 rabbits. The conjunctiva on the temporal site was excised to create a conjunctival epithelial defect. The excised area in the Group 1 was transplanted with autologous conjunctiva cultivated on autologous fibrin; Group 2 was transplanted with autologous conjunctiva cultivated on HAM and Group 3 was left bare. The rabbits were followed up at regular intervals until 6 weeks. The mean period of complete conjunctival epithelization was 11.50 ± 8.22 days for the autologous fibrin group, 15.33 ± 11.80 days for the HAM group and 25.33 ± 5.32 days in the bare sclera group. The epithelization rate for the autologous fibrin group was faster compared to the other two groups. However all the results were not statistically significant (p value >0.05). There were no postoperative complications noted during the follow up. Autologous fibrin is comparable to HAM as a scaffold for cultivation of conjunctiva in the treatment of conjunctival defect.
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links