Mesenchymal stem cells (MSCs) derived from human umbilical cord (UC) have been considered as an important tool for treating various malignancies, tissue repair and organ regeneration. Umbilical cord-derived mesenchymal stem cells (UC-MSCs) are better alternative to MSCs that derived from bone marrow (BM-MSCs) as they are regarded as medical waste with little ethical concern for research and easily culture-expanded. In this present study, the foetal distal end of human UC was utilised to generate MSC by explant method. Upon in vitro culture, adherent cells with fibroblastic morphology were generated with rapid growth kinetics. Under the respective inductive conditions, these cells were capable of differentiating into adipocytes and osteocytes; express an array of standard MSC's surface markers CD29, CD73, CD90, CD106 and MHC-class I. Further assessment of immunosuppression activity revealed that MSCs generated from UC had profoundly inhibited the proliferation of mitogen-activated T lymphocytes in a dosedependent manner. The current laboratory findings have reinforced the application of explant method to generate UCMSCs thus, exploring an ideal platform to fulfil the increasing demand of MSCs for research and potential clinical use.
This study concerned the identification of the beta-thalassaemia mutations that were present in 27 Malay patients with Hb E-beta-thalassaemia and seven Malay patients with thalassaemia major who were from West Malaysia. Nearly 50% of all beta-thalassaemia chromosomes carried the G----C substitution at nucleotide 5 of IVS-I; the commonly occurring Chinese anomalies such as the frameshift at codons 41 and 42, the nonsense mutation A----T at codon 17, the A----G substitution at position -28 of the promoter region, and the C----T substitution at position 654 of the second intron, were rare or absent. Two new thalassaemia mutations were discovered. The first involves a frameshift at codon 35 (-C) that was found in two patients with Hb E-beta zero-thalassaemia and causes a beta zero-thalassaemia because a stop codon is present at codon 60. The second is an AAC----AGC mutation in codon 19 that was present on six chromosomes. This substitution results in the production of an abnormal beta chain (beta-Malay) that has an Asn----Ser substitution at position beta 19. Hb Malay is a 'Hb Knossos-like' beta +-thalassaemia abnormality; the A----G mutation at codon 19 likely creates an alternate splicing site between codons 17 and 18, reducing the efficiency of the normal donor splice site at IVS-I to about 60%.
The molecular basis of variable phenotypes in P-thalassaemia patients with identical genotypes has been associated with co-inheritance of alpha-thalassaemia and persistence of HbF production in adult life. The Xmn I restriction site at -158 position of the Ggamma-gene is associated with increased expression of the Ggamma-globin gene and higher production of HbF This study aims to determine the frequency of the digammaferent genotypes of the Ggamma Xmn I polymorphism in P-thalassaemia patients in two ethnic groups in Malaysia. Molecular characterisation and frequency of the Ggamma Xmn I polymorphism were studied in fifty-eight Chinese and forty-nine beta-thalassaemia Malay patients by Xmn I digestion after DNA amplification of a 650 bp sequence. The in-house developed technique did not require further purification or concentration of amplified DNA before restriction enzyme digestion. The cheaper Seakem LE agarose was used instead of Nusieve agarose and distinct well separated bands were observed. Genotyping showed that the most frequent genotype observed in the Malaysian Chinese was homozygosity for the absence of the Xmn I site (-/-) (89.7%). In the Malays, heterozygosity of the Xmn I site (+/-) was most common (63.3%). Homozygosity for the Xmn I site (+/+) was absent in the Chinese, but was confirmed in 8.2% of the Malays. The ratio of the (+) allele (presence of the Xmn I site) to the (-) allele (absence of the Xmn I site)) was higher in the Malays (0.66) compared to the Chinese (0.05). The (+/-) and (+/+) genotypes are more commonly observed in the Malays than the Chinese in Malaysia.
Thalassaemia is a common public health problem in Malaysia and about 4.5 to 6% of the Malays and Chinese are carriers of this genetic disorder. The major forms of thalassaemia result in death in utero of affected foetuses (α-thalassaemia) or life-long blood transfusions for survival in β-thalassaemia. This study, the first nationwide population based survey of thalassaemia in Malaysia, aimed to determine differences in public awareness, perceptions and attitudes toward thalassaemia in the multi-racial population in Malaysia.
Hemoglobin disorders which include thalassemias are the most common heritable disorders. Effective treatment is available, and these disorders can be avoided as identification of carriers is achievable using simple hematological tests. An in-depth understanding of the awareness, attitudes, perceptions, and screening reservations towards thalassemia is necessary, as Malaysia has a multi-ethnic population with different religious beliefs. A total of 13 focus group discussions (70 participants) with members of the general lay public were conducted between November 2008 and January 2009. Lack of knowledge and understanding about thalassemia leads to general confusions over differences between thalassemia carriers and thalassemia major, inheritance patterns, and the physical and psychologically impact of the disorder in affected individuals and their families. Although most of the participants have not been tested for thalassemia, a large majority expressed willingness to be screened. Views on prenatal diagnosis and termination of fetuses with thalassemia major received mixed opinions from participants with different religions and practices. Perceived stigma and discrimination attached to being a carrier emerged as a vital topic in some group discussions where disparity in the answers exhibited differences in levels of participants' literacy and ethnic origins. The two most common needs identified from the discussion were information and screening facilities. Participants' interest in knowing the severity of the disease and assessing their risk of getting the disorder may imply the health belief model as a possible means of predicting thalassemia public screening services. Findings provide valuable insights for the development of more effective educational, screening, and prenatal diagnostic services in the multi-ethnic Asian society.
BACKGROUND/AIMS: Individuals with double heterozygosity for alpha- and beta-thalassaemia and heterozygous beta-thalassaemia show a similar haematological picture. Co-inheritance of alpha- and beta-thalassaemia in both partners may result in pregnancies with either Hb Bart's hydrops foetalis or beta-thalassaemia major, or pregnancies with both disorders.
METHODS: The co-inheritance of alpha-thalassaemia in 322 beta-thalassaemia carriers in Malaysia was studied.
RESULTS: The frequency of alpha-thalassaemia in the beta-thalassaemia carriers was 12.7% (41/322), with a carrier frequency of 7.8% for the SEA deletion, 3.7% for the -alpha(3.7) deletion, 0.9% for Hb Constant Spring and 0.3% for the -alpha(4.2) deletion.
CONCLUSION: Double heterozygosity for alpha- and beta-thalassaemia was confirmed in 5 out of the 41 couples and the risk of the fatal condition Hb Bart's hydrops foetalis was confirmed in two of these couples. Detection of the Southeast Asian (SEA) deletion in the Malaysian Malays in this study confirms that Hb Bart's hydrops foetalis can occur in this ethnic group. Results of this study have provided new information on the frequency and different types of alpha-thalassaemia (--(SEA), -alpha(3.7) and -alpha(4.2) deletions, Hb Constant Spring) in Malaysian beta-thalassaemia carriers.
BACKGROUND: The interaction of the non-deletional α(+)-thalassaemia mutations Haemoglobin Constant Spring and Haemoglobin Quong Sze with the Southeast Asian double α-globin gene deletion results in non-deletional Haemoglobin H disease. Accurate detection of non-deletional Haemoglobin H disease, which is associated with severe phenotypes, is necessary as these mutations have been confirmed in the Malaysian population.
METHODS: DNA from two families with Haemoglobin H disease was extracted from EDTA-anticoagulated whole blood and subjected to molecular analysis for α-thalassaemia. A duplex polymerase chain reaction was used to detect the Southeast Asian α-globin gene deletion. Polymerase chain reaction-restriction fragment length polymorphism analysis was then carried out to determine the presence of Haemoglobin Constant Spring and Haemoglobin Quong Sze. A combine-amplification refractory mutation system protocol was optimised and implemented for the rapid and specific molecular characterisation of Haemoglobin Constant Spring and Haemoglobin Quong Sze in a single polymerase chain reaction.
RESULTS AND CONCLUSIONS: The combine-amplification refractory mutation system for Haemoglobin Constant Spring and Haemoglobin Quong Sze, together with the duplex polymerase chain reaction, provides accurate pre- and postnatal diagnosis of non-deletional Haemoglobin H disease and allows detailed genotype analyses using minimal quantities of DNA.
KEYWORDS: Combine-ARMS; Hb Constant Spring; Hb Quong Sze; medical sciences
Mesenchymal stem cells (MSC) generated from human umbilical cord (UC-MSC) and placenta (PLC-MSC) were assessed and compared for their immunomodulatory function on T cells proliferation by analysis of the cell cycle. Mitogen stimulated or resting T cells were co-cultured in the presence or absence of MSC. T-cell proliferation was assessed by tritiated thymidine ((3) H-TdR) assay and the mechanism of inhibition was examined bycell cycle and apoptosis assay. Both UC-MSC and PLC-MSC profoundly inhibited the proliferation of T-cell, mainly via cell-to-cell contact. MSC-mediated anti-proliferation does not lead to apoptosis,but prevented T cells from entering S phase and they therefore accumulated in the G(0) /G(1) phases. The anti-proliferative activity of MSC was related to this cell cycle arrest of T-cell. UC-MSC produced a greater inhibition than PLC-MSC in all measured parameters.
Since the discovery of gonadotropin-releasing hormone (GnRH) in mammals at the beginning of the 1970s, it was generally accepted that GnRH is the only hypothalamic neuropeptide regulating gonadotropin release in mammals and other vertebrates. In 2000, however, gonadotropin-inhibitory hormone (GnIH), a novel hypothalamic neuropeptide that actively inhibits gonadotropin release, was discovered in quail. Numerous studies over the past decade and a half have demonstrated that GnIH serves as a key player regulating reproduction across vertebrates, acting on the brain and pituitary to modulate reproductive physiology and behavior. In the latter case, recent evidence indicates that GnIH can regulate reproductive behavior through changes in neurosteroid, such as neuroestrogen, biosynthesis in the brain. This review summarizes the discovery of GnIH, and the contributions to GnIH research focused on its mode of action, regulation of biosynthesis, and how these findings advance our understanding of reproductive neuroendocrinology.
Management of Beta (β)-thalassaemia intermedia in contrast to β-thalassaemia major patients has no clear guidelines as to indicators of adequate transfusion. Regular blood transfusion suppresses bone marrow erythropoietic activity. Serum soluble transferrin receptor (sTfR) concentration is a marker for erythropoietic activity, with increased sTfR being associated with functional iron deficiency and increased erythropoietic activity. This study aimed to determine the use of sTfR as an indicator of adequate transfusion in adult β-thalassaemia intermedia patients. A cross-sectional study was conducted at Hospital Ampang, Malaysia, for six months. Patient group included six β-thalassaemia intermedia and 34 HbE-β-thalassaemia transfused patients. None of the patients were on regular monthly blood transfusions as in β-thalassaemia major. The control group comprised of 16 healthy subjects with normal haematological parameters. Haemoglobin (Hb) analysis, sTfR and ferritin assays were performed. Hb and HbA percentages (%) were found to be significantly lower in patients compared to the controls, while HbE%, HbF%, sTfR and ferritin were significantly higher in patients. An inverse relationship was found in the controls between HbF% with Hb (r = -0.515, p < 0.05) and HbA% (r = -0.534, p < 0.05). In patients, sTfR showed an inverse relationship with HbA% (r = -0.618, p = 0.000) and a positive correlation with HbE% (r = 0.418, p = 0.007) and HbF% (r = 0.469, p = 0.002). Multivariate analysis showed that HbA% (r = 2.875, p = 0.048), HbE% (r = 2.872, p = 0.020) and HbF% (r = 2.436, p = 0.013) best predicted sTfR independently in patients. Thus, sTfR is a useful marker for erythropoiesis. The elevated sTfR in these patients indicate that the transfusion regimen used was inadequate to suppress ineffective erythropoiesis. Hb levels may not be the best target for monitoring transfusion treatment in β-thalassaemia intermedia patients, but the use of sTfR is helpful in individualising transfusion regimens.
BACKGROUND: The principal cause of iron overload in patients with haematological malignancies is recurrent red cell transfusions for anaemia. The serum ferritin level reflects the iron burden in the body, in the absence of inflammation or liver disease. In Malaysia, data are lacking on the association between pre-transplant serum ferritin levels and outcome after allogeneic haemopoietic stem cell transplant.
METHODS: We did a cross-sectional study using retrospective data of 106 post-allogeneic haemopoietic stem cell transplant patients (HLA-matched sibling) with haematological malignancies at Hospital Ampang to determine the relationship between pre-transplant serum ferritin levels and post-transplant outcome, post-transplant complications and survival time. Patients were divided into two groups according to the iron status: serum ferritin level >1000 μg/L (iron overload) and <1000 μg/L.
RESULTS: The median age for patients was 30.5 (18-58) years. The median pre-transplantation serum ferritin level and the prevalence of pre-transplantation iron overload were 2423 (408.2-7664) μg/L and 87.5%, respectively. No significant association was found between iron status and demographic factors, type of haematological malignancy and post-transplant complications. Although insignificant, patients with iron overload had a shorter survival time (36 months) compared to those with no iron overload (40 months). There was also no significant association between the iron status and post-transplant outcome. Significant post-transplant complications associated with post-transplant outcome were the need for total parenteral nutrition (TPN) (p=0.014) and chronic graft-versus-host disease (GVHD) (p=0.008). Similarly, significant associations were found between age group (p=0.003), TPN (p=0.035) and chronic GVHD (p=0.012) with survival time using Kaplan-Meir analysis. However, after Cox regression, only age group was found to be significantly associated with survival time (p=0.014).
CONCLUSION: Serum ferritin is an acute phase reactant and its levels increase in the presence of tissue necrosis and inflammation. Both these events occur in haematological malignancies. Although serum ferritin level is a non-invasive, relatively cost-effective, widely available and practical indicator of iron status, it is not specific to iron overload. Therefore, a true association between the serum ferritin level and iron burden is problematic in patients with haematological malignancies.
The risk of coronary heart disease (CHD) is dramatically increased in diabetic patients due to their atherogenic lipid profile. The severity of CHD in diabetic patients has been found to be directly associated with glycated haemoglobin (HbA1c). According to the Malaysian Clinical Practice Guidelines on diabetes mellitus (DM), HbA1c level less than 6.5% reduces the risk of microvascular and macrovascular complications. Hence, this study aimed to determine the relationship between dyslipidaemia and glycaemic status in patients with type 2 DM (T2DM) patients in Hospital Putrajaya, a tertiary endocrine centre in Malaysia. This was a cross sectional, retrospective study of 214 T2DM patients with dyslipidaemia who had visited the endocrine clinic between January 2009 and December 2012. Significant correlations were found between fasting blood glucose (FBG) and HbA1c with total cholesterol (TC), triglyceride (TG), low density lipoprotein cholesterol (LDL), non-high density lipoprotein cholesterol (non-HDL), LDL/HDL ratio and TC/HDL ratio; greater correlation being with HbA1c than FBG. In patients with HbA1c ≥ 6.5%, TC, TG, non-HDL and TC/HDL ratio were significantly higher than in patients with HbA1c < 6.5%. Non-HDL, LDL/HDL ratio, TC/HDL ratio and HbA1c were significantly lower in patients on statin treatment than nontreated patients (p<0.05). This significant association between glycaemic status and dyslipidaemia emphasises the additional possible use of HbA1c as a biomarker for dyslipidaemia as well as a potential indirect predictor of cardiovascular disease (CVD) risk in T2DM patients.
Patients with diabetes have an earlier onset and increased severity of anaemia compared to those with similar degree of renal impairment from other causes. Anaemia is associated with an increased risk of vascular complications. In this study, we determined the prevalence of anaemia in T2DM patients and its association with sociodemographic, clinical and laboratory parameters in an endocrine tertiary hospital in Malaysia. This was a cross-sectional study using retrospective electronic data from January 2011 to December 2013 of 165 T2DM patients in Hospital Putrajaya. Data was analysed using IBM SPSS Statistics version 21.0 for Windows. The prevalence of anaemia was 39.4% and majority had normocytic normochromic (80%), mild (58.5%) anaemia. Majority were Malays (73.9%), aged below 60 with comparable gender percentage and long-standing, poorly-controlled DM [median fasting blood sugar (FBS) 8mmol/L; glycated haemoglobin (HbA1c) 7.9%]. Using the KDIGO chronic kidney disease (CKD) staging system, 86% of these patients were in stages 3-5. Anaemic patients had a significantly higher serum urea, creatinine and a lower FBS, estimated glomerular filtration rate (eGFR) compared to non-anaemic patients. Anaemic patients with diabetic nephropathy had a significantly lower haemoglobin (Hb) compared to those without this complication (p=0.022). The sensitivity and specificity at a cut-off eGFR value of 38.3 ml/min/1.73 m2 (maximum Youden index = 0.462) was 66.7% and 79.5%, respectively to discriminate mild from moderate anaemia. This study shows that anaemia is already present in T2DM patients in Hospital Putrajaya at initial presentation to the specialist outpatient clinic and is significantly associated with CKD. Hence, it emphasises the obligatory need for routine and follow-up full blood count monitoring in T2DM patients in primary care as well as tertiary settings in Malaysia to enable early detection and aggressive correction of anaemia in preventing further complications.
In Malaysia, β-thalassaemia is a common inherited blood disorder in haemoglobin synthesis with a carrier rate of 4.5%. Currently, PCR-incorporating techniques such as amplification refractory mutation system (ARMS) or reverse dot blot hybridization (RDBH) are used in β-thalassaemia mutation detection. ARMS allows single-mutation identification using two reactions, one for wild type and another for mutant alleles. RDBH requires probe immobilization and optimization of hybridization and washing temperatures which is time consuming. The aim of our study was to investigate whether β-thalassaemia mutations can be identified in samples with low DNA concentrations.
Beta-thalassemia is one of the most prevalent inherited diseases and a public health problem in Malaysia. Malaysia is geographically divided into West and East Malaysia. In Sabah, a state in East Malaysia, there are over 1000 estimated cases of β-thalassemia major patients. Accurate population frequency data of the molecular basis of β-thalassemia major are needed for planning its control in the high-risk population of Sabah. Characterization of β-globin gene defects was done in 252 transfusion dependent β-thalassemia patients incorporating few PCR techniques. The study demonstrates that β-thalassemia mutations inherited are ethnically dependent. It is important to note that 86.9% of transfusion-dependent β-thalassemia major patients in Sabah were of the indigenous population and homozygous for a single mutation. The Filipino β(0)-deletion was a unique mutation found in the indigenous population of Sabah. Mutations common in West Malaysia were found in 11 (4.3%) patients. Four rare mutations (Hb Monroe, CD 8/9, CD 123/124/125 and IVS I-2) were also found. This study is informative on the population genetics of β-thalassemia major in Sabah.
Alpha thalassaemia is one of the haemoglobin disordersin which the carriers of alpha thalassaemia may have normal haemoglobin level and are eligible to donate blood which may bring complications. This study is to investigate the interaction of haematological parameter with α-globin genotypes among eligible blood donors. Materials & Methods: A cohort study with 270 eligible blood donors were analysed for red cell indices. Alpha-globin (α-globin) genotyping was performed for seven deletions, six point mutations and two triplications. Statistical analyses were performed to compare the α-globin genotypes with haematological data. Results: High prevalence of α-thalassaemia carriers (7.7%, 21/270) was found among blood donors. All of them did not show anaemic pictures with a normal Hb level (>12 gm/dl). Five genotypes were identified consisting of 249 αα/αα (92.2%), nine -α3.7/αα (3.3%), nine--SEA/αα (3.3%), two -α4.2/αα (0.7%) and one ααCS/αα (0.4%). Different α-globin genotypes showed a significant difference in RBC, MCV, MCH, MCHC, RDW, and Hct/Hb ratio (p
The optimal training of the highly specialized congenital heart surgeon is a long and complex process, which is a significant challenge in most parts of the world. The World Society for Pediatric and Congenital Heart Surgery (WSPCHS) has established the Global Council on Education for Congenital Heart Surgery as a nonprofit organization with the goal of assessing current training and certification and ultimately establishing standardized criteria for the training, evaluation, and certification of congenital heart surgeons around the world. The Global Council and the WSPCHS have reviewed the present status of training and certification for congenital cardiac surgery around the world. There is currently lack of consensus and standardized criteria for training in congenital heart surgery, with significant disparity between continents and countries. This represents significant obstacles to international job mobility of competent congenital heart surgeons and to the efforts to improve the quality of care for patients with Congenital Heart Disease worldwide. The purpose of this article is to summarize and document the present state of training and certification in congenital heart surgery around the world.
Objectives: This study aimed to evaluate the UBI MAGIWELTM ζ-GLOBIN ELISA Kit for the presumptive diagnosis of αo-thalassaemia. The ELISA results obtained were confirmed by molecular characterisation of αo-thalassaemia using a Duplex-PCR. Methods: Routine peripheral blood counts and red cell indices were determined in 94 blood samples sent for Hb analysis. Hb subtypes were quantified by high performance liquid chromatography (HPLC) and Hb electrophoresis conducted on agarose gel at pH 8.5. Zeta-globin chain levels were determined using the UBI MAGIWELTM ζ-GLOBIN ELISA Kit. Molecular analysis was performed using a duplex-PCR which simultaneously amplifies
a normal 136 bp sequence between the ψα−α2-globin genes and a 730 bp Southeast Asian deletion-specific sequence (–SEA) between the ψα2−θ1-globin genes. Results: Using the ELISA assay kit, 20 blood samples were presumptively identified as α-thalassaemia carriers from elevated ζ-globin chains (OD>0.3) while the remaining 74 blood samples showed OD
BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.