MyMedR

Displaying publications 1 - 20 of 84 in total

Abstract:

Sort:

α-Haemoglobin stabilising protein expression is influenced by mean cell haemoglobin and HbF levels in HbE/β-thalassaemia individuals

Lim WF, Muniandi L, George E, Sathar J, Teh LK, Gan GG, et al.

Blood Cells Mol. Dis., 2012 Jan 15;48(1):17-21.
PMID: 22079025 DOI: 10.1016/j.bcmd.2011.10.002

The alpha haemoglobin stabilising protein (AHSP) acts as a molecular chaperone for α-globin by stabilising nascent α-globin before transferring it to waiting free β-globin chains. Binding of AHSP to α-globin renders α-globin chemically inert whereby preventing it from precipitating and forming reactive oxygen species byproducts. The AHSP has been actively studied in the recent years, particularly in its relation to β-thalassaemia. Studies have shown that AHSP is a modifier in β-thalassaemia mice models. However, this relationship is less established in humans. Studies by some groups showed no correlation between the AHSP haplotypes and the severity of β-thalassaemia, whereas others have shown that certain AHSP haplotype could modify the phenotype of β-thalassaemia intermedia patients. We investigated the expression of AHSP in relation to selected demographic data, full blood count, HPLC results, HbE/β-thalassaemia genotype, Xmn-1 Gγ polymorphism, α-globin, β-globin and γ-globin expression. We found that AHSP expression was significantly correlated to mean cell haemoglobin level, HbF %, α-globin, β-globin and excess α-globin expression. We concluded that AHSP could be a secondary compensatory mechanism in red blood cells to counterbalance the excess α-globin chains in HbE/β-thalassaemia individuals.
Types of thalassemia among patients attending a large university clinic in Kuala Lumpur, Malaysia

George E, Li HJ, Fei YJ, Reese AL, Baysal E, Cepreganova B, et al.

Hemoglobin, 1992;16(1-2):51-66.
PMID: 1634362

We have identified the beta-thalassemia mutations in 59 patients with thalassemia major and 47 patients with Hb E-beta-thalassemia, and the deletional and nondeletional alpha-thalassemia determinants in 23 out of 24 patients with Hb H disease. All persons were attending the Haematology Clinic at the National University of Malaysia in Kuala Lumpur (Malaysia). Most patients (76) were of Malay descent, while 52 patients were Chinese, and two came from elsewhere. The most frequently occurring beta-thalassemia alleles among the Malay patients were IVS-I-5 (G----C) and G----A at codon 26 (Hb E), while a few others were present at lower frequencies. The Chinese patients carried the mutation characteristic for Chinese [mainly codons 41/42 (-TTCT) and IVS-II-654 (C----T)]; Malay mutations were not observed among Chinese and Chinese mutations were virtually absent in the Malay patients. The large group of patients with Hb E-beta-thalassemia and different beta-thalassemia alleles offered the opportunity of comparing hematological data; information obtained for patients with Hb E-beta-thalassemia living in other countries was included in this comparison. Twenty-three patients with Hb H disease carried the Southeast Asian (SEA) alpha-thalassemia-1 deletion; 13 had the alpha CS alpha (Constant Spring) nondeletional alpha-thalassemia-2 determinant, while the deletional alpha-thalassemia-2 (-3.7 or -4.2 kb) was present in 10 subjects. The --/alpha CS alpha condition appeared to be the most severe with higher Hb H values. Both deletional and nondeletional types of alpha-thalassemia-2 were seen among Malay and Chinese patients.
Two novel polyadenylation mutations leading to beta(+)-thalassemia

Jankovic L, Efremov GD, Petkov G, Kattamis C, George E, Yang KG, et al.

Br J Haematol, 1990 May;75(1):122-6.
PMID: 2375910

In an ongoing effort to identify point mutations causing beta-thalassaemia, we have found two previously unreported mutations which are located in the Poly A site of the beta-globin gene. The screening programme used amplified DNA and dot-blot hybridization with several 32P-labelled oligonucleotide probes. DNA samples which remained unidentified by this methodology were subjected to sequencing with 32P-labelled primers and modified T7 DNA polymerase. The newly discovered mutations were confirmed by the dot-blot hybridization technique. One type concerned an AATAAA----AATGAA mutation in the polyadenylation site and was found in one family from Yugoslavia (including one patient with the C----T mutation at codon 29 in trans), one from Bulgaria (the patient had the G----A mutation at IVS-I-110 in trans), and one from Greece (this patient had the C----G mutation at IVS-II-745 in trans). Haematological data for three simple heterozygotes suggested a rather mild beta(+)-thalassemia. The second type involved an AATAAA----AATAGA mutation and was found in one family from Malaysia. The propositus had the beta E mutation on the other chromosome, was originally diagnosed as mild Hb E-beta(+)-thalassaemia, and had Hb A and Hb E percentages which were nearly the same.
Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations

Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.

Public Health Genomics, 2015;18(1):60-4.
PMID: 25412720 DOI: 10.1159/000368342

BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
The use of Taqman genotyping assays for rapid confirmation of β-thalassaemia mutations in the Malays: accurate diagnosis with low DNA concentrations

Teh LK, Lee TY, Tan JA, Lai MI, George E

Int J Lab Hematol, 2015 Feb;37(1):79-89.
PMID: 24725998 DOI: 10.1111/ijlh.12240

In Malaysia, β-thalassaemia is a common inherited blood disorder in haemoglobin synthesis with a carrier rate of 4.5%. Currently, PCR-incorporating techniques such as amplification refractory mutation system (ARMS) or reverse dot blot hybridization (RDBH) are used in β-thalassaemia mutation detection. ARMS allows single-mutation identification using two reactions, one for wild type and another for mutant alleles. RDBH requires probe immobilization and optimization of hybridization and washing temperatures which is time consuming. The aim of our study was to investigate whether β-thalassaemia mutations can be identified in samples with low DNA concentrations.
The clinical severity of beta-thalassemia mutations in West Malaysia

George E

Southeast Asian J. Trop. Med. Public Health, 1995;26 Suppl 1:225-8.
PMID: 8629111

Beta-thalassemia in West Malaysia is caused by 14 molecular defects with differing clinical severity. In Chinese patients from West Malaysia, the main beta-thalassemia mutations seen were (a) a 4 base pair-TCTT deletion in codon 41-42 [frameshift mutation (FSC 41-42)]; (b) a C to T substitution at the second intervening sequence (IVS2-654); (c) an A to G substitution in the TATA box [-28 (A to G)], and (d) an A to T substitution in codon 17[17 A to T]. In the Malays, the main mutations seen were (a) a G to C in nucleotide 5 at the intervening sequence I [IVS1-5 (G to C)]; (b) G to T substitution in nucleotide I at the intervening sequence I [IVS1-1 (G to T)]; (c) a A to T substitution in codon 17 (17 A to T); (d) removal of C from codon 35 [codon 35 (-C)], and (e) a 4 base pairs-TCTT deletion in codon 41-42 [frameshift mutation (FSC 41-42)]. A scoring system (Tha1 CS) has been formulated to predict clinical severity. It is the type of beta-thalassemia mutation present that decides on the clinical phenotype. The most severe beta-thalassemia mutation is assigned a score of 4. A score of 8 indicates severe thalassemia.
Thalassemia intermedia in HbH-CS disease with compound heterozygosity for beta-thalassemia: challenges in hemoglobin analysis and clinical diagnosis

Tan JA, Kok JL, Tan KL, Wee YC, George E

Genes Genet Syst, 2009 Feb;84(1):67-71.
PMID: 19420802

Co-inheritance of alpha-thalassemia with homozygosity or compound heterozygosity for beta-thalassemia may ameliorate beta-thalassemia major. A wide range of clinical phenotypes is produced depending on the number of alpha-thalassemia alleles (-alpha/alphaalpha --/alphaalpha, --/-alpha). The co-inheritance of beta-thalassemia with alpha-thalassemia with a single gene deletion (-alpha/alphaalpha) is usually associated with thalassemia major. In contrast, the co-inheritance of beta-thalassemia with two alpha-genes deleted in cis or trans (--/alphaalpha or -alpha/-alpha) generally produces beta-thalassemia intermedia. In Southeast Asia, the most common defect responsible for alpha-thalassemia is the Southeast Asian (SEA) deletion of 20.5 kilobases. The presence of the SEA deletion with Hb Constant Spring (HbCS) produces HbH-CS disease. Co-inheritance of HbH-CS with compound heterozygosity for beta-thalassemia is very rare. This study presents a Malay patient with HbH-CS disorder and beta degrees/beta+-thalassemia. The SEA deletion was confirmed in the patient using a duplex-PCR. A Combine-Amplification Refractory Mutation System (C-ARMS) technique to simultaneously detect HbCS and Hb Quong Sze confirmed HbCS in the patient. Compound heterozygosity for CD41/42 and Poly A was confirmed using the ARMS. This is a unique case as the SEA alpha-gene deletion in cis (--SEA/alphaalpha) is generally not present in the Malays, who more commonly possess the two alpha-gene deletion in trans (-alpha/-alpha). In addition, the beta-globin gene mutation at CD41/42 is a common mutation in the Chinese and not in the Malays. The presence of both the SEA deletion and CD41/42 in the mother of the patient suggests the possible introduction of these two defects into the family by marriage with a Chinese.
Fulltext TERT gene harbors multiple variants associated with pancreatic cancer susceptibility

Campa D, Rizzato C, Stolzenberg-Solomon R, Pacetti P, Vodicka P, Cleary SP, et al.

Int J Cancer, 2015 Nov 01;137(9):2175-83.
PMID: 25940397 DOI: 10.1002/ijc.29590

A small number of common susceptibility loci have been identified for pancreatic cancer, one of which is marked by rs401681 in the TERT-CLPTM1L gene region on chromosome 5p15.33. Because this region is characterized by low linkage disequilibrium, we sought to identify whether additional single nucleotide polymorphisms (SNPs) could be related to pancreatic cancer risk, independently of rs401681. We performed an in-depth analysis of genetic variability of the telomerase reverse transcriptase (TERT) and the telomerase RNA component (TERC) genes, in 5,550 subjects with pancreatic cancer and 7,585 controls from the PANcreatic Disease ReseArch (PANDoRA) and the PanScan consortia. We identified a significant association between a variant in TERT and pancreatic cancer risk (rs2853677, odds ratio = 0.85; 95% confidence interval = 0.80-0.90, p = 8.3 × 10(-8)). Additional analysis adjusting rs2853677 for rs401681 indicated that the two SNPs are independently associated with pancreatic cancer risk, as suggested by the low linkage disequilibrium between them (r(2) = 0.07, D' = 0.28). Three additional SNPs in TERT reached statistical significance after correction for multiple testing: rs2736100 (p = 3.0 × 10(-5) ), rs4583925 (p = 4.0 × 10(-5) ) and rs2735948 (p = 5.0 × 10(-5) ). In conclusion, we confirmed that the TERT locus is associated with pancreatic cancer risk, possibly through several independent variants.
Fulltext Spectrum of beta-thalassaemia mutations in transfusion dependent thalassaemia patients: practical implications in prenatal diagnosis

George E, George R, Ariffin WA, Mokhtar AB, Azman ZA, Sivagengei K

Med J Malaysia, 1993 Sep;48(3):325-9.
PMID: 8183146

The study concerned the identification of the beta-thalassaemia mutations that were present in 24 patients with beta-thalassaemia major who were transfusion dependent. The application of a modified polymerase chain reaction, the amplification refractory system (ARMS) was found to be an effective and rapid method for the identification of the beta-thalassaemia mutations. Six different mutations were detected. Seventy five percent of the patients were Chinese-Malaysians and showed the commonly occurring anomalies: 1. frameshift codon 41 and 42 (-TCTT); 2. the C to T substitution at position 654 of intron 2 (IVS-2); 3. the mutation at position -28(A to G); and the nonsense mutation A to T at codon 17. In the Malays, the common mutations seen were: 1. the G to C mutation at position 5 of IVS-1; 2. the G to T mutation at position 1 of intron 1 (IVS-1); and the A to T at codon 17. The delineation of the specific mutations present will enable effective prenatal diagnosis for beta-thalassaemia to be instituted.
Fulltext Specific and straightforward molecular investigation of β-thalassemia mutations in the Malaysian Malays and Chinese using direct TaqMan genotyping assays

Kho SL, Chua KH, George E, Tan JA

Genet. Mol. Res., 2013;12(3):2409-15.
PMID: 23479149 DOI: 10.4238/2013.February.28.4

Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.
Fulltext Serum soluble transferrin receptor concentration as a biomarker of erythropoietic activity: surrogate marker of adequate transfusion in adult beta-thalassaemia intermedia patients

Thambiah, S., George, E., Nor Aini, U., Sathar, J., Zarida, H., Mokhtar, A.B.

Malaysian Journal of Medicine and Health Sciences, 2013;9(2):3-12.
MyJurnal

Management of Beta (β)-thalassaemia intermedia in contrast to β-thalassaemia major patients has no clear guidelines as to indicators of adequate transfusion. Regular blood transfusion suppresses bone marrow erythropoietic activity. Serum soluble transferrin receptor (sTfR) concentration is a marker for erythropoietic activity, with increased sTfR being associated with functional iron deficiency and increased erythropoietic activity. This study aimed to determine the use of sTfR as an indicator of adequate transfusion in adult β-thalassaemia intermedia patients. A cross-sectional study was conducted at Hospital Ampang, Malaysia, for six months. Patient group included six β-thalassaemia intermedia and 34 HbE-β-thalassaemia transfused patients. None of the patients were on regular monthly blood transfusions as in β-thalassaemia major. The control group comprised of 16 healthy subjects with normal haematological parameters. Haemoglobin (Hb) analysis, sTfR and ferritin assays were performed. Hb and HbA percentages (%) were found to be significantly lower in patients compared to the controls, while HbE%, HbF%, sTfR and ferritin were significantly higher in patients. An inverse relationship was found in the controls between HbF% with Hb (r = -0.515, p < 0.05) and HbA% (r = -0.534, p < 0.05). In patients, sTfR showed an inverse relationship with HbA% (r = -0.618, p = 0.000) and a positive correlation with HbE% (r = 0.418, p = 0.007) and HbF% (r = 0.469, p = 0.002). Multivariate analysis showed that HbA% (r = 2.875, p = 0.048), HbE% (r = 2.872, p = 0.020) and HbF% (r = 2.436, p = 0.013) best predicted sTfR independently in patients. Thus, sTfR is a useful marker for erythropoiesis. The elevated sTfR in these patients indicate that the transfusion regimen used was inadequate to suppress ineffective erythropoiesis. Hb levels may not be the best target for monitoring transfusion treatment in β-thalassaemia intermedia patients, but the use of sTfR is helpful in individualising transfusion regimens.
Fulltext Serum ferritin concentrations in transfusion dependent beta-thalassaemia

George E, Wong HB, George R, Ariffin WA

Singapore Med J, 1994 Feb;35(1):62-4.
PMID: 8009283

Patients on a moderate red cell transfusion programme have iron overload where the concentrations of the serum ferritin were inappropriate to increases in the transfusion load as a result of limitations of apoferritin synthesis and conversion of ferritin into haemosiderin. This study confirms the limitations for the use of estimations of the serum ferritin to evaluate the iron status in patients with expected high overload as would be seen in patients on many years of maintenance red cell transfusions in the absence of iron chelation therapy. Poor compliance, inadequate dosage of Desferal (deferoxamine), and the late initiation of iron chelation therapy were factors that were considered in the patients with failure of response to iron chelation.
Fulltext Secondary polycythaemia in a Malay girl with homozygous Hb Tak

Amran HS, Aziz MA, George E, Mahmud N, Lee TY, Md Noor S

Malays J Pathol, 2017 Dec;39(3):321-326.
PMID: 29279598 MyJurnal

Hb Tak is one of more than 200 high affinity haemoglobin variants reported worldwide. It results from the insertion of two nucleotides (AC) at the termination codon, between codon 146 and codon 147 of the beta-globin gene [Beta 147 (+AC)]. Polycythaemia is the main clinical feature although affected carriers are usually asymptomatic and do not require intervention. Several case studies in this region have reported the co-inheritance of Hb Tak with Hb E, delta beta and beta thalassaemia with one case of homozygous Hb Tak in a Thai boy. In this case report, a cluster of haemoglobin Tak was found in a family of Malay ethnic origin. Cascade family screening was conducted while investigating a 4-year old girl who presented with symptomatic polycythaemia. She had 2 previous Hb analysis done, at 7-month and 2-year-old with the diagnosis of possible Hb Q Thailand and Homozygous Hb D, respectively. Both diagnosis did not fit her clinical presentations. She was plethoric, had reduced exercise tolerance as well as cardiomyopathy. Her parents were consanguineously married and later diagnosed as asymptomatic carriers of Hb Tak. Consequently, re-analysis of the girl's blood sample revealed a homozygous state of Hb Tak. In conclusion, high oxygen affinity haemoglobin like Hb Tak should be considered in the investigation of polycythaemic patients with abnormal Hb analyses. In this case, DNA analysis was crucial in determining the correct diagnosis.
Fulltext Screening of concurrent alpha-thalassaemia 1 in beta-thalassaemia carriers

Chong YM, Tan JA, Zubaidah Z, Rahimah A, Kuldip K, George E

Med J Malaysia, 2006 Jun;61(2):217-20.
PMID: 16898315

Thalassaemia is an inherited blood disorder and is a significant public health problem in Malaysia, with many not knowing they carry the gene for thalassaemia. The two major forms are alpha and beta thalassaemia. An individual can co-inherit both the alpha and beta thalassaemia genes. This study determined the frequency of concurrent carriers of alpha thalassaemia in 231 beta thalassaemia carriers. Gap-PCR was done on extracted DNA of the beta thalassaemia samples to check for alpha thalassaemia 1 molecular defect. Eight (3.5%) samples were found to have concurrently inherited the alpha thalassaemia 1 (- -SEA) deletion. The significant carrier rate for alpha thalassaemia 1 indicates the need for the implementation of DNA analysis to complement thalassaemia screening in high risk populations.
Fulltext Screening for thalassaemia in pregnant women: a laboratory perspective

George E, Khoo SK, Mokhtar AB, Nor Aini U

Malaysian Journal of Medicine and Health Sciences, 2005;1(2):111-117.

Aims: To investigate whether in Malaysia, a mean corpuscular volume (MCV) less than 80 fl and a mean corpuscular haemoglobin (MCH) less than 27 pg will identify carriers in pregnant women with severe forms of thalassaemia, a-thal 1 (a0) and classical b (b0)-thalassaemia. The results from this study will aid the implementation of a national program to screen for thalassaemia.
Methods: For classical b (b0)-thalassaemia, blood samples collected in EDTA from 153 pregnant women were taken for full blood counts and haemoglobin subtyping by automated blood counting and high performance liquid chromatography (HPLC) respectively. For a-thal 1 (a0), the full blood counts were obtained from archives of 30 pregnant women who were genotyped positive for the a-thal 1 (a0) during prenatal diagnosis for Hb Barts hydrops fetalis. The effects of storage on MCV, MCH and Hb A2 were determined by tests done daily for 3 weeks.
Results: By correlating red cell indices with high performance liquid chromatography and genotypic data, we show that mean corpuscular volume (MCV) <80 fl and mean corpuscular haemoglobin <27pg is able to detect all heterozygous carriers of a-thal 1 (a0) and classical b (b0)-thalassaemia. On storage, the MCV of heterozygous carriers with classical b (b0)-thalassaemia rose at 1% a day after 24 hours reaching a mean of 80 fl by day 15. However, the MCH and Hb A2 were stable for 3 weeks.
Conclusion: A mean corpuscular volume (MCV) <80 fl and mean corpuscular haemoglobin <27pg should be recommended as cut-off values for screening of carriers of a-thal 1 (a0) and classical b (b0)-thalassaemia. In blood samples, not processed within a day, MCH with a cut-off value of 27 pg is the recommended choice for screening of carriers. Keywords: Screen, thalassaemia, pregnant, MCV, MCH
Fulltext Screening for intermediate and severe forms of thalassaemia in discarded red blood cells: optimization and feasibility

George E, Lai MI, Teh LK, Ramasamy R, Goh EH, Asokan K, et al.

Med J Malaysia, 2011 Dec;66(5):429-34.
PMID: 22390095 MyJurnal

Detection and quantification of Hb subtypes of human blood is integral to presumptive identification of thalassaemias. It has been used in neonatal screening of thalassaemia and Hb variants. The use of discarded red blood cells following processing of the cord blood for stem cells provides readily available diagnostic material for thalassaemia screening. In this study, we determined the range of Hb subtypes in 195 consecutive cord blood samples collected for cord blood banking. The 'cord blood samples' analysed were those of the remaining red blood cells after the cord blood was processed for stem cell storage. Quantification of Hb subtypes by high performance liquid chromatography (HPLC) was done on BioRad Variant II Hb testing system. Only 73 (36.5%) of the samples could be analyzed neat without dilution. With a 1:300 dilution with wash solution the acceptable area as recommended by the manufacturer for reading of a C-gram within the 1 to 3 million ranges were achieved in all. Eighteen (9%) 12 showed classical Hb Barts (y4) prerun peaks were confirmed by Sebia Hydrasys automated Hb gel electrophoresis and quantified by Sebia Capillarys 2 capillary electrophoresis. Only 1 (0.5%) was presumptively identified with HbH disease. Due to the limited number of samples no beta-thalassaemia major, Hb E beta-thalassaemia and Hb Barts hydrops fetalis were found. The HPLC assay was possible at a cost US$ 5 per sample and a turnover time of 10 samples per hour without technical difficulties. This study reports an effective and valuable protocol for thalassaemia screening in red blood cells which would otherwise be discarded during cord blood processing. Cord blood with severe and intermediate forms of thalassaemia can be preselected and not stored.
Review: Beta-thalassemia and molecular chaperones

Sumera A, Radhakrishnan A, Baba AA, George E

Blood Cells Mol. Dis., 2015 Apr;54(4):348-52.
PMID: 25648458 DOI: 10.1016/j.bcmd.2015.01.008

Thalassemia is known as a diverse single gene disorder, which is prevalent worldwide. The molecular chaperones are set of proteins that help in two important processes while protein synthesis and degradation include folding or unfolding and assembly or disassembly, thereby helping in cell homeostasis. This review recaps current knowledge regarding the role of molecular chaperones in thalassemia, with a focus on beta thalassemia.
Fulltext Relationship between dyslipidaemia and glycaemic status in patients with Type 2 diabetes mellitus

Thambiah SC, Samsudin IN, George E, Zahari Sham SY, Lee HM, Muhamad MA, et al.

Malays J Pathol, 2016 Aug;38(2):123-30.
PMID: 27568669 MyJurnal

The risk of coronary heart disease (CHD) is dramatically increased in diabetic patients due to their atherogenic lipid profile. The severity of CHD in diabetic patients has been found to be directly associated with glycated haemoglobin (HbA1c). According to the Malaysian Clinical Practice Guidelines on diabetes mellitus (DM), HbA1c level less than 6.5% reduces the risk of microvascular and macrovascular complications. Hence, this study aimed to determine the relationship between dyslipidaemia and glycaemic status in patients with type 2 DM (T2DM) patients in Hospital Putrajaya, a tertiary endocrine centre in Malaysia. This was a cross sectional, retrospective study of 214 T2DM patients with dyslipidaemia who had visited the endocrine clinic between January 2009 and December 2012. Significant correlations were found between fasting blood glucose (FBG) and HbA1c with total cholesterol (TC), triglyceride (TG), low density lipoprotein cholesterol (LDL), non-high density lipoprotein cholesterol (non-HDL), LDL/HDL ratio and TC/HDL ratio; greater correlation being with HbA1c than FBG. In patients with HbA1c ≥ 6.5%, TC, TG, non-HDL and TC/HDL ratio were significantly higher than in patients with HbA1c < 6.5%. Non-HDL, LDL/HDL ratio, TC/HDL ratio and HbA1c were significantly lower in patients on statin treatment than nontreated patients (p<0.05). This significant association between glycaemic status and dyslipidaemia emphasises the additional possible use of HbA1c as a biomarker for dyslipidaemia as well as a potential indirect predictor of cardiovascular disease (CVD) risk in T2DM patients.
Rapid detection of α-thalassaemia variants using droplet digital PCR

Lee TY, Lai MI, Ramachandran V, Tan JA, Teh LK, Othman R, et al.

Int J Lab Hematol, 2016 Aug;38(4):435-43.
PMID: 27349818 DOI: 10.1111/ijlh.12520

INTRODUCTION: Alpha thalassaemia is a highly prevalent disease globally and is a well-known public health problem in Malaysia. The deletional forms of the mutation are the most common forms found in alpha thalassaemia. The three most common deletional alpha thalassaemia found in this region include --(SEA) deletion, -α(3.7) rightward and -α(4.2) leftward deletions. The prevalence rate of triplication alpha cases such as ααα(anti3.7) and ααα(anti4.2) is not known in Malaysia although it plays a role in exacerbating the clinical phenotypes in beta thalassaemia carriers. Recently, there have been more reported cases of rare alpha thalassaemia mutations due to the advancement of molecular techniques involved in thalassaemia detections. Therefore, it is essential to develop a new method which allows the detection of different alpha thalassaemia mutations including the rare ones simultaneously and accurately.
METHODS: The purpose of this study was to design an assay for the detection of triplications, common and rare deletional alpha thalassaemia using droplet digital PCR (ddPCR).
RESULTS: This is a quantitative detection method to measure the changes of copy number which can detect deletions, duplications and triplications of the alpha globin gene simultaneously.
CONCLUSION: In conclusion, ddPCR is an alternative method for rapid detection of alpha thalassaemia variants in Malaysia.
Fulltext Public perceptions and attitudes toward thalassaemia: Influencing factors in a multi-racial population

Wong LP, George E, Tan JA

BMC Public Health, 2011;11:193.
PMID: 21447191 DOI: 10.1186/1471-2458-11-193

Thalassaemia is a common public health problem in Malaysia and about 4.5 to 6% of the Malays and Chinese are carriers of this genetic disorder. The major forms of thalassaemia result in death in utero of affected foetuses (α-thalassaemia) or life-long blood transfusions for survival in β-thalassaemia. This study, the first nationwide population based survey of thalassaemia in Malaysia, aimed to determine differences in public awareness, perceptions and attitudes toward thalassaemia in the multi-racial population in Malaysia.

Filters

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links