MyMedR

George E, Adeeb N, Ahmad J

Med J Malaysia, 1980 Dec;35(2):129-30.

Serum ferritin concentration has been measured in pregnant women at their first antenatal visit. Results were analysed according to trimesters. With progression of the pregnancy there is a fall in serum ferritin concentrations. Haemoglobin and red cell indices cannot be used to predict iron status supplemental iron therapy raised the serum ferritin levels.

Fulltext Genotype-phenotype diversity of beta-thalassemia in Malaysia: treatment options and emerging therapies

George E, Ann TJ

Med J Malaysia, 2010 Dec;65(4):256-60.

PMID: 21901940 MyJurnal

The haemoglobinopathies and thalassemias represent the most common inherited monogenic disorders in the world. Beta-thalassaemia major is an ongoing public health problem in Malaysia. Prior to 2004, the country had no national policy for screening and registry for thalassemia. In the absence of a national audit, the true figure of the extent of thalassemia in the Malaysian population was largely presumptive from micro-mapping studies from various research workers in the country. The estimated carrier rate for beta-thalassemia in Malaysia is 3.5-4%. There were 4768 transfusion dependent thalassemia major patients as of May 2010 (Data from National Thalassemia Registry).

Fulltext Serum ferritin concentrations in transfusion dependent beta-thalassaemia

George E, Wong HB, George R, Ariffin WA

Singapore Med J, 1994 Feb;35(1):62-4.

PMID: 8009283

Patients on a moderate red cell transfusion programme have iron overload where the concentrations of the serum ferritin were inappropriate to increases in the transfusion load as a result of limitations of apoferritin synthesis and conversion of ferritin into haemosiderin. This study confirms the limitations for the use of estimations of the serum ferritin to evaluate the iron status in patients with expected high overload as would be seen in patients on many years of maintenance red cell transfusions in the absence of iron chelation therapy. Poor compliance, inadequate dosage of Desferal (deferoxamine), and the late initiation of iron chelation therapy were factors that were considered in the patients with failure of response to iron chelation.

Fulltext TERT gene harbors multiple variants associated with pancreatic cancer susceptibility

Campa D, Rizzato C, Stolzenberg-Solomon R, Pacetti P, Vodicka P, Cleary SP, et al.

Int J Cancer, 2015 Nov 01;137(9):2175-83.

PMID: 25940397 DOI: 10.1002/ijc.29590

A small number of common susceptibility loci have been identified for pancreatic cancer, one of which is marked by rs401681 in the TERT-CLPTM1L gene region on chromosome 5p15.33. Because this region is characterized by low linkage disequilibrium, we sought to identify whether additional single nucleotide polymorphisms (SNPs) could be related to pancreatic cancer risk, independently of rs401681. We performed an in-depth analysis of genetic variability of the telomerase reverse transcriptase (TERT) and the telomerase RNA component (TERC) genes, in 5,550 subjects with pancreatic cancer and 7,585 controls from the PANcreatic Disease ReseArch (PANDoRA) and the PanScan consortia. We identified a significant association between a variant in TERT and pancreatic cancer risk (rs2853677, odds ratio = 0.85; 95% confidence interval = 0.80-0.90, p = 8.3 × 10(-8)). Additional analysis adjusting rs2853677 for rs401681 indicated that the two SNPs are independently associated with pancreatic cancer risk, as suggested by the low linkage disequilibrium between them (r(2) = 0.07, D' = 0.28). Three additional SNPs in TERT reached statistical significance after correction for multiple testing: rs2736100 (p = 3.0 × 10(-5) ), rs4583925 (p = 4.0 × 10(-5) ) and rs2735948 (p = 5.0 × 10(-5) ). In conclusion, we confirmed that the TERT locus is associated with pancreatic cancer risk, possibly through several independent variants.

Fulltext Functional single nucleotide polymorphisms within the cyclin-dependent kinase inhibitor 2A/2B region affect pancreatic cancer risk

Campa D, Pastore M, Gentiluomo M, Talar-Wojnarowska R, Kupcinskas J, Malecka-Panas E, et al.

Oncotarget, 2016 08 30;7(35):57011-57020.

PMID: 27486979 DOI: 10.18632/oncotarget.10935

The CDKN2A (p16) gene plays a key role in pancreatic cancer etiology. It is one of the most commonly somatically mutated genes in pancreatic cancer, rare germline mutations have been found to be associated with increased risk of developing familiar pancreatic cancer and CDKN2A promoter hyper-methylation has been suggested to play a critical role both in pancreatic cancer onset and prognosis. In addition several unrelated SNPs in the 9p21.3 region, that includes the CDNK2A, CDNK2B and the CDNK2B-AS1 genes, are associated with the development of cancer in various organs. However, association between the common genetic variability in this region and pancreatic cancer risk is not clearly understood. We sought to fill this gap in a case-control study genotyping 13 single nucleotide polymorphisms (SNPs) in 2,857 pancreatic ductal adenocarcinoma (PDAC) patients and 6,111 controls in the context of the Pancreatic Disease Research (PANDoRA) consortium. We found that the A allele of the rs3217992 SNP was associated with an increased pancreatic cancer risk (ORhet=1.14, 95% CI 1.01-1.27, p=0.026, ORhom=1.30, 95% CI 1.12-1.51, p=0.00049). This pleiotropic variant is reported to be a mir-SNP that, by changing the binding site of one or more miRNAs, could influence the normal cell cycle progression and in turn increase PDAC risk. In conclusion, we observed a novel association in a pleiotropic region that has been found to be of key relevance in the susceptibility to various types of cancer and diabetes suggesting that the CDKN2A/B locus could represent a genetic link between diabetes and pancreatic cancer risk.

Fulltext High prevalence of alpha- and beta-thalassemia in the Kadazandusuns in East Malaysia: challenges in providing effective health care for an indigenous group

Tan JA, Lee PC, Wee YC, Tan KL, Mahali NF, George E, et al.

J Biomed Biotechnol, 2010;2010.

PMID: 20871816 DOI: 10.1155/2010/706872

Thalassemia can lead to severe transfusion-dependent anemia, and it is the most common genetic disorder in Malaysia. This paper aims to determine the prevalence of thalassemia in the Kadazandusuns, the largest indigenous group in Sabah, East Malaysia. α- and β-thalassemia were confirmed in 33.6% and 12.8%, of the individuals studied respectively. The high prevalence of α- and β-thalassemia in the Kadazandusuns indicates that thalassemia screening, genetic counseling, and prenatal diagnosis should be included as part of their healthcare system. This preliminary paper serves as a baseline for further investigations into the health and genetic defects of the major indigenous population in Sabah, East Malaysia.

Fulltext Hepatitis B infection in multitransfused thalassaemics

George E, Ilina I, Yasmin AM, George R, Duraisamy G

Med J Malaysia, 1988 Dec;43(4):284-7.

PMID: 3241594

Review: Beta-thalassemia and molecular chaperones

Sumera A, Radhakrishnan A, Baba AA, George E

Blood Cells Mol. Dis., 2015 Apr;54(4):348-52.

PMID: 25648458 DOI: 10.1016/j.bcmd.2015.01.008

Thalassemia is known as a diverse single gene disorder, which is prevalent worldwide. The molecular chaperones are set of proteins that help in two important processes while protein synthesis and degradation include folding or unfolding and assembly or disassembly, thereby helping in cell homeostasis. This review recaps current knowledge regarding the role of molecular chaperones in thalassemia, with a focus on beta thalassemia.

Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations

Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.

Public Health Genomics, 2015;18(1):60-4.

PMID: 25412720 DOI: 10.1159/000368342

BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.

The use of Taqman genotyping assays for rapid confirmation of β-thalassaemia mutations in the Malays: accurate diagnosis with low DNA concentrations

Teh LK, Lee TY, Tan JA, Lai MI, George E

Int J Lab Hematol, 2015 Feb;37(1):79-89.

PMID: 24725998 DOI: 10.1111/ijlh.12240

In Malaysia, β-thalassaemia is a common inherited blood disorder in haemoglobin synthesis with a carrier rate of 4.5%. Currently, PCR-incorporating techniques such as amplification refractory mutation system (ARMS) or reverse dot blot hybridization (RDBH) are used in β-thalassaemia mutation detection. ARMS allows single-mutation identification using two reactions, one for wild type and another for mutant alleles. RDBH requires probe immobilization and optimization of hybridization and washing temperatures which is time consuming. The aim of our study was to investigate whether β-thalassaemia mutations can be identified in samples with low DNA concentrations.

Fulltext Screening of concurrent alpha-thalassaemia 1 in beta-thalassaemia carriers

Chong YM, Tan JA, Zubaidah Z, Rahimah A, Kuldip K, George E

Med J Malaysia, 2006 Jun;61(2):217-20.

PMID: 16898315

Thalassaemia is an inherited blood disorder and is a significant public health problem in Malaysia, with many not knowing they carry the gene for thalassaemia. The two major forms are alpha and beta thalassaemia. An individual can co-inherit both the alpha and beta thalassaemia genes. This study determined the frequency of concurrent carriers of alpha thalassaemia in 231 beta thalassaemia carriers. Gap-PCR was done on extracted DNA of the beta thalassaemia samples to check for alpha thalassaemia 1 molecular defect. Eight (3.5%) samples were found to have concurrently inherited the alpha thalassaemia 1 (- -SEA) deletion. The significant carrier rate for alpha thalassaemia 1 indicates the need for the implementation of DNA analysis to complement thalassaemia screening in high risk populations.

Fulltext DNA studies are necessary for accurate patient diagnosis in compound heterozygosity for Hb Adana (HBA2:c.179>A) with deletional or nondeletional α-thalassaemia

Tan JA, Kho SL, Ngim CF, Chua KH, Goh AS, Yeoh SL, et al.

Sci Rep, 2016 06 08;6:26994.

PMID: 27271331 DOI: 10.1038/srep26994

Haemoglobin (Hb) Adana (HBA2:c.179>A) interacts with deletional and nondeletional α-thalassaemia mutations to produce HbH disorders with varying clinical manifestations from asymptomatic to severe anaemia with significant hepatosplenomegaly. Hb Adana carriers are generally asymptomatic and haemoglobin subtyping is unable to detect this highly unstable α-haemoglobin variant. This study identified 13 patients with compound heterozygosity for Hb Adana with either the 3.7 kb gene deletion (-α(3.7)), Hb Constant Spring (HbCS) (HBA2:c.427T>C) or Hb Paksé (HBA2:429A>T). Multiplex Amplification Refractory Mutation System was used for the detection of five deletional and six nondeletional α-thalassaemia mutations. Duplex-PCR was used to confirm Hb Paksé and HbCS. Results showed 84.6% of the Hb Adana patients were Malays. Using DNA studies, compound heterozygosity for Hb Adana and HbCS (α(codon 59)α/α(CS)α) was confirmed in 11 patients. A novel point in this investigation was that DNA studies confirmed Hb Paksé for the first time in a Malaysian patient (α(codon 59)α/α(Paksé)α) after nine years of being misdiagnosis with Hb Adana and HbCS (α(codon 59)α/α(CS)α). Thus, the reliance on haematology studies and Hb subtyping to detect Hb variants is inadequate in countries where thalassaemia is prevalent and caused by a wide spectrum of mutations.

Fulltext Analysis of α1 and α2 globin genes among patients with hemoglobin Adana in Malaysia

Lee TY, Lai MI, Ismail P, Ramachandran V, Tan JA, Teh LK, et al.

Genet. Mol. Res., 2016 Apr 07;15(2).

PMID: 27173219 DOI: 10.4238/gmr.15027400

Hemoglobin (Hb) Adana [HBA2: c179G>A (or HBA1); p.Gly60Asp] is a non-deletional α-thalassemia variant found in Malaysia. An improvement in the molecular techniques in recent years has made identification of Hb Adana much easier. For this study, a total of 26 Hb Adana α-thalassemia intermedia and 10 Hb Adana trait blood samples were collected from patients. Common deletional and non-deletional α-thalassemia genotypes were determined using multiplex gap polymerase chain reaction (PCR) and multiplex ARMS PCR techniques. Identification of the Hb Adana location on the α-globin gene was carried out using genomic sequencing and the location of the mutation was confirmed via restriction fragment length polymorphism-PCR. Among the 36 samples, 24 (66.7%) had the -α(3.7)/α(Cd59)α mutation, while the -α(3.7)/α(Cd59)α mutation accounted for 2 samples (5.6%) and the remaining 10 (27.8%) samples were α/α(Cd59)α. All 36 samples were found to have the Hb Adana mutation on the α2-globin gene. The position of the α-globin gene mutation found in our cases was similar to that reported in Indonesia (16%) but not to that in Turkey (0.6%). Our results showed that the Hb Adana mutation was preferentially present in the α2-globin genes in Malays compared to the other ethnicities in Malaysia. Thus, the Malays might have similar ancestry based on the similarities in the Hb Adana position.

Fulltext Non-invasive prenatal diagnosis using fetal DNA in maternal plasma: a preliminary study for identification of paternally-inherited alleles using single nucleotide polymorphisms

Chen JJ, Tan JA, Chua KH, Tan PC, George E

BMJ Open, 2015 Jul 22;5(7):e007648.

PMID: 26201722 DOI: 10.1136/bmjopen-2015-007648

OBJECTIVES: Single nucleotide polymorphism (SNP) with a mutation can be used to identify the presence of the paternally-inherited wild-type or mutant allele as result of the inheritance of either allele in the fetus and allows the prediction of the fetal genotype. This study aims to identify paternal SNPs located at the flanking regions upstream or downstream from the β-globin gene mutations at CD41/42 (HBB:c.127_130delCTTT), IVS1-5 (HBB:c.92+5G>C) and IVS2-654 (HBB:c.316-197C>T) using free-circulating fetal DNA.

SETTING: Haematology Lab, Department of Biomedical Science, University of Malaya.

PARTICIPANTS: Eight couples characterised as β-thalassaemia carriers where both partners posed the same β-globin gene mutations at CD41/42, IVS1-5 and IVS2-654, were recruited in this study.

OUTCOME MEASURES: Genotyping was performed by allele specific-PCR and the locations of SNPs were identified after sequencing alignment.

RESULTS: Genotype analysis revealed that at least one paternal SNP was present for each of the couples. Amplification on free-circulating DNA revealed that the paternal mutant allele of SNP was present in three fcDNA. Thus, the fetuses may be β-thalassaemia carriers or β-thalassaemia major. Paternal wild-type alleles of SNP were present in the remaining five fcDNA samples, thus indicating that the fetal genotypes would not be homozygous mutants.

CONCLUSIONS: This preliminary research demonstrates that paternal allele of SNP can be used as a non-invasive prenatal diagnosis approach for at-risk couples to determine the β-thalassaemia status of the fetus.

Fulltext Beta-thalassemia major in Malaysia, an ongoing public health problem

George E

Med J Malaysia, 2001 Dec;56(4):397-400.

PMID: 12014756

Beta-thalassaemia mutations in west Malaysia: a new thalassaemia clinical score system

George E

Ann Acad Med Singap, 1994 Jan;23(1):89-93.

PMID: 7514384

The clinical severity of the mutations causing beta-thalassaemia in West Malaysia is presented. Thalassaemia clinical scores (Thal CS), a scoring system, has been formulated to predict clinical severity. It is the type of beta-thalassaemia mutation present that decides on the clinical phenotype. The most severe beta-thalassaemia mutation is assigned a score of 4. A score of 8 indicates a severe thalassaemia phenotype. Alpha-thalassaemia, increased synthesis of Hb F, and glucose-6-phosphate deficiency may ameliorate the clinical condition at phenotype level, and the co-inheritance of hereditary ovalocytosis aggravates it.

The clinical severity of beta-thalassemia mutations in West Malaysia

George E

Southeast Asian J. Trop. Med. Public Health, 1995;26 Suppl 1:225-8.

PMID: 8629111

Beta-thalassemia in West Malaysia is caused by 14 molecular defects with differing clinical severity. In Chinese patients from West Malaysia, the main beta-thalassemia mutations seen were (a) a 4 base pair-TCTT deletion in codon 41-42 [frameshift mutation (FSC 41-42)]; (b) a C to T substitution at the second intervening sequence (IVS2-654); (c) an A to G substitution in the TATA box [-28 (A to G)], and (d) an A to T substitution in codon 17[17 A to T]. In the Malays, the main mutations seen were (a) a G to C in nucleotide 5 at the intervening sequence I [IVS1-5 (G to C)]; (b) G to T substitution in nucleotide I at the intervening sequence I [IVS1-1 (G to T)]; (c) a A to T substitution in codon 17 (17 A to T); (d) removal of C from codon 35 [codon 35 (-C)], and (e) a 4 base pairs-TCTT deletion in codon 41-42 [frameshift mutation (FSC 41-42)]. A scoring system (Tha1 CS) has been formulated to predict clinical severity. It is the type of beta-thalassemia mutation present that decides on the clinical phenotype. The most severe beta-thalassemia mutation is assigned a score of 4. A score of 8 indicates severe thalassemia.

Fulltext Antibody to hepatitis C virus in thalassemia patients

Isahak I, Baharin R, Hakim AS, Abu Bakar M, George E

Malays J Pathol, 1993 Jun;15(1):85-7.

PMID: 8277796

A specific enzyme immunoassay (EIA) for the diagnosis of hepatitis C virus (HCV) infection was developed by recombinant DNA technology. Abbott HCV EIA was used to detect antibody to HCV (anti-HCV) in non-transfused and multiply-transfused thalassemia patients. None of 11 non-transfused patients had anti-HCV but 3 of 52 (5.8%) multiply-transfused patients had anti-HCV. This study showed that the prevalence rate of HCV infection is low in thalassemia patients. However, it is still important to identify hepatitis C virus infected patients in high risk groups because hepatitis C is associated with chronic hepatitis, cirrhosis and hepatocellular carcinoma.

Interaction of Hb South Florida (codon 1; GTG-->ATG) and HbE, with beta-thalassemia (IVS1-1; G-->A): expression of different clinical phenotypes

Tan JA, Tan KL, Omar KZ, Chan LL, Wee YC, George E

Eur J Pediatr, 2009 Sep;168(9):1049-54.

PMID: 19034506 DOI: 10.1007/s00431-008-0877-9

INTRODUCTION: Interactions of different hemoglobin variants with thalassemia alleles can result in various clinical phenotypes. HbE-beta-thalassemia generally manifests with severe anemia where individuals exhibit beta-thalassemia major with regular blood transfusions or beta-thalassemia intermedia with periodic blood transfusions. This study presents a unique Malay family with three beta-globin gene defects-HbE, Hb South Florida, and IVS1-1 (G-->A).

MATERIALS AND METHODS: HbE activates a cryptic splice site that produces non-functional mRNAs. Hb South Florida is a rare beta-hemoglobin variant, and its interactions with other beta-thalassemia alleles have not been reported. IVS1-1 is a Mediterranean mutation that affects mRNA processing giving rise to beta(o)-thalassemia.

RESULTS AND DISCUSSION: Fifteen mutations along the beta-globin gene complex were analyzed using the amplification refractory mutation system. Hb South Florida was identified by direct sequencing using genomic DNA.

CONCLUSION: The affected child with HbE/IVS1-1 produced a beta-thalassemia major phenotype. Compound heterozygosity for Hb South Florida/IVS1-1 produced a beta-thalassemia carrier phenotype in the mother.

Characterisation and confirmation of rare beta-thalassaemia mutations in the Malay, Chinese and Indian ethnic groups in Malaysia

Tan JA, Chin PS, Wong YC, Tan KL, Chan LL, George E

Pathology, 2006 Oct;38(5):437-41.

PMID: 17008283

In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations.

Displaying publications 1 - 20 of 84 in total