In 2008, we published the first set of guidelines for standardizing research in autophagy. Since then, this topic has received increasing attention, and many scientists have entered the field. Our knowledge base and relevant new technologies have also been expanding. Thus, it is important to formulate on a regular basis updated guidelines for monitoring autophagy in different organisms. Despite numerous reviews, there continues to be confusion regarding acceptable methods to evaluate autophagy, especially in multicellular eukaryotes. Here, we present a set of guidelines for investigators to select and interpret methods to examine autophagy and related processes, and for reviewers to provide realistic and reasonable critiques of reports that are focused on these processes. These guidelines are not meant to be a dogmatic set of rules, because the appropriateness of any assay largely depends on the question being asked and the system being used. Moreover, no individual assay is perfect for every situation, calling for the use of multiple techniques to properly monitor autophagy in each experimental setting. Finally, several core components of the autophagy machinery have been implicated in distinct autophagic processes (canonical and noncanonical autophagy), implying that genetic approaches to block autophagy should rely on targeting two or more autophagy-related genes that ideally participate in distinct steps of the pathway. Along similar lines, because multiple proteins involved in autophagy also regulate other cellular pathways including apoptosis, not all of them can be used as a specific marker for bona fide autophagic responses. Here, we critically discuss current methods of assessing autophagy and the information they can, or cannot, provide. Our ultimate goal is to encourage intellectual and technical innovation in the field.
A small number of common susceptibility loci have been identified for pancreatic cancer, one of which is marked by rs401681 in the TERT-CLPTM1L gene region on chromosome 5p15.33. Because this region is characterized by low linkage disequilibrium, we sought to identify whether additional single nucleotide polymorphisms (SNPs) could be related to pancreatic cancer risk, independently of rs401681. We performed an in-depth analysis of genetic variability of the telomerase reverse transcriptase (TERT) and the telomerase RNA component (TERC) genes, in 5,550 subjects with pancreatic cancer and 7,585 controls from the PANcreatic Disease ReseArch (PANDoRA) and the PanScan consortia. We identified a significant association between a variant in TERT and pancreatic cancer risk (rs2853677, odds ratio = 0.85; 95% confidence interval = 0.80-0.90, p = 8.3 × 10(-8)). Additional analysis adjusting rs2853677 for rs401681 indicated that the two SNPs are independently associated with pancreatic cancer risk, as suggested by the low linkage disequilibrium between them (r(2) = 0.07, D' = 0.28). Three additional SNPs in TERT reached statistical significance after correction for multiple testing: rs2736100 (p = 3.0 × 10(-5) ), rs4583925 (p = 4.0 × 10(-5) ) and rs2735948 (p = 5.0 × 10(-5) ). In conclusion, we confirmed that the TERT locus is associated with pancreatic cancer risk, possibly through several independent variants.
The CDKN2A (p16) gene plays a key role in pancreatic cancer etiology. It is one of the most commonly somatically mutated genes in pancreatic cancer, rare germline mutations have been found to be associated with increased risk of developing familiar pancreatic cancer and CDKN2A promoter hyper-methylation has been suggested to play a critical role both in pancreatic cancer onset and prognosis. In addition several unrelated SNPs in the 9p21.3 region, that includes the CDNK2A, CDNK2B and the CDNK2B-AS1 genes, are associated with the development of cancer in various organs. However, association between the common genetic variability in this region and pancreatic cancer risk is not clearly understood. We sought to fill this gap in a case-control study genotyping 13 single nucleotide polymorphisms (SNPs) in 2,857 pancreatic ductal adenocarcinoma (PDAC) patients and 6,111 controls in the context of the Pancreatic Disease Research (PANDoRA) consortium. We found that the A allele of the rs3217992 SNP was associated with an increased pancreatic cancer risk (ORhet=1.14, 95% CI 1.01-1.27, p=0.026, ORhom=1.30, 95% CI 1.12-1.51, p=0.00049). This pleiotropic variant is reported to be a mir-SNP that, by changing the binding site of one or more miRNAs, could influence the normal cell cycle progression and in turn increase PDAC risk. In conclusion, we observed a novel association in a pleiotropic region that has been found to be of key relevance in the susceptibility to various types of cancer and diabetes suggesting that the CDKN2A/B locus could represent a genetic link between diabetes and pancreatic cancer risk.
The optimal training of the highly specialized congenital heart surgeon is a long and complex process, which is a significant challenge in most parts of the world. The World Society for Pediatric and Congenital Heart Surgery (WSPCHS) has established the Global Council on Education for Congenital Heart Surgery as a nonprofit organization with the goal of assessing current training and certification and ultimately establishing standardized criteria for the training, evaluation, and certification of congenital heart surgeons around the world. The Global Council and the WSPCHS have reviewed the present status of training and certification for congenital cardiac surgery around the world. There is currently lack of consensus and standardized criteria for training in congenital heart surgery, with significant disparity between continents and countries. This represents significant obstacles to international job mobility of competent congenital heart surgeons and to the efforts to improve the quality of care for patients with Congenital Heart Disease worldwide. The purpose of this article is to summarize and document the present state of training and certification in congenital heart surgery around the world.
BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
Detection and quantification of Hb subtypes of human blood is integral to presumptive identification of thalassaemias. It has been used in neonatal screening of thalassaemia and Hb variants. The use of discarded red blood cells following processing of the cord blood for stem cells provides readily available diagnostic material for thalassaemia screening. In this study, we determined the range of Hb subtypes in 195 consecutive cord blood samples collected for cord blood banking. The 'cord blood samples' analysed were those of the remaining red blood cells after the cord blood was processed for stem cell storage. Quantification of Hb subtypes by high performance liquid chromatography (HPLC) was done on BioRad Variant II Hb testing system. Only 73 (36.5%) of the samples could be analyzed neat without dilution. With a 1:300 dilution with wash solution the acceptable area as recommended by the manufacturer for reading of a C-gram within the 1 to 3 million ranges were achieved in all. Eighteen (9%) 12 showed classical Hb Barts (y4) prerun peaks were confirmed by Sebia Hydrasys automated Hb gel electrophoresis and quantified by Sebia Capillarys 2 capillary electrophoresis. Only 1 (0.5%) was presumptively identified with HbH disease. Due to the limited number of samples no beta-thalassaemia major, Hb E beta-thalassaemia and Hb Barts hydrops fetalis were found. The HPLC assay was possible at a cost US$ 5 per sample and a turnover time of 10 samples per hour without technical difficulties. This study reports an effective and valuable protocol for thalassaemia screening in red blood cells which would otherwise be discarded during cord blood processing. Cord blood with severe and intermediate forms of thalassaemia can be preselected and not stored.
BACKGROUND/AIMS: Individuals with double heterozygosity for alpha- and beta-thalassaemia and heterozygous beta-thalassaemia show a similar haematological picture. Co-inheritance of alpha- and beta-thalassaemia in both partners may result in pregnancies with either Hb Bart's hydrops foetalis or beta-thalassaemia major, or pregnancies with both disorders.
METHODS: The co-inheritance of alpha-thalassaemia in 322 beta-thalassaemia carriers in Malaysia was studied.
RESULTS: The frequency of alpha-thalassaemia in the beta-thalassaemia carriers was 12.7% (41/322), with a carrier frequency of 7.8% for the SEA deletion, 3.7% for the -alpha(3.7) deletion, 0.9% for Hb Constant Spring and 0.3% for the -alpha(4.2) deletion.
CONCLUSION: Double heterozygosity for alpha- and beta-thalassaemia was confirmed in 5 out of the 41 couples and the risk of the fatal condition Hb Bart's hydrops foetalis was confirmed in two of these couples. Detection of the Southeast Asian (SEA) deletion in the Malaysian Malays in this study confirms that Hb Bart's hydrops foetalis can occur in this ethnic group. Results of this study have provided new information on the frequency and different types of alpha-thalassaemia (--(SEA), -alpha(3.7) and -alpha(4.2) deletions, Hb Constant Spring) in Malaysian beta-thalassaemia carriers.
Hemoglobin (Hb) Adana [HBA2: c179G>A (or HBA1); p.Gly60Asp] is a non-deletional α-thalassemia variant found in Malaysia. An improvement in the molecular techniques in recent years has made identification of Hb Adana much easier. For this study, a total of 26 Hb Adana α-thalassemia intermedia and 10 Hb Adana trait blood samples were collected from patients. Common deletional and non-deletional α-thalassemia genotypes were determined using multiplex gap polymerase chain reaction (PCR) and multiplex ARMS PCR techniques. Identification of the Hb Adana location on the α-globin gene was carried out using genomic sequencing and the location of the mutation was confirmed via restriction fragment length polymorphism-PCR. Among the 36 samples, 24 (66.7%) had the -α(3.7)/α(Cd59)α mutation, while the -α(3.7)/α(Cd59)α mutation accounted for 2 samples (5.6%) and the remaining 10 (27.8%) samples were α/α(Cd59)α. All 36 samples were found to have the Hb Adana mutation on the α2-globin gene. The position of the α-globin gene mutation found in our cases was similar to that reported in Indonesia (16%) but not to that in Turkey (0.6%). Our results showed that the Hb Adana mutation was preferentially present in the α2-globin genes in Malays compared to the other ethnicities in Malaysia. Thus, the Malays might have similar ancestry based on the similarities in the Hb Adana position.
We have identified the beta-thalassemia mutations in 59 patients with thalassemia major and 47 patients with Hb E-beta-thalassemia, and the deletional and nondeletional alpha-thalassemia determinants in 23 out of 24 patients with Hb H disease. All persons were attending the Haematology Clinic at the National University of Malaysia in Kuala Lumpur (Malaysia). Most patients (76) were of Malay descent, while 52 patients were Chinese, and two came from elsewhere. The most frequently occurring beta-thalassemia alleles among the Malay patients were IVS-I-5 (G----C) and G----A at codon 26 (Hb E), while a few others were present at lower frequencies. The Chinese patients carried the mutation characteristic for Chinese [mainly codons 41/42 (-TTCT) and IVS-II-654 (C----T)]; Malay mutations were not observed among Chinese and Chinese mutations were virtually absent in the Malay patients. The large group of patients with Hb E-beta-thalassemia and different beta-thalassemia alleles offered the opportunity of comparing hematological data; information obtained for patients with Hb E-beta-thalassemia living in other countries was included in this comparison. Twenty-three patients with Hb H disease carried the Southeast Asian (SEA) alpha-thalassemia-1 deletion; 13 had the alpha CS alpha (Constant Spring) nondeletional alpha-thalassemia-2 determinant, while the deletional alpha-thalassemia-2 (-3.7 or -4.2 kb) was present in 10 subjects. The --/alpha CS alpha condition appeared to be the most severe with higher Hb H values. Both deletional and nondeletional types of alpha-thalassemia-2 were seen among Malay and Chinese patients.
A new haemoglobin, Haemoglobin Malay is described in a 22 year old Malay. Structural analysis showed a AAC----AGC mutation in codon 17, with the production of an abnormal beta chain (beta Malay) that has an Asn----Ser substitution at position beta 19. This haemoglobin variant could not be detected by conventional procedures.
Patients with diabetes have an earlier onset and increased severity of anaemia compared to those with similar degree of renal impairment from other causes. Anaemia is associated with an increased risk of vascular complications. In this study, we determined the prevalence of anaemia in T2DM patients and its association with sociodemographic, clinical and laboratory parameters in an endocrine tertiary hospital in Malaysia. This was a cross-sectional study using retrospective electronic data from January 2011 to December 2013 of 165 T2DM patients in Hospital Putrajaya. Data was analysed using IBM SPSS Statistics version 21.0 for Windows. The prevalence of anaemia was 39.4% and majority had normocytic normochromic (80%), mild (58.5%) anaemia. Majority were Malays (73.9%), aged below 60 with comparable gender percentage and long-standing, poorly-controlled DM [median fasting blood sugar (FBS) 8mmol/L; glycated haemoglobin (HbA1c) 7.9%]. Using the KDIGO chronic kidney disease (CKD) staging system, 86% of these patients were in stages 3-5. Anaemic patients had a significantly higher serum urea, creatinine and a lower FBS, estimated glomerular filtration rate (eGFR) compared to non-anaemic patients. Anaemic patients with diabetic nephropathy had a significantly lower haemoglobin (Hb) compared to those without this complication (p=0.022). The sensitivity and specificity at a cut-off eGFR value of 38.3 ml/min/1.73 m2 (maximum Youden index = 0.462) was 66.7% and 79.5%, respectively to discriminate mild from moderate anaemia. This study shows that anaemia is already present in T2DM patients in Hospital Putrajaya at initial presentation to the specialist outpatient clinic and is significantly associated with CKD. Hence, it emphasises the obligatory need for routine and follow-up full blood count monitoring in T2DM patients in primary care as well as tertiary settings in Malaysia to enable early detection and aggressive correction of anaemia in preventing further complications.
The risk of coronary heart disease (CHD) is dramatically increased in diabetic patients due to their atherogenic lipid profile. The severity of CHD in diabetic patients has been found to be directly associated with glycated haemoglobin (HbA1c). According to the Malaysian Clinical Practice Guidelines on diabetes mellitus (DM), HbA1c level less than 6.5% reduces the risk of microvascular and macrovascular complications. Hence, this study aimed to determine the relationship between dyslipidaemia and glycaemic status in patients with type 2 DM (T2DM) patients in Hospital Putrajaya, a tertiary endocrine centre in Malaysia. This was a cross sectional, retrospective study of 214 T2DM patients with dyslipidaemia who had visited the endocrine clinic between January 2009 and December 2012. Significant correlations were found between fasting blood glucose (FBG) and HbA1c with total cholesterol (TC), triglyceride (TG), low density lipoprotein cholesterol (LDL), non-high density lipoprotein cholesterol (non-HDL), LDL/HDL ratio and TC/HDL ratio; greater correlation being with HbA1c than FBG. In patients with HbA1c ≥ 6.5%, TC, TG, non-HDL and TC/HDL ratio were significantly higher than in patients with HbA1c < 6.5%. Non-HDL, LDL/HDL ratio, TC/HDL ratio and HbA1c were significantly lower in patients on statin treatment than nontreated patients (p<0.05). This significant association between glycaemic status and dyslipidaemia emphasises the additional possible use of HbA1c as a biomarker for dyslipidaemia as well as a potential indirect predictor of cardiovascular disease (CVD) risk in T2DM patients.
In Malaysia, β-thalassaemia is a common inherited blood disorder in haemoglobin synthesis with a carrier rate of 4.5%. Currently, PCR-incorporating techniques such as amplification refractory mutation system (ARMS) or reverse dot blot hybridization (RDBH) are used in β-thalassaemia mutation detection. ARMS allows single-mutation identification using two reactions, one for wild type and another for mutant alleles. RDBH requires probe immobilization and optimization of hybridization and washing temperatures which is time consuming. The aim of our study was to investigate whether β-thalassaemia mutations can be identified in samples with low DNA concentrations.
Beta-thalassemia is one of the most prevalent inherited diseases and a public health problem in Malaysia. Malaysia is geographically divided into West and East Malaysia. In Sabah, a state in East Malaysia, there are over 1000 estimated cases of β-thalassemia major patients. Accurate population frequency data of the molecular basis of β-thalassemia major are needed for planning its control in the high-risk population of Sabah. Characterization of β-globin gene defects was done in 252 transfusion dependent β-thalassemia patients incorporating few PCR techniques. The study demonstrates that β-thalassemia mutations inherited are ethnically dependent. It is important to note that 86.9% of transfusion-dependent β-thalassemia major patients in Sabah were of the indigenous population and homozygous for a single mutation. The Filipino β(0)-deletion was a unique mutation found in the indigenous population of Sabah. Mutations common in West Malaysia were found in 11 (4.3%) patients. Four rare mutations (Hb Monroe, CD 8/9, CD 123/124/125 and IVS I-2) were also found. This study is informative on the population genetics of β-thalassemia major in Sabah.
The alpha haemoglobin stabilising protein (AHSP) acts as a molecular chaperone for α-globin by stabilising nascent α-globin before transferring it to waiting free β-globin chains. Binding of AHSP to α-globin renders α-globin chemically inert whereby preventing it from precipitating and forming reactive oxygen species byproducts. The AHSP has been actively studied in the recent years, particularly in its relation to β-thalassaemia. Studies have shown that AHSP is a modifier in β-thalassaemia mice models. However, this relationship is less established in humans. Studies by some groups showed no correlation between the AHSP haplotypes and the severity of β-thalassaemia, whereas others have shown that certain AHSP haplotype could modify the phenotype of β-thalassaemia intermedia patients. We investigated the expression of AHSP in relation to selected demographic data, full blood count, HPLC results, HbE/β-thalassaemia genotype, Xmn-1 Gγ polymorphism, α-globin, β-globin and γ-globin expression. We found that AHSP expression was significantly correlated to mean cell haemoglobin level, HbF %, α-globin, β-globin and excess α-globin expression. We concluded that AHSP could be a secondary compensatory mechanism in red blood cells to counterbalance the excess α-globin chains in HbE/β-thalassaemia individuals.
Dried blood spots (DBS) are currently the recommended sample collection method for newborn screening programmes in America. Early diagnosis of beta-thalassaemia screening is essential as it provides an added advantage especially in sickle cell disease. Beta-thalassaemia frequency is high in many poor countries, and the cost of using commercial DNA extraction kits can be prohibitive. Our study assessed three methods that use minimal reagents and materials to extract DNA from DBS for beta-thalassaemia identification.
The molecular basis of variable phenotypes in P-thalassaemia patients with identical genotypes has been associated with co-inheritance of alpha-thalassaemia and persistence of HbF production in adult life. The Xmn I restriction site at -158 position of the Ggamma-gene is associated with increased expression of the Ggamma-globin gene and higher production of HbF This study aims to determine the frequency of the digammaferent genotypes of the Ggamma Xmn I polymorphism in P-thalassaemia patients in two ethnic groups in Malaysia. Molecular characterisation and frequency of the Ggamma Xmn I polymorphism were studied in fifty-eight Chinese and forty-nine beta-thalassaemia Malay patients by Xmn I digestion after DNA amplification of a 650 bp sequence. The in-house developed technique did not require further purification or concentration of amplified DNA before restriction enzyme digestion. The cheaper Seakem LE agarose was used instead of Nusieve agarose and distinct well separated bands were observed. Genotyping showed that the most frequent genotype observed in the Malaysian Chinese was homozygosity for the absence of the Xmn I site (-/-) (89.7%). In the Malays, heterozygosity of the Xmn I site (+/-) was most common (63.3%). Homozygosity for the Xmn I site (+/+) was absent in the Chinese, but was confirmed in 8.2% of the Malays. The ratio of the (+) allele (presence of the Xmn I site) to the (-) allele (absence of the Xmn I site)) was higher in the Malays (0.66) compared to the Chinese (0.05). The (+/-) and (+/+) genotypes are more commonly observed in the Malays than the Chinese in Malaysia.
The diverse clinical phenotype of hemoglobin E (HbE)/β-thalassemia has not only confounded clinicians in matters of patient management but has also led scientists to investigate the complex mechanisms involved in maintaining the delicate red cell environment where, even with apparent similarities of α- and β-globin genotypes, the phenotype tells a different story. The BTB and CNC homology 1 (BACH1) protein is known to regulate α- and β-globin gene transcriptions during the terminal differentiation of erythroid cells. With the mutations involved in HbE/β-thalassemia disorder, we studied the role of BACH1 in compensating for the globin chain imbalance, albeit for fine-tuning purposes.
Haemoglobin (Hb) Adana (HBA2:c.179>A) interacts with deletional and nondeletional α-thalassaemia mutations to produce HbH disorders with varying clinical manifestations from asymptomatic to severe anaemia with significant hepatosplenomegaly. Hb Adana carriers are generally asymptomatic and haemoglobin subtyping is unable to detect this highly unstable α-haemoglobin variant. This study identified 13 patients with compound heterozygosity for Hb Adana with either the 3.7 kb gene deletion (-α(3.7)), Hb Constant Spring (HbCS) (HBA2:c.427T>C) or Hb Paksé (HBA2:429A>T). Multiplex Amplification Refractory Mutation System was used for the detection of five deletional and six nondeletional α-thalassaemia mutations. Duplex-PCR was used to confirm Hb Paksé and HbCS. Results showed 84.6% of the Hb Adana patients were Malays. Using DNA studies, compound heterozygosity for Hb Adana and HbCS (α(codon 59)α/α(CS)α) was confirmed in 11 patients. A novel point in this investigation was that DNA studies confirmed Hb Paksé for the first time in a Malaysian patient (α(codon 59)α/α(Paksé)α) after nine years of being misdiagnosis with Hb Adana and HbCS (α(codon 59)α/α(CS)α). Thus, the reliance on haematology studies and Hb subtyping to detect Hb variants is inadequate in countries where thalassaemia is prevalent and caused by a wide spectrum of mutations.
Pre-donation screening declarations and hemoglobin (Hb) testing are measures used to determine the quality of donated blood. The copper sulphate (CuSo4) method used to screen for blood abnormalities can give inaccurate results if strict quality control is not applied. Blood donors who are carriers of thalassemia and those with mild iron deficiency anemia (IDA) are usually asymptomatic and frequently missed at blood donation. The aim of this study was to evaluate the red blood cell (RBC) indices related disorders among blood donors who were deemed qualified to donate blood after screening with CuSo4 method. One hundred fifty-eight volunteer blood donors at the Universiti Putra Malaysia (UPM), who had passed the CuSo4 screening method, were recruited for this study. Their bloods specimens were examined with a complete blood count. Subjects with a low mean corpuscular hemoglobin (MCH) level were examined further by checking a serum ferritin level, Hb quantification, and molecular analysis to examine for common RBC disorders. Fourteen point six percent of subjects had a low Hb level, two (1.3%) had IDA and four (2.5%) had thalassemia or some other hemoglobinopathy. Using a MCH level < 27 pg as a cut-off point, 58 subjects (36.7%) had suspected IDA, thalassemia or some other hemoglobinopathy. Eight point nine percent of subjects with a normal Hb level had thalassemia, and 3.8% had IDA. Malaysia has a high prevalence of thalassemia and other hemoglobinopathies. Pre-donation accurate screening is crucial to protect the quality of blood transfusion products. Public education regarding RBC disorders especially among blood donors is important.