Displaying publications 1 - 20 of 130 in total

Abstract:
Sort:
  1. Ghadimi H, Tehrani RM, Ali AS, Mohamed N, Ab Ghani S
    Anal Chim Acta, 2013 Feb 26;765:70-6.
    PMID: 23410628 DOI: 10.1016/j.aca.2012.12.039
    A novel glassy carbon electrode (GCE) modified with a composite film of poly (4-vinylpyridine) (P4VP) and multiwalled carbon nanotubes (P4VP/MWCNT GCE) was used for the voltammetric determination of paracetamol (PCT). This novel electrode displayed a combined effect of P4VP and MWCNT on the electro-oxidation of PCT in a solution of phosphate buffer at pH 7. Hence, conducting properties of P4VP along with the remarkable physical properties of MWCNTs might have combined effects in enhancing the kinetics of PCT oxidation. The P4VP/MWCNT GCE has also demonstrated excellent electrochemical activity toward PCT oxidation compared to that with bare GCE and MWCNT GCE. The anodic peak currents of PCT on the P4VP/MWCNT GCE were about 300 fold higher than that of the non-modified electrodes. By applying differential pulse voltammetry technique under optimized experimental conditions, a good linear ratio of oxidation peak currents and concentrations of PCT over the range of 0.02-450 μM with a limit of detection of 1.69 nM were achieved. This novel electrode was stable for more than 60 days and reproducible responses were obtained at 99% of the initial current of PCT without any influence of physiologically common interferences such as ascorbic acid and uric acid. The application of this electrode to determine PCT in tablets and urine samples was proposed.
  2. Yusof ZYM, Mohamed NH, Radzi Z, Yahya NA, Ramli AS, Abdul Kadir R
    Ann Dent, 2007;14(1):31-38.
    MyJurnal
    Background: The high prevalence and impacts of orofacial pain (OFP) have caused major sufferings to individuals and society. The purpose of the study was to investigate the problems and impacts of OFP among a group of Malaysian aborigines. The objectives were to determine (i) the prevalence, aetiology, duration, severity, types and persistence of OFP during the past 3 months preceding the study; (ii) its associated impact on daily performance; and (iii) the measures taken for pain relief.
    Methods: This is a cross sectional study carried out in Kuala Lipis, Pahang involving 6 villages of Orang Asli Bateq and Semai. Study sample was chosen using convenient sampling including adults aged 16 years and above. Participants were invited for an interview using structured questionnaire followed by clinical examination. Data analysis was carried out using SPSS ver12.
    Results: Response rate was low at 20% (n = 140). Over one-quarter (26.4%) of the sample experienced OFP in the previous 3 months. Toothache was found to be the main aetiology (83.3%) followed by gingival pain (18.9%), temporomandibular joint (10.8%) and facial pain (8.1%). Mean duration of pain was 9.8 days for toothache, 162.4 days for gingival pain, 7.3 days for TMJ and 5.7 days for facial pain. Of those who had OFP, over half rated the pain as moderate (37.8%) and severe (29.7%) and most of the pain was ‘intermittent’ in nature (81.1%). Over half (62.2%) admitted the pain had disappeared during the interview. In terms of pain relief, 56.8% of the sample used traditional medicine. The pain had impacted on the chewing ability (70.3%, p=0.01), ability to sleep at night (73.0%, p<0.001), levels of anxiety (70.3%), ability to perform daily chores (33.3%) and social life (35.1%) of the Orang Asli sample.
    Conclusion: This study suggests the prevalence of OFP was high among the Orang Asli sample, which imposed considerable physical and psychological impacts on daily life.
    Key words: orofacial pain; impacts; quality of life; Malaysian aborigines
  3. Mohamed NA, Mansur FAF, Abdul Rahman N
    Malays J Pathol, 2020 Apr;42(1):107-110.
    PMID: 32342938
    INTRODUCTION: Malaysia declared its intent to eliminate malaria by 2020, with a phased goal of achieving zero local transmission. Nonetheless, Malaysia is highl susceptible to malaria importation due to geographical proximity to high-burden countries e.g. Thailand, Myanmar and high influx of foreign workers and students from Asia and Africa.

    CASE SERIES: We accumulated all malaria cases diagnosed in a tertiary hospital within a period of two years. Three cases were reported, where all of the patients were foreigners with recent travel history to African countries. All of them were infected by P. falciparum, responded to treatment and discharged well.

    DISCUSSION: This case series highlighted the importance of acquiring recent travel history during history taking and having a high index of suspicions on malaria when dealing with feverish patients originated particularly from African countries.

  4. Al-Joudi FS, Kaid FA, Ishak I, Mohamed N, Osman K, Alias IZ
    Indian J Pathol Microbiol, 2011 Apr-Jun;54(2):284-9.
    PMID: 21623075 DOI: 10.4103/0377-4929.81596
    Human mammaglobin (hMAG) is a secreted protein which has been detected in breast epithelial cells of mammary glands and has been used as a specific marker for breast cancer.
  5. Hassanein M, Afandi B, Yakoob Ahmedani M, Mohammad Alamoudi R, Alawadi F, Bajaj HS, et al.
    PMID: 35016991 DOI: 10.1016/j.diabres.2021.109185
    Fasting during Ramadan is one of the five pillars of Islam and is obligatory for all healthy Muslims from the age of puberty. Though individuals with some illness and serious medical conditions, including some people with diabetes, can be exempted from fasting, many will fast anyway. It is of paramount importance that people with diabetes that fast are given the appropriate guidance and receive proper care. The International Diabetes Federation (IDF) and Diabetes and Ramadan (DaR) International Alliance have come together to provide a substantial update to the previous guidelines. This update includes key information on fasting during Ramadan with type 1 diabetes, the management of diabetes in people of elderly ages and pregnant women, the effects of Ramadan on one's mental wellbeing, changes to the risk of macrovascular and microvascular complications, and areas of future research. The IDF-DAR Diabetes and Ramadan Practical Guidelines 2021 seek to improve upon the awareness, knowledge and management of diabetes during Ramadan, and to provide real-world recommendations to health professionals and the people with diabetes who choose to fast.
  6. Moey SF, Sowtali SN, Mohamad Ismail MF, Hashi AA, Mohd Azharuddin NS, Che Mohamed N
    Asian Pac J Cancer Prev, 2022 Dec 01;23(12):3971-3982.
    PMID: 36579977 DOI: 10.31557/APJCP.2022.23.12.3971
    INTRODUCTION: Breast cancer is the most diagnosed cancer worldwide. With an estimated 685,000 deaths, female breast cancer was the fifth leading cause of cancer mortality worldwide, accounting for 6.9% of all cancer deaths. Previous studies have shown that late detection and delayed diagnosis are associated with advanced-stage breast cancer and poor survival. Factors contributing to non-adherence to breast cancer screening among women were elicited from previous studies. However, few studies have focused on the Muslim community, particularly Muslim women. As such, this systematic review aims to fill this gap by collecting information from studies conducted globally over the past ten years that examined cultural, religious and socio-ethical misconceptions about breast cancer screening among Muslim women.

    METHODS: Following the PRISMA guidelines, literature searches were conducted systematically through various databases including PubMed, Science Direct, Scopus, Cochrane Library and Oxford Academic Journals. Article identification, screening steps and eligibility measures were meticulously performed throughout the review.

    RESULTS: A total of 22 papers were appraised and included in this review. Five main themes were generated which were socio-ethical misconceptions, cultural and religious beliefs, cultural and religious barriers, stigmatization and fear of breast cancer impact. Eight sub-themes and 14 sub sub-themes were further elicited from the main themes.

    CONCLUSION: Muslim women have socio-ethical, cultural and religious misconceptions on what constitutes health and practices as well as on the nature and etiology of BC. Cultural barriers and religious values of Muslim women were indicated to influence their health behaviors such as upholding their modesty when choosing health interventions. BC stigma and fear were also found to be key sources of psychological distress that discouraged Muslim women from undergoing BC screening. The study suggests the implementation of holistic effort in educating Muslim women to increase BC screening rate.

  7. Chan CY, Subramaniam S, Mohamed N, Ima-Nirwana S, Muhammad N, Fairus A, et al.
    Arch Osteoporos, 2020 09 12;15(1):142.
    PMID: 32918631 DOI: 10.1007/s11657-020-00821-5
    T-score discordance between hip and spine is a common problem in the diagnosis of osteoporosis based on dual-energy X-ray absorptiometry. Not much information on the prevalence and risk factors of this problem is available in Malaysia. Our study found that factors like age, height, physical activity and menopausal status should be taken into account in the diagnosis of osteoporosis.

    INTRODUCTION AND OBJECTIVE: T-score discordance between hip and spine is a common problem in bone mineral density assessment. A difference ≥ 1 standard deviation (SD) (regardless of diagnostic class) is considered minor, and a difference more than one diagnostic class is considered major discordance. This study aimed to determine the prevalence and factors of hip and spine T-score discordance in a population aged ≥ 40 years in Klang Valley, Malaysia.

    SUBJECTS AND METHODS: In this cross-sectional study, subjects answered a demographic questionnaire and underwent body composition and bone health assessment using dual-energy X-ray absorptiometry. Chi-square and binary logistic regression analysis were used to assess the prevalence of T-score discordance among the subjects.

    RESULTS: A total of 786 Malaysians (382 men, 404 women) subjects were recruited. The prevalence of minor and major discordance was 30.3% and 2.3%, respectively. Overall, factors related to T-score discordance were advanced age, decreased height, and being physically active. Sub-analysis showed that decreased height and being physically active predicted T-score discordance in men, being menopausal and Indian (vs Chinese) were predictors in women.

    CONCLUSIONS: T-score discordance between hip and spine is common among Malaysian middle-aged and elderly population. Diagnosis of osteopenia/osteoporosis should be based on the T-score of more than one skeletal site as per the current recommendations.

  8. Chan CY, Mohamed N, Ima-Nirwana S, Chin KY
    PMID: 30103534 DOI: 10.3390/ijerph15081727
    Osteoporosis is a major public health problem affecting millions of people worldwide. Increasing knowledge, correcting health belief and promoting osteoprotective practices are effective measures for building and maintaining strong bone throughout ones' life-span. This review aims to summarize the contemporary evidence on the knowledge, beliefs and practice of adolescents and young adults on bone health. We performed literature searches using the PubMed and Scopus databases to identify original studies from 2008 to May 2018 using the search terms "(knowledge OR beliefs OR attitude OR practice OR behaviours OR physical activity OR exercise OR diet OR nutrition) AND (young OR youth OR adolescents OR children OR young adults OR students OR teenager) AND (osteoporosis OR bone health)". Of the 3206 articles found, 34 met the inclusion criteria. Studies showed that most adolescents and young adults had poor knowledge and expressed disinterest in osteoporosis. They believed that other diseases were more serious than osteoporosis, contributing to low perceived susceptibility and seriousness towards this disease. Popular media emerged as a platform to obtain information regarding osteoporosis. The lack of knowledge and misconceptions about osteoporosis led to poor osteoprotective practices. As a conclusion, the current evidence revealed a lack of awareness about osteoporosis among adolescents and young adults. Educational interventions may be useful to improve the awareness of osteoporosis among this population.
  9. Subramaniam S, Chan CY, Soelaiman IN, Mohamed N, Muhammad N, Ahmad F, et al.
    Arch Osteoporos, 2019 11 28;14(1):117.
    PMID: 31781876 DOI: 10.1007/s11657-019-0666-2
    The concordance between osteoporosis self-assessment tool for Asians (OSTA) and dual-energy X-ray absorptiometry (DXA) was fair in the study. Modification of OSTA cutoff values improved its sensitivity to identify subjects at risk for suboptimal bone health (osteopenia/osteoporosis) and osteoporosis.

    PURPOSE: Osteoporosis self-assessment tool for Asians (OSTA) is a convenient screening algorithm used widely to identify patients at risk of osteoporosis. Currently, the number of studies validating OSTA in Malaysian population is limited. This study aimed to validate the performance of OSTA in identifying subjects with osteoporosis determined with DXA.

    METHODS: This cross-sectional study recruited 786 Malaysians in Klang Valley, Malaysia. Their bone health status was assessed by DXA and OSTA. The association and agreement between OSTA and bone mineral density assessment by DXA were determined by Pearson's correlation and Cohen's kappa, respectively. Receiver operating characteristics (ROC) curves were used to determine the sensitivity, specificity, and area under the curve (AUC) for OSTA.

    RESULTS: OSTA and DXA showed a fair association in the study (r = 0.382, κ = 0.159, p 

  10. Chan CY, Subramaniam S, Mohamed N, Muhammad N, Ramli FF, Ima-Nirwana S, et al.
    PMID: 34370656 DOI: 10.2174/1871530321666210809154456
    BACKGROUND: The currently available bone turnover markers are mostly derived from osteoblasts or osteoclasts. Protein markers derived from osteocytes, the most abundant bone cells that can regulate bone turnover activities by other cells, are less explored.

    OBJECTIVE: This study aimed to compare the circulating markers of osteocytes and calcium homeostasis between Malaysian postmenopausal women with and without osteoporosis.

    METHODS: Postmenopausal women with (n=20) or without osteoporosis (n=20) as determined by dual- energy X-ray absorptiometry were randomly drawn from a bone health cohort. Their fasting blood was collected and assayed by a multiplex immunoassay panel.

    RESULTS: The results showed that osteoprotegerin and sclerostin levels were significantly lower among postmenopausal women with osteoporosis than the normal control. No significant differences in other markers were observed between the two groups. Sclerostin level correlated positively with spine Bone Mineral Density (BMD), while 25-hydroxyvitamin D correlated negatively with hip BMD in the control group. No significant correlation was observed between other markers with spine or hip BMD.

    CONCLUSION: These data provide an insight into the possible roles of osteocyte markers, especially osteoprotegerin and sclerostin, in classifying subjects with osteoporosis. However, the lack of association between these markers and BMD indicates that osteoporosis is a complex and multifactorial condition.

  11. Subramaniam S, Chan CY, Soelaiman IN, Mohamed N, Muhammad N, Ahmad F, et al.
    PMID: 32272697 DOI: 10.3390/ijerph17072526
    Background: The current osteoporosis screening instruments are not optimized to be used among the Malaysian population. This study aimed to develop an osteoporosis screening algorithm based on risk factors for Malaysians. Methods: Malaysians aged ≥50 years (n = 607) from Klang Valley, Malaysia were interviewed and their bone health status was assessed using a dual-energy X-ray absorptiometry device. The algorithm was constructed based on osteoporosis risk factors using multivariate logistic regression and its performance was assessed using receiver operating characteristics analysis. Results: Increased age, reduced body weight and being less physically active significantly predicted osteoporosis in men, while in women, increased age, lower body weight and low-income status significantly predicted osteoporosis. These factors were included in the final algorithm and the optimal cut-offs to identify subjects with osteoporosis was 0.00120 for men [sensitivity 73.3% (95% confidence interval (CI) = 54.1%-87.7%), specificity 67.8% (95% CI = 62.7%-85.5%), area under curve (AUC) 0.705 (95% CI = 0.608-0.803), p < 0.001] and 0.161 for women [sensitivity 75.4% (95% CI = 61.9%-73.3%), specificity 74.5% (95% CI = 68.5%-79.8%), AUC 0.749 (95% CI = 0.679-0.820), p < 0.001]. Conclusion: The new algorithm performed satisfactorily in identifying the risk of osteoporosis among the Malaysian population ≥50 years. Further validation studies are required before applying this algorithm for screening of osteoporosis in public.
  12. Subramaniam S, Chan CY, Soelaiman IN, Mohamed N, Muhammad N, Ahmad F, et al.
    Diagnostics (Basel), 2020 Mar 25;10(4).
    PMID: 32218298 DOI: 10.3390/diagnostics10040178
    BACKGROUND: Calcaneal quantitative ultrasound (QUS) is widely used in osteoporosis screening, but the cut-off values for risk stratification remain unclear. This study validates the performance of a calcaneal QUS device (CM-200) using dual-energy X-ray absorptiometry (DXA) as the reference and establishes a new set of cut-off values for CM-200 in identifying subjects with osteoporosis.

    METHODS: The bone health status of Malaysians aged ≥40 years was assessed using CM-200 and DXA. Sensitivity, specificity, area under the curve (AUC) and the optimal cut-off values for risk stratification of CM-200 were determined using receiver operating characteristic (ROC) curves and Youden's index (J). Results: From the data of 786 subjects, CM-200 (QUS T-score 0.05). Modified cut-off values for the QUS T-score improved the performance of CM-200 in identifying subjects with osteopenia (sensitivity 67.7% (95% CI: 62.8-72.3%); specificity 72.8% (95% CI: 68.1-77.2%); J = 0.405; AUC 0.702 (95% CI: 0.666-0.739); p < 0.001) and osteoporosis (sensitivity 79.4% (95% CI: 70.0-86.9%); specificity 61.8% (95% CI: 58.1-65.5%); J = 0.412; AUC 0.706 (95% CI: 0.654-0.758); p < 0.001). Conclusion: The modified cut-off values significantly improved the performance of CM-200 in identifying individuals with osteoporosis. Since these values are device-specific, optimization is necessary for accurate detection of individuals at risk for osteoporosis using QUS.

  13. Manshor NM, Razali N, Jusoh RR, Asmawi MZ, Mohamed N, Zainol S, et al.
    Int J Cardiol Hypertens, 2020 Mar;4:100024.
    PMID: 33447753 DOI: 10.1016/j.ijchy.2020.100024
    Introduction: Labisia pumila has been reported to possess activities including antioxidant, anti-aging and anti-cancer but there is no report on its vasorelaxant effects.

    Objective: This study aims to fractionate water extract of Labisia pumila, identify the compound(s) involved and elucidate the possible mechanism(s) of its vasorelaxant effects.

    Methods: Water extract of Labisia pumila was subjected to liquid-liquid extraction to obtain ethyl acetate, n-butanol and water fractions. In SHR aortic ring preparations, water fraction (WF-LPWE) was established as the most potent fraction for vasorelaxation. The pharmacological mechanisms of the vasorelaxant effect of WF-LPWE were investigated with and without the presence of various inhibitors. The cumulative dose-response curves of potassium chloride (KCl)-induced contractions were conducted to study the possible mechanisms of WF-LPWE in reducing vasoconstriction.

    Results: WF-LPWE produced dose-dependent vasorelaxant effect in endothelium-denuded aortic ring and showed non-competitive inhibition of dose-response curves of PE-induced contraction, and at its higher concentrations reduced KCl-induced contraction. 1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one (ODQ) significantly inhibited vasorelaxant effect of WF-LPWE. WF-LPWE significantly reduced the release of intracellular calcium ion (Ca2+) from the intracellular stores and suppressed the calcium chloride (CaCal2)-induced contraction. Nω-nitro-L-arginine methyl ester (L-NAME), methylene blue, indomethacin and atropine did not influence the vasorelaxant effects of WF-LPWE.

    Conclusion: WF-LPWE exerts its vasorelaxant effect independently of endothelium and possibly by inhibiting the release of calcium from intracellular calcium stores, receptor-operated calcium channels and formation of inositol 1,4,5- triphosphate. WF-LPWE vasorelaxant effect may also mediated via nitric oxide-independent direct involvement of soluble guanylate cyclase (sGC)/ cyclic guanosine monophosphate (cGMP) pathways.

  14. Teh LK, Mohamed NI, Salleh MZ, Rohaizak M, Shahrun NS, Saladina JJ, et al.
    AAPS J, 2012 Mar;14(1):52-9.
    PMID: 22183189 DOI: 10.1208/s12248-011-9313-6
    CYP2D6 plays a major role in the metabolism of tamoxifen, and polymorphism of P-glycoprotein has been associated with resistance of many drug therapies. This study investigates the clinical impact of genetic variants of CYP2D6 and ABCB1 in breast cancer patients treated with tamoxifen. Blood samples from 95 breast cancer patients treated with tamoxifen were collected and genotyped for CYP2D6 and ABCB1 variants using allele-specific PCR method. Recurrence risks were calculated using Kaplan-Meier analysis and compared using the log-rank test. Patients carrying CYP2D6*10/*10 and heterozygous null allele (IM) showed higher risks of developing recurrence and metastasis (OR 13.14; 95% CI 1.57-109.94; P = 0.004) than patients with CYP2D6*1/*1 and *1/*10 genotypes. Patients with homozygous CC genotypes of ABCB1 C3435T showed a shorter time to recurrence. Patients who were CYP2D6 IM and homozygous CC genotype of C3435T have statistically significant higher risks of recurrence (P = 0.002). Similarly, median time to recurrence in these patients was only 12 months (95% CI = 0.79-23.2) compared to those without this combination which was 48 months (95% CI = 14.7-81.2). Patients with CYP2D6 IM and homozygous CC genotype of ABCB1 C3435T have shorter times to recurrence. The results confirmed the findings of previous studies and support FDA recommendation to perform pre-genotyping in patients before the choice of therapy is determined in breast cancer patients.
  15. Gomaa MN, Soliman K, Ayesh A, Abd El-Wahed A, Hamza Z, Mansour HM, et al.
    Nat Prod Res, 2016;30(6):729-34.
    PMID: 26186031 DOI: 10.1080/14786419.2015.1040991
    The marine soft corals Sarcophyton trocheliophorum crude extracts possessed antimicrobial activity towards pathogenic bacterial strains, i.e. Bacillus cereus, Salmonella typhi, Escherichia coli, Staphylococcus aureus and Pseudomonas aeruginosa. Bioassay-guided fractionation indicated that the antimicrobial effect was due to the presence of terpenoid bioactive derivatives. Further biological assays of the n-hexane fractions were carried out using turbidity assay, inhibition zone assay and minimum inhibitory concentration for investigating the growth-inhibition effect towards the Gram-positive and Gram-negative bacteria. The fractions were screened and the structure of the isolated compound was justified by interpretation of the spectroscopic data, mainly mass spectrometry (GC-MS). The structure was assigned as (5S)-3-[(3E,5S)-5-hydroxy-3-hepten-6-yn-1-yl]-5-methyl-2(5H)-furanone and was effective at concentrations as low as 0.20 mg/mL. The above findings, in the course of our ongoing research on marine products, may implicate that the profound anti-microbial activity of the S. trocheliophorum soft corals, inhabiting the red sea reefs, is attributed to the presence of growth-inhibiting secondary metabolites mainly terpenoids.
  16. Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
  17. Salim SS, Mustafa MB, Asemi A, Ahmad A, Mohamed N, Ghazali KB
    Res Dev Disabil, 2016 Sep;56:41-59.
    PMID: 27262125 DOI: 10.1016/j.ridd.2016.05.013
    BACKGROUND: The speech pronunciation practice (SPP) system enables children with speech impairments to practise and improve their speech pronunciation. However, little is known about the surrogate measures of the SPP system.

    AIMS: This research aims to measure the success and effectiveness of the SPP system using three surrogate measures: usage (frequency of use), performance (recognition accuracy) and satisfaction (children's subjective reactions), and how these measures are aligned with the success of the SPP system, as well as to each other.

    METHODS AND PROCEDURES: We have measured the absolute change in the word error rate (WER) between the pre- and post-training, using the ANOVA test. Correlation co-efficiency (CC) analysis was conducted to test the relation between the surrogate measures, while a Structural Equation Model (SEM) was used to investigate the causal relations between the measures.

    OUTCOMES AND RESULTS: The CC test results indicate a positive correlation between the surrogate measures. The SEM supports all the proposed gtheses. The ANOVA results indicate that SPP is effective in reducing the WER of impaired speech.

    CONCLUSIONS AND IMPLICATIONS: The SPP system is an effective assistive tool, especially for high levels of severity. We found that performance is a mediator of the relation between "usage" and "satisfaction".

  18. Hassandarvish P, Tiong V, Sazaly AB, Mohamed NA, Arumugam H, Ananthanarayanan A, et al.
    Br Dent J, 2020 06;228(12):900.
    PMID: 32591671 DOI: 10.1038/s41415-020-1794-1
  19. Mohd Isa KN, Jalaludin J, Mohd Elias S, Mohamed N, Hashim JH, Hashim Z
    PMID: 35457448 DOI: 10.3390/ijerph19084580
    Numerous epidemiological studies have evaluated the association of fractional exhaled nitric oxide (FeNO) and indoor air pollutants, but limited information available of the risks between schools located in suburban and urban areas. We therefore investigated the association of FeNO levels with indoor particulate matter (PM10 and PM2.5), and nitrogen dioxide (NO2) exposure in suburban and urban school areas. A comparative cross-sectional study was undertaken among secondary school students in eight schools located in the suburban and urban areas in the district of Hulu Langat, Selangor, Malaysia. A total of 470 school children (aged 14 years old) were randomly selected, their FeNO levels were measured, and allergic skin prick tests were conducted. The PM2.5, PM10, NO2, and carbon dioxide (CO2), temperature, and relative humidity were measured inside the classrooms. We found that the median of FeNO in the school children from urban areas (22.0 ppb, IQR = 32.0) were slightly higher as compared to the suburban group (19.5 ppb, IQR = 24.0). After adjustment of potential confounders, the two-level hierarchical multiple logistic regression models showed that the concentrations of PM2.5 were significantly associated with elevated of FeNO (>20 ppb) in school children from suburban (OR = 1.42, 95% CI = 1.17−1.72) and urban (OR = 1.30, 95% CI = 1.10−1.91) areas. Despite the concentrations of NO2 being below the local and international recommendation guidelines, NO2 was found to be significantly associated with the elevated FeNO levels among school children from suburban areas (OR = 1.11, 95% CI = 1.06−1.17). The findings of this study support the evidence of indoor pollutants in the school micro-environment associated with FeNO levels among school children from suburban and urban areas.
  20. Ab Wahab SZ, Nik Hussain NH, Zakaria R, Abdul Kadir A, Mohamed N, Tohit NM, et al.
    Complement Ther Med, 2018 Dec;41:154-160.
    PMID: 30477832 DOI: 10.1016/j.ctim.2018.08.015
    OBJECTIVE: To investigate the long-term effects of Tualang Honey versus Honey Cocktail (mixture of honey, bee bread, and royal jelly) on cardiovascular markers and anthropometric measurements of postmenopausal women.

    METHODS: We conducted a randomised, double blinded, two-armed parallel study comparing 20 g/day of Tualang Honey versus 20 g/day Honey Cocktail among postmenopausal women aged 45-65 years. The cardiovascular parameters and anthropometrics measurements were assessed at baseline, 6 months, and 12 months of the intervention.

    RESULTS: 100 subjects were successfully randomised into the groups. There was a significant decrease in the diastolic blood pressure from 77.92 mmHg at baseline to 73.45 mmHg at 12 months (F-statistic = 2.55, p-value = 0.047) in the Tualang Honey group compared to Honey Cocktail. There was also a significant decrease in the fasting blood sugar from 6.11 mmol/L at baseline to 5.71 mmol/L at 12 months (F-statistic = 4.03, p-value = 0.021) in the Tualang Honey group compared to the Honey Cocktail group. The body mass index remained unchanged at 27 kg/m2 (F-statistic = 1.60, p-value = 0.010) throughout 12 months of the intervention in the Honey Cocktail group.

    CONCLUSION: Subjects who received Honey Cocktail showed remarkable effects on body mass index. However, Tualang Honey supplementation showed superior effect in lowering diastolic blood pressure and fasting blood sugar compared to Honey Cocktail. Further studies are required to ascertain the underlying mechanism(s) of Tualang Honey and Honey Cocktail on each observed parameter.

Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links