Displaying publications 1 - 20 of 130 in total

Abstract:
Sort:
  1. Ibrahim N', Wong SK, Mohamed IN, Mohamed N, Chin KY, Ima-Nirwana S, et al.
    PMID: 30366427 DOI: 10.3390/ijerph15112360
    Wound healing is a complex process of recovering the forms and functions of injured tissues. The process is tightly regulated by multiple growth factors and cytokines released at the wound site. Any alterations that disrupt the healing processes would worsen the tissue damage and prolong repair process. Various conditions may contribute to impaired wound healing, including infections, underlying diseases and medications. Numerous studies on the potential of natural products with anti-inflammatory, antioxidant, antibacterial and pro-collagen synthesis properties as wound healing agents have been performed. Their medicinal properties can be contributed by the content of bioactive phytochemical constituents such as alkaloids, essential oils, flavonoids, tannins, saponins, and phenolic compounds in the natural products. This review highlights the in vitro, in vivo and clinical studies on wound healing promotions by the selected natural products and the mechanisms involved.
  2. Zakaria S, Mat-Husain SZ, Ying-Hwey K, Xin-Kai K, Mohd-Badawi A, Abd-Ghani NA, et al.
    Iran J Basic Med Sci, 2017 Dec;20(12):1360-1367.
    PMID: 29238472 DOI: 10.22038/IJBMS.2017.9610
    Objectives: Alcohol consumption induces oxidative stress on bone, which in turn increases the risk of osteoporosis. This study determined the effects of vitamin E on bone strength and bone mineral content in alcohol-induced osteoporotic rats.

    Materials and Methods: Three months old Sprague Dawley male rats were randomly divided into 5 groups: (I) control group; (II) alcohol (3g/kg) + normal saline; (III) alcohol (3g/kg) + olive oil; (IV) alcohol (3g/kg) + alpha-tocopherol (60mg/kg) and (V) alcohol (3g/kg) + palm vitamin E (60mg/kg). The treatment lasted for three months. Following sacrifice, the right tibia was subjected to bone biomechanical test while the lumbar (fourth and fifth lumbar) and left tibia bones were harvested for bone mineral measurement.

    Results: Alcohol caused reduction in bone biomechanical parameters (maximum force, ultimate stress, yield stress and Young's modulus) and bone minerals (bone calcium and magnesium) compared to control group (P<0.05). Palm vitamin E was able to improve bone biomechanical parameters by increasing the maximum force, ultimate stress and Young's modulus (P<0.05) while alpha-tocopherol was not able to. Both alpha-tocopherol and palm vitamin E were able to significantly increase tibia calcium and magnesium content while only alpha-tocopherol caused significant increase in lumbar calcium content (P<0.05).

    Conclusion: Both palm vitamin E and alpha-tocopherol improved bone mineral content which was reduced by alcohol. However, only palm vitamin E was able to improve bone strength in alcohol treated rats.

  3. Shuid AN, Mehat Z, Mohamed N, Muhammad N, Soelaiman IN
    J. Bone Miner. Metab., 2010 Mar;28(2):149-56.
    PMID: 19779668 DOI: 10.1007/s00774-009-0122-2
    Recently, vitamin E has been found to promote the bone structure of nicotine-treated rats well above their baseline values, thus suggesting that vitamin E may have some anabolic action. A bone anabolic agent acts by improving the bone structure leading to stronger bone. To assess the possible anabolic action vitamin E on bone, we supplemented alpha-tocopherol (ATF) or gamma-tocotrienol (GTT) at 60 mg/kg or vehicle [normal control (NC) group] for 4 months to normal male rats and measured their bone structure and biomechanical properties. Histomorphometric analysis revealed that vitamin E-supplemented rats have better trabecular volume, thickness, number, and separation than rats receiving vehicle only. For the first time we reported that GTT improves all the parameters of bone biomechanical strength, while ATF only improved some of the parameters compared to the NC group. Vitamin E supplementation, especially with the gamma isomer, improves bone structure, which contributed to stronger bone. Therefore, vitamin E has the potential to be used as an anabolic agent to treat osteoporosis or as bone supplements for young adults to prevent osteoporosis in later years.
  4. Hayatullina Z, Muhammad N, Mohamed N, Soelaiman IN
    PMID: 23024690
    Oxidative stress and free radicals have been implicated in the pathogenesis of osteoporosis. Therefore, antioxidant compounds have the potential to be used in the prevention and treatment of the disease. In this study, we investigated the effects of virgin coconut oil (VCO) on bone microarchitecture in a postmenopausal osteoporosis rat model. VCO is a different form of coconut oil as it is rich with antioxidants. Three-month-old female rats were randomly grouped into baseline, sham-operated, ovariectomized control (Ovx), and ovariectomized rats fed with 8% VCO in their diet for six weeks (Ovx+VCO). Bone histomorphometry of the right femora was carried out at the end of the study. Rats supplemented with VCO had a significantly greater bone volume and trabecular number while trabecular separation was lower than the Ovx group. In conclusion, VCO was effective in maintaining bone structure and preventing bone loss in estrogen-deficient rat model.
  5. Manshor NM, Razali N, Jusoh RR, Asmawi MZ, Mohamed N, Zainol S, et al.
    Int J Cardiol Hypertens, 2020 Mar;4:100024.
    PMID: 33447753 DOI: 10.1016/j.ijchy.2020.100024
    Introduction: Labisia pumila has been reported to possess activities including antioxidant, anti-aging and anti-cancer but there is no report on its vasorelaxant effects.

    Objective: This study aims to fractionate water extract of Labisia pumila, identify the compound(s) involved and elucidate the possible mechanism(s) of its vasorelaxant effects.

    Methods: Water extract of Labisia pumila was subjected to liquid-liquid extraction to obtain ethyl acetate, n-butanol and water fractions. In SHR aortic ring preparations, water fraction (WF-LPWE) was established as the most potent fraction for vasorelaxation. The pharmacological mechanisms of the vasorelaxant effect of WF-LPWE were investigated with and without the presence of various inhibitors. The cumulative dose-response curves of potassium chloride (KCl)-induced contractions were conducted to study the possible mechanisms of WF-LPWE in reducing vasoconstriction.

    Results: WF-LPWE produced dose-dependent vasorelaxant effect in endothelium-denuded aortic ring and showed non-competitive inhibition of dose-response curves of PE-induced contraction, and at its higher concentrations reduced KCl-induced contraction. 1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one (ODQ) significantly inhibited vasorelaxant effect of WF-LPWE. WF-LPWE significantly reduced the release of intracellular calcium ion (Ca2+) from the intracellular stores and suppressed the calcium chloride (CaCal2)-induced contraction. Nω-nitro-L-arginine methyl ester (L-NAME), methylene blue, indomethacin and atropine did not influence the vasorelaxant effects of WF-LPWE.

    Conclusion: WF-LPWE exerts its vasorelaxant effect independently of endothelium and possibly by inhibiting the release of calcium from intracellular calcium stores, receptor-operated calcium channels and formation of inositol 1,4,5- triphosphate. WF-LPWE vasorelaxant effect may also mediated via nitric oxide-independent direct involvement of soluble guanylate cyclase (sGC)/ cyclic guanosine monophosphate (cGMP) pathways.

  6. Che Mohamed N, Moey SF, Lim BC
    Asian Pac J Cancer Prev, 2019 09 01;20(9):2865-2873.
    PMID: 31554389 DOI: 10.31557/APJCP.2019.20.9.2865
    Background: Early detection of breast cancer is essential in improving overall women’s health. The researchers
    sought to develop a comprehensive measure that combined the basic components of the health belief model (HBM)
    with a focus on breast self-examination (BSE) and screening mammogram amongst women. Methods: Questionnaire
    items were developed following a review of relevant literature of HBM on BSE and screening mammogram. The
    sampling frame for the study was Malaysian women aged 35 to 70 years old, living in Kuantan, Pahang and able to
    read or write in Bahasa Malaysia or English. As such, 103 women were randomly selected to participate in the study.
    Tests of validity using exploratory factor analysis (EFA) and reliability were subsequently performed to determine the
    psychometric properties of the questionnaire. Results: The EFA revealed nine factors (self-efficacy of mammogram,
    perceived barriers of BSE and mammogram, perceived susceptibility of breast cancer, perceived severity of breast
    cancer, cues to action for mammogram screening, perceived benefits of BSE, health motivation, perceived benefits
    of mammogram and self-efficacy of BSE) containing 54 items that jointly accounted for 74.2% of the observed
    variance. All nine factors have good internal consistency with Cronbach’s alpha ≥ 0.8. Fifty-four items remained in
    the final questionnaire after deleting 13 problematic items. The scale also showed good convergent and discriminant
    validity. Conclusion: The findings showed that the designed questionnaire was a valid and reliable instrument for the
    study involving women in Kuantan, Pahang. The instrument can help to assess women’s beliefs on BSE adoption and
    mammogram screening in health care practice and research.
  7. Ibrahim N', Mohamed N, Shuid AN
    Curr Drug Targets, 2013 Dec;14(13):1524-32.
    PMID: 23876090
    Fracture healing is a process of recovering injured bone tissue forms and functions. Osteoporosis can delay the healing process, which contributes to personal suffering and loss of activities. Osteoporosis patients tend to lose bone mass at the metaphyseal region which require treatment to increase bone mass. Postmenopausal osteoporosis is the most common osteoporosis that occurs in women which subsequently resulted in fractures even under slight trauma. Estrogen Replacement Therapy (ERT), the recommended therapy for postmenopausal osteoporosis, is associated with higher risk of breast cancer, ovarian cancer and cardiovascular diseases. As osteoporotic fractures are becoming a public health issue, alternative treatment is now being thoroughly explored. The potential agent is statins, the HMG-CoA reductase inhibitor which is widely used for hypercholesterolemia treatment. Statins have been found to increase bone mass by stimulation of Bone morphogenetic protein-2 (BMP-2) expression and Vascular Endothelial Growth Factor (VEGF) production. However, these bone forming effects were achieved at very high systemic doses. Therefore, studies on locally applied statins are required to further explore the ability of statins to stimulate bone formation at acceptable doses for better fracture healing. This review highlights the animal and clinical studies on fracture healing promotions by statins and the mechanisms involved.
  8. Muhammad N, Luke DA, Shuid AN, Mohamed N, Soelaiman IN
    PMID: 23118785 DOI: 10.1155/2012/161527
    Postmenopausal osteoporotic bone loss occurs mainly due to cessation of ovarian function, a condition associated with increased free radicals. Vitamin E, a lipid-soluble vitamin, is a potent antioxidant which can scavenge free radicals in the body. In this study, we investigated the effects of alpha-tocopherol and pure tocotrienol on bone microarchitecture and cellular parameters in ovariectomized rats. Three-month-old female Wistar rats were randomly divided into ovariectomized control, sham-operated, and ovariectomized rats treated with either alpha-tocopherol or tocotrienol. Their femurs were taken at the end of the four-week study period for bone histomorphometric analysis. Ovariectomy causes bone loss in the control group as shown by reduction in both trabecular volume (BV/TV) and trabecular number (Tb.N) and an increase in trabecular separation (Tb.S). The increase in osteoclast surface (Oc.S) and osteoblast surface (Ob.S) in ovariectomy indicates an increase in bone turnover rate. Treatment with either alpha-tocopherol or tocotrienol prevents the reduction in BV/TV and Tb.N as well as the increase in Tb.S, while reducing the Oc.S and increasing the Ob.S. In conclusion, the two forms of vitamin E were able to prevent bone loss due to ovariectomy. Both tocotrienol and alpha-tocopherol exert similar effects in preserving bone microarchitecture in estrogen-deficient rat model.
  9. Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
  10. Muhammad N, Luke DA, Shuid AN, Mohamed N, Soelaiman IN
    Clinics (Sao Paulo), 2013 Oct;68(10):1338-43.
    PMID: 24212841 DOI: 10.6061/clinics/2013(10)08
    OBJECTIVE: Accelerated bone loss that occurs in postmenopausal women has been linked to oxidative stress and increased free radicals. We propose the use of antioxidants to prevent and reverse postmenopausal osteoporosis. This study aimed to examine the effects of tocotrienol, a vitamin E analog, on bone loss due to estrogen deficiency. Our previous study showed that tocotrienol increased the trabecular bone volume and trabecular number in ovariectomized rats. In the current study, we investigated the effects of tocotrienol supplementation on various biochemical parameters in a postmenopausal osteoporosis rat model.

    MATERIALS AND METHODS: A total of 32 female Wistar rats were randomly divided into four groups. The baseline group was sacrificed at the start of the study, and another group was sham operated. The remaining rats were ovariectomized and either given olive oil as a vehicle or treated with tocotrienol at a dose of 60 mg/kg body weight. After four weeks of treatment, blood was withdrawn for the measurement of interleukin-1 (IL1) and interleukin-6 (IL6) (bone resorbing cytokines), serum osteocalcin (a bone formation marker) and pyridinoline (a bone resorption marker).

    RESULTS: Tocotrienol supplementation in ovariectomized rats significantly reduced the levels of osteocalcin, IL1 and IL6. However, it did not alter the serum pyridinoline level.

    CONCLUSION: Tocotrienol prevented osteoporotic bone loss by reducing the high bone turnover rate associated with estrogen deficiency. Therefore, tocotrienol has the potential to be used as an anti-osteoporotic agent in postmenopausal women.

  11. Hariono M, Choi SB, Roslim RF, Nawi MS, Tan ML, Kamarulzaman EE, et al.
    PLoS One, 2019;14(1):e0210869.
    PMID: 30677071 DOI: 10.1371/journal.pone.0210869
    Dengue virus Type 2 (DENV-2) is predominant serotype causing major dengue epidemics. There are a number of studies carried out to find its effective antiviral, however to date, there is still no molecule either from peptide or small molecules released as a drug. The present study aims to identify small molecules inhibitor from National Cancer Institute database through virtual screening. One of the hits, D0713 (IC50 = 62 μM) bearing thioguanine scaffold was derivatised into 21 compounds and evaluated for DENV-2 NS2B/NS3 protease inhibitory activity. Compounds 18 and 21 demonstrated the most potent activity with IC50 of 0.38 μM and 16 μM, respectively. Molecular dynamics and MM/PBSA free energy of binding calculation were conducted to study the interaction mechanism of these compounds with the protease. The free energy of binding of 18 calculated by MM/PBSA is -16.10 kcal/mol compared to the known inhibitor, panduratin A (-11.27 kcal/mol), which corroborates well with the experimental observation. Results from molecular dynamics simulations also showed that both 18 and 21 bind in the active site and stabilised by the formation of hydrogen bonds with Asn174.
  12. Abdul-Majeed S, Mohamed N, Soelaiman IN
    Life Sci, 2015 Mar 15;125:42-8.
    PMID: 25534439 DOI: 10.1016/j.lfs.2014.12.012
    Statins are competitive inhibitors of HMGCoA reductase and are commonly used as antihypercholesterolemic agents. Experimental studies clearly demonstrate the beneficial effects of statins on bone. Tocotrienols have also been shown to have anti-osteoporotic effects on the skeletal system. This study was conducted to observe the effect of a combination of delta-tocotrienol and lovastatin on structural bone histomorphometry and bone biomechanical strength in a postmenopausal rat model at clinically tolerable doses, and to compare it with the effect of delta-tocotrienol or lovastatin.
  13. Teh LK, Mohamed NI, Salleh MZ, Rohaizak M, Shahrun NS, Saladina JJ, et al.
    AAPS J, 2012 Mar;14(1):52-9.
    PMID: 22183189 DOI: 10.1208/s12248-011-9313-6
    CYP2D6 plays a major role in the metabolism of tamoxifen, and polymorphism of P-glycoprotein has been associated with resistance of many drug therapies. This study investigates the clinical impact of genetic variants of CYP2D6 and ABCB1 in breast cancer patients treated with tamoxifen. Blood samples from 95 breast cancer patients treated with tamoxifen were collected and genotyped for CYP2D6 and ABCB1 variants using allele-specific PCR method. Recurrence risks were calculated using Kaplan-Meier analysis and compared using the log-rank test. Patients carrying CYP2D6*10/*10 and heterozygous null allele (IM) showed higher risks of developing recurrence and metastasis (OR 13.14; 95% CI 1.57-109.94; P = 0.004) than patients with CYP2D6*1/*1 and *1/*10 genotypes. Patients with homozygous CC genotypes of ABCB1 C3435T showed a shorter time to recurrence. Patients who were CYP2D6 IM and homozygous CC genotype of C3435T have statistically significant higher risks of recurrence (P = 0.002). Similarly, median time to recurrence in these patients was only 12 months (95% CI = 0.79-23.2) compared to those without this combination which was 48 months (95% CI = 14.7-81.2). Patients with CYP2D6 IM and homozygous CC genotype of ABCB1 C3435T have shorter times to recurrence. The results confirmed the findings of previous studies and support FDA recommendation to perform pre-genotyping in patients before the choice of therapy is determined in breast cancer patients.
  14. Yusof ZYM, Mohamed NH, Radzi Z, Yahya NA, Ramli AS, Abdul Kadir R
    Ann Dent, 2007;14(1):31-38.
    MyJurnal
    Background: The high prevalence and impacts of orofacial pain (OFP) have caused major sufferings to individuals and society. The purpose of the study was to investigate the problems and impacts of OFP among a group of Malaysian aborigines. The objectives were to determine (i) the prevalence, aetiology, duration, severity, types and persistence of OFP during the past 3 months preceding the study; (ii) its associated impact on daily performance; and (iii) the measures taken for pain relief.
    Methods: This is a cross sectional study carried out in Kuala Lipis, Pahang involving 6 villages of Orang Asli Bateq and Semai. Study sample was chosen using convenient sampling including adults aged 16 years and above. Participants were invited for an interview using structured questionnaire followed by clinical examination. Data analysis was carried out using SPSS ver12.
    Results: Response rate was low at 20% (n = 140). Over one-quarter (26.4%) of the sample experienced OFP in the previous 3 months. Toothache was found to be the main aetiology (83.3%) followed by gingival pain (18.9%), temporomandibular joint (10.8%) and facial pain (8.1%). Mean duration of pain was 9.8 days for toothache, 162.4 days for gingival pain, 7.3 days for TMJ and 5.7 days for facial pain. Of those who had OFP, over half rated the pain as moderate (37.8%) and severe (29.7%) and most of the pain was ‘intermittent’ in nature (81.1%). Over half (62.2%) admitted the pain had disappeared during the interview. In terms of pain relief, 56.8% of the sample used traditional medicine. The pain had impacted on the chewing ability (70.3%, p=0.01), ability to sleep at night (73.0%, p<0.001), levels of anxiety (70.3%), ability to perform daily chores (33.3%) and social life (35.1%) of the Orang Asli sample.
    Conclusion: This study suggests the prevalence of OFP was high among the Orang Asli sample, which imposed considerable physical and psychological impacts on daily life.
    Key words: orofacial pain; impacts; quality of life; Malaysian aborigines
  15. Subramaniam S, Chan CY, Soelaiman IN, Mohamed N, Muhammad N, Ahmad F, et al.
    Arch Osteoporos, 2019 11 28;14(1):117.
    PMID: 31781876 DOI: 10.1007/s11657-019-0666-2
    The concordance between osteoporosis self-assessment tool for Asians (OSTA) and dual-energy X-ray absorptiometry (DXA) was fair in the study. Modification of OSTA cutoff values improved its sensitivity to identify subjects at risk for suboptimal bone health (osteopenia/osteoporosis) and osteoporosis.

    PURPOSE: Osteoporosis self-assessment tool for Asians (OSTA) is a convenient screening algorithm used widely to identify patients at risk of osteoporosis. Currently, the number of studies validating OSTA in Malaysian population is limited. This study aimed to validate the performance of OSTA in identifying subjects with osteoporosis determined with DXA.

    METHODS: This cross-sectional study recruited 786 Malaysians in Klang Valley, Malaysia. Their bone health status was assessed by DXA and OSTA. The association and agreement between OSTA and bone mineral density assessment by DXA were determined by Pearson's correlation and Cohen's kappa, respectively. Receiver operating characteristics (ROC) curves were used to determine the sensitivity, specificity, and area under the curve (AUC) for OSTA.

    RESULTS: OSTA and DXA showed a fair association in the study (r = 0.382, κ = 0.159, p 

  16. Mohd Effendy N, Mohamed N, Muhammad N, Mohamad IN, Shuid AN
    PMID: 22973408 DOI: 10.1155/2012/938574
    Osteoporosis which is characterized by low bone mass and microarchitectural deterioration with a consequent increase in bone fragility can be associated with various stimuli such as oxidative stress and inflammation. Postmenopausal women are more prone to osteoporosis due to reduction in estrogen which may further lead to elevation of oxidative stress and lipid accumulation which will promote osteoblasts apoptosis. Proinflammatory cytokines are elevated following estrogen deficiency. These cytokines are important determinants of osteoclasts differentiation and its bone resorption activity. The main treatment for postmenopausal osteoporosis is estrogen replacement therapy (ERT). Despite its effectiveness, ERT, however, can cause many adverse effects. Therefore, alternative treatment that is rich in antioxidant and can exert an anti-inflammatory effect can be given to replace the conventional ERT. Tualang honey is one of the best options available as it contains antioxidant as well as exerting anti-inflammatory effect which can act as a free radical scavenger, reducing the oxidative stress level as well as inhibiting proinflammatory cytokine. This will result in survival of osteoblasts, reduced osteoclastogenic activity, and consequently, reduce bone loss. Hence, Tualang honey can be used as an alternative treatment of postmenopausal osteoporosis with minimal side effects.
  17. Ibrahim N', Mohamed N, Soelaiman IN, Shuid AN
    Int J Environ Res Public Health, 2015 Oct;12(10):12958-76.
    PMID: 26501302 DOI: 10.3390/ijerph121012958
    Osteoporotic drugs are used to prevent fragility fractures, but their role in fracture healing still remains unknown. Thus, alternative agents with suitable mode of delivery are needed to promote fracture healing. This study was performed to investigate the effects of direct deliveries of lovastatin and tocotrienol to fracture sites on ossification-related gene expression in fracture healing in a postmenopausal osteoporosis model. Forty-eight Sprague Dawley female rats were divided into six groups. Group I comprised the sham-operated rats, while Groups II-VI were ovariectomized rats. After 8 weeks, the right tibiae of all rats were fractured and stabilized. Group I and Group II were given two single injections of lovastatin and tocotrienol carriers. Group III was given an estrogen preparation at 64.5 µg/kg daily via oral gavages. Group IV was injected with lovastatin particles (750 µg/kg), while Group V was injected with tocotrienol particles (60 mg/kg). Group VI received two single injections of 750 µg/kg lovastatin particles and 60 mg/kg tocotrienol particles. After 4 weeks, the gene expressions were measured. Group VI showed significantly higher gene expressions of osteocalcin, BMP-2, VEGF-α, and RUNX-2 compared to Group II. In conclusion, combined treatment of lovastatin and tocotrienol upregulated the expression of genes related to fracture healing.
  18. Suhana Mohd Ramli E, Nirwana Soelaiman I, Othman F, Ahmad F, Nazrun Shuib A, Mohamed N, et al.
    Iran J Med Sci, 2012 Mar;37(1):39-46.
    PMID: 23115429
    BACKGROUND: Long-term glucocorticoid therapy causes secondary osteoporosis leading to pathological fractures. Glucocorticoid action in bone is dependant upon the activity of 11β-hydroxysteroid dehydrogenase type 1 enzyme (11β-HSD1). Piper sarmentosum is a local herb that possesses the ability to inhibit 11-βHSD1 enzyme activity. We aimed to determine the effects of Piper sarmentosum water extract on 11-βHSD1 expressions and activity in the bones of glucocorticoid-treated adrenalectomized rats.

    METHODS: Forty male Sprague-Dawley rats (200-250 g) were used. Twenty-four animals were adrenalectomized and received intramuscular injection of dexamethasone (120 μg/kg/day). They were simultaneously administered with either Piper sarmentosum water extract (125 mg/kg/day), GCA (120 mg/kg/day) or distilled water as vehicle by oral gavage for two months. Eight animals were sham-operated and given vehicle daily, i.e. intramuscular olive oil and oral distilled water.

    RESULTS: Following two months treatment, dexamethasone-treated adrenalectomized rats had significantly lower 11β-HSD1 dehydrogenase activity and higher 11β-HSD1 expression in the femoral bones compared to the sham-operated and baseline group. The rats supplemented with Piper sarmentosum water extract had significantly higher 11β-HSD1 dehydrogenase activity and lower 11β-HSD1 expression in the bones.

    CONCLUSION: The results showed that Piper sarmentosum water extract had the ability to prevent glucocorcoticoid excess in the bones of glucocorticoid-treated adrenalectomized rats through the local modulation of 11β-HSD1 expression and activity, and may be used as prophylaxis for osteoporosis in patients on long-term glucocorticoid treatment.

  19. Mohamad S, Shuid AN, Mohamed N, Fadzilah FM, Mokhtar SA, Abdullah S, et al.
    Clinics (Sao Paulo), 2012 Sep;67(9):1077-85.
    PMID: 23018307
    OBJECTIVE: Osteoporosis increases the risk of bone fractures and may impair fracture healing. The aim of this study was to investigate whether alpha-tocopherol can improve the late-phase fracture healing of osteoporotic bones in ovariectomized rats.

    METHOD: In total, 24 female Sprague-Dawley rats were divided into three groups. The first group was sham-operated, and the other two groups were ovariectomized. After two months, the right femora of the rats were fractured under anesthesia and internally repaired with K-wires. The sham-operated and ovariectomized control rat groups were administered olive oil (a vehicle), whereas 60 mg/kg of alpha-tocopherol was administered via oral gavage to the alpha-tocopherol group for six days per week over the course of 8 weeks. The rats were sacrificed, and the femora were dissected out. Computed tomography scans and X-rays were performed to assess fracture healing and callus staging, followed by the assessment of callus strengths through the biomechanical testing of the bones.

    RESULTS: Significantly higher callus volume and callus staging were observed in the ovariectomized control group compared with the sham-operated and alpha-tocopherol groups. The ovariectomized control group also had significantly lower fracture healing scores than the sham-operated group. There were no differences between the alpha-tocopherol and sham-operated groups with respect to the above parameters. The healed femora of the ovariectomized control group demonstrated significantly lower load and strain parameters than the healed femora of the sham-operated group. Alpha-tocopherol supplementation was not able to restore these biomechanical properties.

    CONCLUSION: Alpha-tocopherol supplementation appeared to promote bone fracture healing in osteoporotic rats but failed to restore the strength of the fractured bone.

Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links