Displaying publications 1 - 20 of 47 in total

Abstract:
Sort:
  1. Wong YC, George E, Tan KL, Yap SF, Chan LL, Tan JA
    Malays J Pathol, 2006 Jun;28(1):17-21.
    PMID: 17694955
    The molecular basis of variable phenotypes in P-thalassaemia patients with identical genotypes has been associated with co-inheritance of alpha-thalassaemia and persistence of HbF production in adult life. The Xmn I restriction site at -158 position of the Ggamma-gene is associated with increased expression of the Ggamma-globin gene and higher production of HbF This study aims to determine the frequency of the digammaferent genotypes of the Ggamma Xmn I polymorphism in P-thalassaemia patients in two ethnic groups in Malaysia. Molecular characterisation and frequency of the Ggamma Xmn I polymorphism were studied in fifty-eight Chinese and forty-nine beta-thalassaemia Malay patients by Xmn I digestion after DNA amplification of a 650 bp sequence. The in-house developed technique did not require further purification or concentration of amplified DNA before restriction enzyme digestion. The cheaper Seakem LE agarose was used instead of Nusieve agarose and distinct well separated bands were observed. Genotyping showed that the most frequent genotype observed in the Malaysian Chinese was homozygosity for the absence of the Xmn I site (-/-) (89.7%). In the Malays, heterozygosity of the Xmn I site (+/-) was most common (63.3%). Homozygosity for the Xmn I site (+/+) was absent in the Chinese, but was confirmed in 8.2% of the Malays. The ratio of the (+) allele (presence of the Xmn I site) to the (-) allele (absence of the Xmn I site)) was higher in the Malays (0.66) compared to the Chinese (0.05). The (+/-) and (+/+) genotypes are more commonly observed in the Malays than the Chinese in Malaysia.
  2. Wong LP, George E, Tan JA
    BMC Public Health, 2011;11:193.
    PMID: 21447191 DOI: 10.1186/1471-2458-11-193
    Thalassaemia is a common public health problem in Malaysia and about 4.5 to 6% of the Malays and Chinese are carriers of this genetic disorder. The major forms of thalassaemia result in death in utero of affected foetuses (α-thalassaemia) or life-long blood transfusions for survival in β-thalassaemia. This study, the first nationwide population based survey of thalassaemia in Malaysia, aimed to determine differences in public awareness, perceptions and attitudes toward thalassaemia in the multi-racial population in Malaysia.
  3. Wong LP, George E, Tan JA
    J Community Genet, 2011 Jun;2(2):71-9.
    PMID: 22109791 DOI: 10.1007/s12687-011-0039-z
    Hemoglobin disorders which include thalassemias are the most common heritable disorders. Effective treatment is available, and these disorders can be avoided as identification of carriers is achievable using simple hematological tests. An in-depth understanding of the awareness, attitudes, perceptions, and screening reservations towards thalassemia is necessary, as Malaysia has a multi-ethnic population with different religious beliefs. A total of 13 focus group discussions (70 participants) with members of the general lay public were conducted between November 2008 and January 2009. Lack of knowledge and understanding about thalassemia leads to general confusions over differences between thalassemia carriers and thalassemia major, inheritance patterns, and the physical and psychologically impact of the disorder in affected individuals and their families. Although most of the participants have not been tested for thalassemia, a large majority expressed willingness to be screened. Views on prenatal diagnosis and termination of fetuses with thalassemia major received mixed opinions from participants with different religions and practices. Perceived stigma and discrimination attached to being a carrier emerged as a vital topic in some group discussions where disparity in the answers exhibited differences in levels of participants' literacy and ethnic origins. The two most common needs identified from the discussion were information and screening facilities. Participants' interest in knowing the severity of the disease and assessing their risk of getting the disorder may imply the health belief model as a possible means of predicting thalassemia public screening services. Findings provide valuable insights for the development of more effective educational, screening, and prenatal diagnostic services in the multi-ethnic Asian society.
  4. Wong FN, Chua KH, Kuppusamy UR, Wong CM, Lim SK, Tan JA
    PeerJ, 2016;4:e1908.
    PMID: 27114872 DOI: 10.7717/peerj.1908
    Chronic kidney disease (CKD) is a condition associated with progressive loss of kidney function and kidney damage. The two common causes of CKD are diabetes mellitus and hypertension. Other causes of CKD also include polycystic kidney disease, obstructive uropathy and primary glomerulonephritis. The receptor for advanced glycation end-products (RAGE) is a multi-ligand cell surface receptor of the immunoglobulin superfamily and it has been associated with kidney disease in both non-diabetic and diabetic patients. Presently, data on the association between RAGE polymorphisms and CKD in the Malaysian population is limited, while numerous studies have reported associations of RAGE polymorphisms with diabetic complications in other populations. The present study aims to explore the possibility of using RAGE polymorphisms as candidate markers of CKD in Malaysian population by using association analysis.
  5. Wong FN, Tan JA, Keng TC, Ng KP, Chua KH, Kuppusamy UR
    Clin Chim Acta, 2016 Jan 30;453:56-61.
    PMID: 26657980 DOI: 10.1016/j.cca.2015.12.002
    BACKGROUND: This study aimed to investigate the relationship between soluble RAGE and estimated glomerular filtration rate (eGFR) in patients with chronic kidney disease (CKD) after controlling for the potential confounding factors such as medication usage and enzymatic antioxidants.
    METHODS: A total of 222 CKD patients whose eGFR is less than 60ml/min/1.73m(2) and 111 non-CKD individuals were recruited. The study subjects were classified based on their diabetes status. The plasma glutathione peroxidase (GPx) and superoxide dismutase (SOD) activities as well as plasma soluble RAGE level were measured.
    RESULTS: The plasma GPx and SOD activities were significantly lower and the plasma soluble RAGE level was significantly higher in the CKD patients than in the non-CKD individuals, regardless of the diabetes status. Soluble RAGE was significantly correlated with eGFR in both diabetic CKD (D-CKD) and non-diabetic CKD (ND-CKD) patients. The association between soluble RAGE and eGFR remained largely unaffected by the confounding factors in D-CKD patients. However, the confounding effect of enzymatic antioxidants in the relationship between eGFR and soluble RAGE was observed in ND-CKD patients.
    CONCLUSION: The increased plasma level of soluble RAGE is a better indicator of renal function decline in diabetic CKD patients instead of non-diabetic CKD patients.
    KEYWORDS: Chronic kidney disease; Diabetes; Enzymatic antioxidants; Glomerular filtration rate; Medications; Soluble RAGE
  6. Wee YC, Tan KL, Kuldip K, Tai KS, George E, Tan PC, et al.
    Community Genet, 2008;11(3):129-34.
    PMID: 18376108 DOI: 10.1159/000113874
    BACKGROUND/AIMS: Individuals with double heterozygosity for alpha- and beta-thalassaemia and heterozygous beta-thalassaemia show a similar haematological picture. Co-inheritance of alpha- and beta-thalassaemia in both partners may result in pregnancies with either Hb Bart's hydrops foetalis or beta-thalassaemia major, or pregnancies with both disorders.
    METHODS: The co-inheritance of alpha-thalassaemia in 322 beta-thalassaemia carriers in Malaysia was studied.
    RESULTS: The frequency of alpha-thalassaemia in the beta-thalassaemia carriers was 12.7% (41/322), with a carrier frequency of 7.8% for the SEA deletion, 3.7% for the -alpha(3.7) deletion, 0.9% for Hb Constant Spring and 0.3% for the -alpha(4.2) deletion.
    CONCLUSION: Double heterozygosity for alpha- and beta-thalassaemia was confirmed in 5 out of the 41 couples and the risk of the fatal condition Hb Bart's hydrops foetalis was confirmed in two of these couples. Detection of the Southeast Asian (SEA) deletion in the Malaysian Malays in this study confirms that Hb Bart's hydrops foetalis can occur in this ethnic group. Results of this study have provided new information on the frequency and different types of alpha-thalassaemia (--(SEA), -alpha(3.7) and -alpha(4.2) deletions, Hb Constant Spring) in Malaysian beta-thalassaemia carriers.
  7. Wee YC, Tan KL, Chow TW, Yap SF, Tan JA
    J Obstet Gynaecol Res, 2005 Dec;31(6):540-6.
    PMID: 16343256 DOI: 10.1111/j.1447-0756.2005.00333.x
    AIM: Interactions between different determinants of alpha-thalassemia raises considerable problems, particularly during pregnancies where antenatal diagnosis is necessary. This study aims to determine the different types of deletional alpha-thalassemia and Hemoglobin Constant Spring (HbCS), and their frequency in Malays, Chinese and Indians in Malaysia.
    METHODS: DNA from 650 pregnant women from the Antenatal Clinic of the University of Malaya Medical Center in Kuala Lumpur, Malaysia who showed mean cell volume < or =89 fL and/or mean cell hemoglobin < or =28 pg were analyzed for the double alpha-globin gene South-East Asian deletion (--SEA), the -alpha3.7 and -alpha4.2 single alpha-globin gene deletions and HbCS.
    RESULTS: One hundred and three (15.8%) of the pregnant women were confirmed as alpha-thalassemia carriers: 25 (3.8%) were alpha-thalassemia-1 carriers with the --SEA/alphaalpha genotype, 64 (9.8%) were heterozygous for the -alpha3.7 rightward deletion (-alpha3.7/alphaalpha), four (0.6%) were heterozygous for the -alpha4.2 leftward deletion (-alpha4.2/alphaalpha), nine (1.4%) were heterozygous for HbCS (alphaCSalpha/alphaalpha) and one (0.2%) was compound heterozygous with the -alpha3.7/alphaCSalpha genotype. The double alpha-globin gene --SEA deletion was significantly higher in the Chinese (15%) compared to the Malays (2.5%) and not detected in the Indians studied. The -alpha3.7 deletion was distributed equally in the three races. HbCS and -alpha4.2 was observed only in the Malays.
    CONCLUSION: The data obtained gives a better understanding of the interactions of the different alpha-thalassemia determinants in the different ethnic groups, thus enabling more rapid and specific confirmation of alpha-thalassemia in affected pregnancies where antenatal diagnosis is necessary.
    Study site: Antenatal clinic, University Malaya Medical Centre (UMMC), Kuala Lumpur, Malaysia
  8. Wee YC, Tan KL, Chua KH, George E, Tan JA
    Malays J Med Sci, 2009 Jul;16(3):21-8.
    PMID: 22589661 MyJurnal
    BACKGROUND: The interaction of the non-deletional α(+)-thalassaemia mutations Haemoglobin Constant Spring and Haemoglobin Quong Sze with the Southeast Asian double α-globin gene deletion results in non-deletional Haemoglobin H disease. Accurate detection of non-deletional Haemoglobin H disease, which is associated with severe phenotypes, is necessary as these mutations have been confirmed in the Malaysian population.
    METHODS: DNA from two families with Haemoglobin H disease was extracted from EDTA-anticoagulated whole blood and subjected to molecular analysis for α-thalassaemia. A duplex polymerase chain reaction was used to detect the Southeast Asian α-globin gene deletion. Polymerase chain reaction-restriction fragment length polymorphism analysis was then carried out to determine the presence of Haemoglobin Constant Spring and Haemoglobin Quong Sze. A combine-amplification refractory mutation system protocol was optimised and implemented for the rapid and specific molecular characterisation of Haemoglobin Constant Spring and Haemoglobin Quong Sze in a single polymerase chain reaction.
    RESULTS AND CONCLUSIONS: The combine-amplification refractory mutation system for Haemoglobin Constant Spring and Haemoglobin Quong Sze, together with the duplex polymerase chain reaction, provides accurate pre- and postnatal diagnosis of non-deletional Haemoglobin H disease and allows detailed genotype analyses using minimal quantities of DNA.
    KEYWORDS: Combine-ARMS; Hb Constant Spring; Hb Quong Sze; medical sciences
  9. Thong MK, Tan JA, Tan KL, Yap SF
    J Trop Pediatr, 2005 Dec;51(6):328-33.
    PMID: 15967770 DOI: 10.1093/tropej/fmi052
    beta-thalassaemia major, an autosomal recessive hemoglobinopathy, is one of the most common single gene disorders in multi-racial Malaysia. The control of beta-thalassaemia major requires a multi-disciplinary approach that includes population screening, genetic counselling, prenatal diagnosis and the option of termination of affected pregnancies. To achieve this objective, the molecular characterisation of the spectrum of beta-globin gene mutations in each of the affected ethnic groups is required. We studied 88 consecutive unrelated individuals and their respective families with beta-thalassaemia (74 beta-thalassaemia major, 12 HbE-beta-thalassaemia, 2 with HbE homozygotes) and four individuals with beta-thalassaemia trait that contributed a total 180 alleles for study. Using a 2-step molecular diagnostic strategy consisting of amplification refractory mutation system (ARMS) to identify the 8 most common mutations followed by other DNA-based diagnostic techniques, a total of 177 (98.3 per cent) of the 180 beta-thalassaemia alleles were characterised. One out of 91 (1 per cent) of the Chinese alleles, one out of 46 (2.2 per cent) Malay alleles and one out of two Indian alleles remained unknown. A 100 per cent success rate was achieved in studying the Kadazandusun community in this study. A strategy to identify beta-globin gene mutations in Malaysians with beta-thalassaemia is proposed based on this outcome.
  10. Thong MK, Rudzki Z, Hall J, Tan JA, Chan LL, Yap SF
    Hum Mutat, 1999;13(5):413.
    PMID: 10338100 DOI: 10.1002/(SICI)1098-1004(1999)13:5<413::AID-HUMU15>
    Beta-thalassemia major is one of the commonest genetic disorders in South-East Asia. The spectrum of beta-thalassemia mutations in the various ethnic sub-populations on the island of Borneo is unknown. We studied 20 Dusun children from the East Malaysian state of Sabah (North Borneo) with a severe beta-thalassemia major phenotype, using a combination of Southern analysis, polymerase chain reaction analysis and direct sequencing. We found the children to be homozygous for a large deletion, which has a 5' breakpoint at position -4279 from the cap site of the beta-globin gene (HBB) with the 3' breakpoint located in a L1 family of repetitive sequences at an unknown distance from the beta-globin gene. This was similar to a recent finding of a large deletion causing beta-thalassemia first described in unrelated beta-thalassemia heterozygotes of Filipino descent. This report describes the first 20 families with homozygosity of the deletion causing a severe phenotype. It provides the first information on the molecular epidemiology of beta-thalassemia in Sabah. This finding has implications for the population genetics and preventative strategies for beta-thalassemia major for nearly 300 million individuals in South-East Asia.
  11. Thevakumar K, Chandren JR, Perez-Perez GI, Chua EG, Teh LK, Salleh MZ, et al.
    PLoS One, 2016;11(7):e0159830.
    PMID: 27441568 DOI: 10.1371/journal.pone.0159830
    The epidemiology of Helicobacter pylori (H. pylori) infection is related to human poverty with marked differences between developing and developed countries. Socioeconomic factors and living standards are the main determinants of the age-dependent acquisition rate of H. pylori, and consequently its prevalence. The aim of this study was to assess the risk and sero-prevalence of H. pylori colonization among Orang Asli in Peninsula Malaysia. This cross-sectional study was conducted on Orang Asli subjects in seven isolated settlements spanning across all three major tribes (Negrito, Proto Malay and Senoi) in Malaysia. Socio-demographic characteristics of the subjects were obtained through interview. Subjects were tested for H. pylori colonization based on CagA and whole cell (WC) antigen serological assays. A total of 275 subjects participated in this study. Among these subjects, 115 (44.7%) were H. pylori sero-positive with highest sero-prevalence among Negrito (65.7%). Among subjects who were H. pylori sero-positive, CagA sero positivity was also significantly higher among Negrito. The highest proportion of respondents reported to be H. pylori sero-positive was from age group 30 years old and below (57.9%), males (56.2%), Negrito (48.6%) and live in bamboo house (92.3%). The highest proportion of respondents reported to be CagA sero-positive was from age group 30 years old and below (41.4%), males (35.6%) and Negrito (48.6%). The results of this study demonstrate that H. pylori colonization can be related to age, gender, tribes and house materials and CagA sero-positive stain closely associated with age, gender and tribes.
  12. Teh LK, Lee TY, Tan JA, Lai MI, George E
    Int J Lab Hematol, 2015 Feb;37(1):79-89.
    PMID: 24725998 DOI: 10.1111/ijlh.12240
    In Malaysia, β-thalassaemia is a common inherited blood disorder in haemoglobin synthesis with a carrier rate of 4.5%. Currently, PCR-incorporating techniques such as amplification refractory mutation system (ARMS) or reverse dot blot hybridization (RDBH) are used in β-thalassaemia mutation detection. ARMS allows single-mutation identification using two reactions, one for wild type and another for mutant alleles. RDBH requires probe immobilization and optimization of hybridization and washing temperatures which is time consuming. The aim of our study was to investigate whether β-thalassaemia mutations can be identified in samples with low DNA concentrations.
  13. Teh LK, George E, Lai MI, Tan JA, Wong L, Ismail P
    J Hum Genet, 2014 Mar;59(3):119-23.
    PMID: 24369358 DOI: 10.1038/jhg.2013.131
    Beta-thalassemia is one of the most prevalent inherited diseases and a public health problem in Malaysia. Malaysia is geographically divided into West and East Malaysia. In Sabah, a state in East Malaysia, there are over 1000 estimated cases of β-thalassemia major patients. Accurate population frequency data of the molecular basis of β-thalassemia major are needed for planning its control in the high-risk population of Sabah. Characterization of β-globin gene defects was done in 252 transfusion dependent β-thalassemia patients incorporating few PCR techniques. The study demonstrates that β-thalassemia mutations inherited are ethnically dependent. It is important to note that 86.9% of transfusion-dependent β-thalassemia major patients in Sabah were of the indigenous population and homozygous for a single mutation. The Filipino β(0)-deletion was a unique mutation found in the indigenous population of Sabah. Mutations common in West Malaysia were found in 11 (4.3%) patients. Four rare mutations (Hb Monroe, CD 8/9, CD 123/124/125 and IVS I-2) were also found. This study is informative on the population genetics of β-thalassemia major in Sabah.
  14. Tan KL, Tan JA, Wong YC, Wee YC, Thong MK, Yap SF
    Genet. Test., 2001;5(1):17-22.
    PMID: 11336396 DOI: 10.1089/109065701750168626
    Beta-thalassemia major patients have chronic anemia and are dependent on blood transfusions to sustain life. Molecular characterization and prenatal diagnosis of beta3-thalassemia is essential in Malaysia because about 4.5% of the population are heterozygous carriers for beta-thalassemia. The high percentage of compound heterozygosity (47.62%) found in beta-thalassemia major patients in the Thalassaemia Registry, University of Malaya Medical Centre (UMMC), Malaysia, also supports a need for rapid, economical, and sensitive protocols for the detection of beta-thalassemia mutations. Molecular characterization of beta-thalassemia mutations in Malaysia is currently carried out using ARMS, which detects a single beta-thalassemia mutation per PCR reaction. We developed and evaluated Combine amplification refractory mutation system (C-ARMS) techniques for efficient molecular detection of two to three beta-thalassemia mutations in a single PCR reaction. Three C-ARMS protocols were evaluated and established for molecular characterization of common beta-thalassemia mutations in the Malay and Chinese ethnic groups in Malaysia. Two C-ARMS protocols (cd 41-42/IVSII #654 and -29/cd 71-72) detected the beta-thalassemia mutations in 74.98% of the Chinese patients studied. The CARMS for cd 41-42/IVSII #654 detected beta-thalassemia mutations in 72% of the Chinese families. C-ARMS for cd 41-42/IVSI #5/cd 17 allowed detection of beta-thalassemia mutations in 36.53% of beta-thalassemia in the Malay patients. C-ARMS for cd 41-42/IVSI #5/cd 17 detected beta-thalassemia in 45.54% of the Chinese patients. We conclude that C-ARMS with the ability to detect two to three mutations in a single reaction provides more rapid and cost-effective protocols for beta-thalassemia prenatal diagnosis and molecular analysis programs in Malaysia.
  15. Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
  16. Tan JA, Kho SL, Ngim CF, Chua KH, Goh AS, Yeoh SL, et al.
    Sci Rep, 2016 06 08;6:26994.
    PMID: 27271331 DOI: 10.1038/srep26994
    Haemoglobin (Hb) Adana (HBA2:c.179>A) interacts with deletional and nondeletional α-thalassaemia mutations to produce HbH disorders with varying clinical manifestations from asymptomatic to severe anaemia with significant hepatosplenomegaly. Hb Adana carriers are generally asymptomatic and haemoglobin subtyping is unable to detect this highly unstable α-haemoglobin variant. This study identified 13 patients with compound heterozygosity for Hb Adana with either the 3.7 kb gene deletion (-α(3.7)), Hb Constant Spring (HbCS) (HBA2:c.427T>C) or Hb Paksé (HBA2:429A>T). Multiplex Amplification Refractory Mutation System was used for the detection of five deletional and six nondeletional α-thalassaemia mutations. Duplex-PCR was used to confirm Hb Paksé and HbCS. Results showed 84.6% of the Hb Adana patients were Malays. Using DNA studies, compound heterozygosity for Hb Adana and HbCS (α(codon 59)α/α(CS)α) was confirmed in 11 patients. A novel point in this investigation was that DNA studies confirmed Hb Paksé for the first time in a Malaysian patient (α(codon 59)α/α(Paksé)α) after nine years of being misdiagnosis with Hb Adana and HbCS (α(codon 59)α/α(CS)α). Thus, the reliance on haematology studies and Hb subtyping to detect Hb variants is inadequate in countries where thalassaemia is prevalent and caused by a wide spectrum of mutations.
  17. Tan JA, Tay JS, Aziz NB, Saha N
    Hum. Hered., 1996 Jul-Aug;46(4):236-8.
    PMID: 8807327
    Restriction fragment length polymorphism (RFLP) of the gene encoding the beta chain of the human T cell receptor (TcR) was studied in three ethnic groups in Singapore by Southern blotting. Polymorphism in the beta chain gene was identified in BglII-digested DNA samples using a 770-bp TcR beta cDNA clone containing the joining and constant region segments. The TcR beta/BglII polymorphism was studied in 136 Chinese, 93 Indian and 88 Malay samples. The frequency of the less frequent allele (TcR beta*2) in all the ethnic groups was significantly lower (0.15-0.29, p < 0.01) than that in the Caucasians (0.46). Indians had a significantly lower frequency of this allele (0.15) than the Chinese (0.29) and Malays (0.26).
  18. Tan JA, Tay SH, Kham KY, Wong HB
    Jpn. J. Hum. Genet., 1993 Sep;38(3):315-8.
    PMID: 7903173 DOI: 10.1007/BF01874141
    The distribution of restriction fragment length polymorphism (RFLP) at the BamH1 site of the beta-globin gene was investigated in the Chinese, Indian, and Malay race in Singapore. The sample comprised of 183 normal individuals and 35 beta-thalassemia carriers in which 13 were couples with at least one beta-major child. The results from this study indicate that BamH1 polymorphism will be informative in 22% of pregnancies at risk for beta-thalassemia major in Chinese, 19% in Malays and 7% in Indians. In prenatal diagnosis using BamH1 polymorphism for one beta-major affected family, the fetus was diagnosed to be normal or beta-carrier. The validity of BamH1 polymorphism in the exclusion of beta-thalassemia major was subsequently confirmed at birth by globin chain biosynthesis.
  19. Tan JA, Tan KL, Omar KZ, Chan LL, Wee YC, George E
    Eur J Pediatr, 2009 Sep;168(9):1049-54.
    PMID: 19034506 DOI: 10.1007/s00431-008-0877-9
    INTRODUCTION: Interactions of different hemoglobin variants with thalassemia alleles can result in various clinical phenotypes. HbE-beta-thalassemia generally manifests with severe anemia where individuals exhibit beta-thalassemia major with regular blood transfusions or beta-thalassemia intermedia with periodic blood transfusions. This study presents a unique Malay family with three beta-globin gene defects-HbE, Hb South Florida, and IVS1-1 (G-->A).

    MATERIALS AND METHODS: HbE activates a cryptic splice site that produces non-functional mRNAs. Hb South Florida is a rare beta-hemoglobin variant, and its interactions with other beta-thalassemia alleles have not been reported. IVS1-1 is a Mediterranean mutation that affects mRNA processing giving rise to beta(o)-thalassemia.

    RESULTS AND DISCUSSION: Fifteen mutations along the beta-globin gene complex were analyzed using the amplification refractory mutation system. Hb South Florida was identified by direct sequencing using genomic DNA.

    CONCLUSION: The affected child with HbE/IVS1-1 produced a beta-thalassemia major phenotype. Compound heterozygosity for Hb South Florida/IVS1-1 produced a beta-thalassemia carrier phenotype in the mother.

  20. Tan JA, Chin PS, Wong YC, Tan KL, Chan LL, George E
    Pathology, 2006 Oct;38(5):437-41.
    PMID: 17008283
    In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations.
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links