t(11;18)(q21;q21) Translocation and trisomy 3 are the most common chromosomal aberrations reported in low-grade mucosa-associated lymphoid tissue (MALT) lymphoma. The current study aims to investigate the frequency of these chromosomal aberrations in a series of 52 extranodal B-cell lymphomas. The tumours were categorised into three histological grades: grade 1 (low-grade lymphoma of MALT type), grade 2 [diffuse large B-cell lymphoma (DLBCL) with MALT component] and grade 3 (DLBCL without MALT component). Fluorescence in situ hybridisation analyses on paraffin tissue sections were performed using a locus-specific probe for the 18q21 region and a centromeric probe for chromosome 3. The 18q21 rearrangement was detected in 9 of 40 (23%) cases, including 7 of 23 (30%) grade-1 and 2 of 11 (18%) grade-3 tumours. Amplification of the 18q21 region was detected in 10 of 40 (25%) cases, and trisomy 3 was detected in 9 of 34 (26%) cases. Amplification of the 18q21 region may be an important alternative pathogenetic pathway in MALT lymphoma and was found almost exclusively in tumours without 18q21 rearrangement. Our study showed that tumours with 18q21 rearrangement and 18q21 amplification develop along two distinct pathways, and the latter was more likely to transform into high-grade tumours upon acquisition of additional genetic alterations, such as trisomy 3. Trisomy 3 was more frequently found in coexistence with 18q21 abnormalities, suggesting that it was more likely to be a secondary aberration.
AIM: Interactions between different determinants of alpha-thalassemia raises considerable problems, particularly during pregnancies where antenatal diagnosis is necessary. This study aims to determine the different types of deletional alpha-thalassemia and Hemoglobin Constant Spring (HbCS), and their frequency in Malays, Chinese and Indians in Malaysia.
METHODS: DNA from 650 pregnant women from the Antenatal Clinic of the University of Malaya Medical Center in Kuala Lumpur, Malaysia who showed mean cell volume < or =89 fL and/or mean cell hemoglobin < or =28 pg were analyzed for the double alpha-globin gene South-East Asian deletion (--SEA), the -alpha3.7 and -alpha4.2 single alpha-globin gene deletions and HbCS.
RESULTS: One hundred and three (15.8%) of the pregnant women were confirmed as alpha-thalassemia carriers: 25 (3.8%) were alpha-thalassemia-1 carriers with the --SEA/alphaalpha genotype, 64 (9.8%) were heterozygous for the -alpha3.7 rightward deletion (-alpha3.7/alphaalpha), four (0.6%) were heterozygous for the -alpha4.2 leftward deletion (-alpha4.2/alphaalpha), nine (1.4%) were heterozygous for HbCS (alphaCSalpha/alphaalpha) and one (0.2%) was compound heterozygous with the -alpha3.7/alphaCSalpha genotype. The double alpha-globin gene --SEA deletion was significantly higher in the Chinese (15%) compared to the Malays (2.5%) and not detected in the Indians studied. The -alpha3.7 deletion was distributed equally in the three races. HbCS and -alpha4.2 was observed only in the Malays.
CONCLUSION: The data obtained gives a better understanding of the interactions of the different alpha-thalassemia determinants in the different ethnic groups, thus enabling more rapid and specific confirmation of alpha-thalassemia in affected pregnancies where antenatal diagnosis is necessary.
Study site: Antenatal clinic, University Malaya Medical Centre (UMMC), Kuala Lumpur, Malaysia
Beta-thalassaemia major causes severe anaemia and patients with it may be transfusion-dependent for life. Regular blood transfusions cause iron-overload that leads to oxidative damage which can hasten mortality. The objective of this research was to study the oxidant-antioxidant indices in beta-thalassaemia major patients at the University of Malaya Medical Centre (UMMC) who were on desferrioxamine-chelation or without chelation therapy. Blood was collected from 39 Chinese patients and 20 controls. Plasma and peripheral blood mononuclear cell lysates (PBMC) were extracted and biochemical tests to evaluate oxidative stress were performed. Oxidative stress was evident in these patients as advanced oxidized protein products (AOPP) and lipid hydroperoxides were elevated, whereas glutathione peroxidase activity and the ferric reducing antioxidant power (FRAP) were reduced. The catalase activity in the patients' PBMC was elevated, possibly as a compensatory mechanism for the reduced glutathione peroxidase activity in both red blood cells and PBMC. The lower FRAP and higher AOPP levels in the non-chelated patients compared with the chelated patients were indicative of a lower oxidative stress level in the chelated patients. The ferritin levels in the chelated and non-chelated patients were high and the mean levels of liver enzyme activities in the majority of patients were elevated regardless of chelation therapy. In conclusion, this study indicates that desferrioxamine chelation therapy does not normalize ferritin level but attenuates oxidative damage and improves total antioxidant level in Malaysian Chinese beta-thalassaemia major patients.
The spectrum of beta-thalassemia mutations in Malays in Singapore and Kelantan (Northeast Malaysia) was studied. Allele specific priming was used to determine the mutations in beta-carriers at -28, Codon 17, IVSI #1, IVSI #5, Codon 41-42 and IVSII #654 along the beta-globin gene. The most common structural hemoglobin variant in Southeast Asia, Hb E, was detected by DNA amplification with restriction enzyme (Mnl1) analysis. Direct genomic sequencing was carried out to detect the beta-mutations uncharacterized by allele-specific priming. The most prevalent beta-mutations in Singaporean Malays were IVSI #5 (45.83%) followed by Hb E (20.83%), codon 15 (12.5%) and IVSI #1 and IVSII #654 at 4.17% each. In contrast, the distribution of the beta-mutations in Kelantan Malays differed, with Hb E as the most common mutation (39.29%) followed by IVSI #5 (17.86%), codon 41-42 (14.29%), codon 19 (10.71%) and codon 17 (3.57%). The beta-mutations in Kelantan Malays follow closely the distribution of beta-mutations in Thais and Malays of Southern Thailand and Malays of West Malaysia. The AAC-->AGC base substitution in codon 19 has been detected only in these populations. The spectrum of beta-mutations in the Singaporean Malays is more similar to those reported in Indonesia with the beta-mutation at codon 15 (TGG-->TAG) present in both populations. The characterization of beta-mutations in Singaporean and Kelantan Malays will facilitate the establishment of effective prenatal diagnosis programs for beta-thalassemia major in this ethnic group.
Detection and quantification of Hb subtypes of human blood is integral to presumptive identification of thalassaemias. It has been used in neonatal screening of thalassaemia and Hb variants. The use of discarded red blood cells following processing of the cord blood for stem cells provides readily available diagnostic material for thalassaemia screening. In this study, we determined the range of Hb subtypes in 195 consecutive cord blood samples collected for cord blood banking. The 'cord blood samples' analysed were those of the remaining red blood cells after the cord blood was processed for stem cell storage. Quantification of Hb subtypes by high performance liquid chromatography (HPLC) was done on BioRad Variant II Hb testing system. Only 73 (36.5%) of the samples could be analyzed neat without dilution. With a 1:300 dilution with wash solution the acceptable area as recommended by the manufacturer for reading of a C-gram within the 1 to 3 million ranges were achieved in all. Eighteen (9%) 12 showed classical Hb Barts (y4) prerun peaks were confirmed by Sebia Hydrasys automated Hb gel electrophoresis and quantified by Sebia Capillarys 2 capillary electrophoresis. Only 1 (0.5%) was presumptively identified with HbH disease. Due to the limited number of samples no beta-thalassaemia major, Hb E beta-thalassaemia and Hb Barts hydrops fetalis were found. The HPLC assay was possible at a cost US$ 5 per sample and a turnover time of 10 samples per hour without technical difficulties. This study reports an effective and valuable protocol for thalassaemia screening in red blood cells which would otherwise be discarded during cord blood processing. Cord blood with severe and intermediate forms of thalassaemia can be preselected and not stored.
Thalassaemia is an inherited blood disorder and is a significant public health problem in Malaysia, with many not knowing they carry the gene for thalassaemia. The two major forms are alpha and beta thalassaemia. An individual can co-inherit both the alpha and beta thalassaemia genes. This study determined the frequency of concurrent carriers of alpha thalassaemia in 231 beta thalassaemia carriers. Gap-PCR was done on extracted DNA of the beta thalassaemia samples to check for alpha thalassaemia 1 molecular defect. Eight (3.5%) samples were found to have concurrently inherited the alpha thalassaemia 1 (- -SEA) deletion. The significant carrier rate for alpha thalassaemia 1 indicates the need for the implementation of DNA analysis to complement thalassaemia screening in high risk populations.
The molecular basis of variable phenotypes in P-thalassaemia patients with identical genotypes has been associated with co-inheritance of alpha-thalassaemia and persistence of HbF production in adult life. The Xmn I restriction site at -158 position of the Ggamma-gene is associated with increased expression of the Ggamma-globin gene and higher production of HbF This study aims to determine the frequency of the digammaferent genotypes of the Ggamma Xmn I polymorphism in P-thalassaemia patients in two ethnic groups in Malaysia. Molecular characterisation and frequency of the Ggamma Xmn I polymorphism were studied in fifty-eight Chinese and forty-nine beta-thalassaemia Malay patients by Xmn I digestion after DNA amplification of a 650 bp sequence. The in-house developed technique did not require further purification or concentration of amplified DNA before restriction enzyme digestion. The cheaper Seakem LE agarose was used instead of Nusieve agarose and distinct well separated bands were observed. Genotyping showed that the most frequent genotype observed in the Malaysian Chinese was homozygosity for the absence of the Xmn I site (-/-) (89.7%). In the Malays, heterozygosity of the Xmn I site (+/-) was most common (63.3%). Homozygosity for the Xmn I site (+/+) was absent in the Chinese, but was confirmed in 8.2% of the Malays. The ratio of the (+) allele (presence of the Xmn I site) to the (-) allele (absence of the Xmn I site)) was higher in the Malays (0.66) compared to the Chinese (0.05). The (+/-) and (+/+) genotypes are more commonly observed in the Malays than the Chinese in Malaysia.
BACKGROUND: The interaction of the non-deletional α(+)-thalassaemia mutations Haemoglobin Constant Spring and Haemoglobin Quong Sze with the Southeast Asian double α-globin gene deletion results in non-deletional Haemoglobin H disease. Accurate detection of non-deletional Haemoglobin H disease, which is associated with severe phenotypes, is necessary as these mutations have been confirmed in the Malaysian population.
METHODS: DNA from two families with Haemoglobin H disease was extracted from EDTA-anticoagulated whole blood and subjected to molecular analysis for α-thalassaemia. A duplex polymerase chain reaction was used to detect the Southeast Asian α-globin gene deletion. Polymerase chain reaction-restriction fragment length polymorphism analysis was then carried out to determine the presence of Haemoglobin Constant Spring and Haemoglobin Quong Sze. A combine-amplification refractory mutation system protocol was optimised and implemented for the rapid and specific molecular characterisation of Haemoglobin Constant Spring and Haemoglobin Quong Sze in a single polymerase chain reaction.
RESULTS AND CONCLUSIONS: The combine-amplification refractory mutation system for Haemoglobin Constant Spring and Haemoglobin Quong Sze, together with the duplex polymerase chain reaction, provides accurate pre- and postnatal diagnosis of non-deletional Haemoglobin H disease and allows detailed genotype analyses using minimal quantities of DNA.
KEYWORDS: Combine-ARMS; Hb Constant Spring; Hb Quong Sze; medical sciences
The distribution of restriction fragment length polymorphism (RFLP) at the BamH1 site of the beta-globin gene was investigated in the Chinese, Indian, and Malay race in Singapore. The sample comprised of 183 normal individuals and 35 beta-thalassemia carriers in which 13 were couples with at least one beta-major child. The results from this study indicate that BamH1 polymorphism will be informative in 22% of pregnancies at risk for beta-thalassemia major in Chinese, 19% in Malays and 7% in Indians. In prenatal diagnosis using BamH1 polymorphism for one beta-major affected family, the fetus was diagnosed to be normal or beta-carrier. The validity of BamH1 polymorphism in the exclusion of beta-thalassemia major was subsequently confirmed at birth by globin chain biosynthesis.
Thirty patients with early onset breast cancer or familial breast cancer from Malaysia were analysed for germline mutation in the early onset breast cancer I gene (BRCA1). Direct sequencing of the entire coding region of BRCA1 identified a frameshift mutation, c.5447-5448insC (insC5447) (codon 1776 of exon 21) in a patient aged 32 of the Malay ethnic origin, who had no family history of breast and/or ovarian cancer. Eight polymorphisms (2201C > T, 2430T > C, P871L, E1038G, K1183R, 4427T > C, S1613G and IVS8-57delT) were identified in the samples tested.
β-Thalassemia is a public health problem where 4.5% of Malaysians are β-thalassemia carriers. The genetic disorder is caused by defects in the β-globin gene complex which lead to reduced or complete absence of β-globin chain synthesis. Five TaqMan genotyping assays were designed and developed to detect the common β-thalassemia mutations in Malaysian Malays. The assays were evaluated with 219 "blinded" DNA samples and the results showed 100% sensitivity and specificity. The in-house designed TaqMan genotyping assays were found to be cost- and time-effective for characterization of β-thalassemia mutations in the Malaysian population.
Homozygosity for the α-thalassaemia Southeast Asian (α-SEA) and Filipino β°-thalassaemia (β-FIL) deletions can cause serious complications leading to foetal death or life-long blood transfusions. A rapid and accurate molecular detection assay is essential in populations where the deletions are common. In this study, gap-polymerase chain reaction (PCR) with high resolution melting (HRM) analysis was developed to detect both the large deletions. Melting curves at 86.9 ± 0.1 °C were generated by normal individuals without the α-SEA deletion, 84.7 ± 0.1 °C by homozygous α-SEA deletion individuals and two melting curves at 84.7 ± 0.1 °C and 86.9 ± 0.1 °C by α-SEA deletion carriers. Normal individuals without the β-FIL deletion produce amplicons with a melting temperature (Tm) at 74.6 ± 0.1 °C, homozygous β-FIL individuals produce amplicons with Tm at 73.6 ± 0.1 °C and heterozygous β-FIL individuals generate two amplicons with Tm at 73.6 ± 0.1 °C and 74.6 ± 0.1 °C. Evaluation using blinded tests on 220 DNA samples showed 100% sensitivity and specificity. The developed assays are sensitive and specific for rapid molecular and prenatal diagnosis for the α-SEA and β-FIL deletions.
Haemoglobin (Hb) Adana (HBA2:c.179>A) interacts with deletional and nondeletional α-thalassaemia mutations to produce HbH disorders with varying clinical manifestations from asymptomatic to severe anaemia with significant hepatosplenomegaly. Hb Adana carriers are generally asymptomatic and haemoglobin subtyping is unable to detect this highly unstable α-haemoglobin variant. This study identified 13 patients with compound heterozygosity for Hb Adana with either the 3.7 kb gene deletion (-α(3.7)), Hb Constant Spring (HbCS) (HBA2:c.427T>C) or Hb Paksé (HBA2:429A>T). Multiplex Amplification Refractory Mutation System was used for the detection of five deletional and six nondeletional α-thalassaemia mutations. Duplex-PCR was used to confirm Hb Paksé and HbCS. Results showed 84.6% of the Hb Adana patients were Malays. Using DNA studies, compound heterozygosity for Hb Adana and HbCS (α(codon 59)α/α(CS)α) was confirmed in 11 patients. A novel point in this investigation was that DNA studies confirmed Hb Paksé for the first time in a Malaysian patient (α(codon 59)α/α(Paksé)α) after nine years of being misdiagnosis with Hb Adana and HbCS (α(codon 59)α/α(CS)α). Thus, the reliance on haematology studies and Hb subtyping to detect Hb variants is inadequate in countries where thalassaemia is prevalent and caused by a wide spectrum of mutations.
BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
Gram-negative bacilli of the genus Aeromonas are primarily inhabitants of the aquatic environment. Humans acquire this organism from a wide range of food and water sources as well as during aquatic recreational activities. In the present study, the diversity and distribution of Aeromonas species from freshwater lakes in Malaysia was investigated using glycerophospholipid-cholesterol acyltransferase (GCAT) and RNA polymerase sigma-factor (rpoD) genes for speciation. A total of 122 possible Aeromonas strains were isolated and confirmed to genus level using the API20E system. The clonality of the isolates was investigated using ERIC-PCR and 20 duplicate isolates were excluded from the study. The specific GCAT-PCR identified all isolates as belonging to the genus Aeromonas, in agreement with the biochemical identification. A phylogenetic tree was constructed using the rpoD gene sequence and all 102 isolates were identified as: A. veronii 43%, A. jandaei 37%, A. hydrophila 6%, A. caviae 4%, A. salmonicida 2%, A. media 2%, A. allosaccharophila 1%, A. dhakensis 1% and Aeromonas spp. 4%. Twelve virulence genes were present in the following proportions--exu 96%, ser 93%, aer 87%, fla 83%, enolase 70%, ela 62%, act 54%, aexT 33%, lip 16%, dam 16%, alt 8% and ast 4%, and at least 2 of these genes were present in all 102 strains. The ascV, aexU and hlyA genes were not detected among the isolates. A. hydrophila was the main species containing virulence genes alt and ast either present alone or in combination. It is possible that different mechanisms may be used by each genospecies to demonstrate virulence. In summary, with the use of GCAT and rpoD genes, unambiguous identification of Aeromonas species is possible and provides valuable data on the phylogenetic diversity of the organism.
The epidemiology of Helicobacter pylori (H. pylori) infection is related to human poverty with marked differences between developing and developed countries. Socioeconomic factors and living standards are the main determinants of the age-dependent acquisition rate of H. pylori, and consequently its prevalence. The aim of this study was to assess the risk and sero-prevalence of H. pylori colonization among Orang Asli in Peninsula Malaysia. This cross-sectional study was conducted on Orang Asli subjects in seven isolated settlements spanning across all three major tribes (Negrito, Proto Malay and Senoi) in Malaysia. Socio-demographic characteristics of the subjects were obtained through interview. Subjects were tested for H. pylori colonization based on CagA and whole cell (WC) antigen serological assays. A total of 275 subjects participated in this study. Among these subjects, 115 (44.7%) were H. pylori sero-positive with highest sero-prevalence among Negrito (65.7%). Among subjects who were H. pylori sero-positive, CagA sero positivity was also significantly higher among Negrito. The highest proportion of respondents reported to be H. pylori sero-positive was from age group 30 years old and below (57.9%), males (56.2%), Negrito (48.6%) and live in bamboo house (92.3%). The highest proportion of respondents reported to be CagA sero-positive was from age group 30 years old and below (41.4%), males (35.6%) and Negrito (48.6%). The results of this study demonstrate that H. pylori colonization can be related to age, gender, tribes and house materials and CagA sero-positive stain closely associated with age, gender and tribes.
Chronic kidney disease (CKD) is a condition associated with progressive loss of kidney function and kidney damage. The two common causes of CKD are diabetes mellitus and hypertension. Other causes of CKD also include polycystic kidney disease, obstructive uropathy and primary glomerulonephritis. The receptor for advanced glycation end-products (RAGE) is a multi-ligand cell surface receptor of the immunoglobulin superfamily and it has been associated with kidney disease in both non-diabetic and diabetic patients. Presently, data on the association between RAGE polymorphisms and CKD in the Malaysian population is limited, while numerous studies have reported associations of RAGE polymorphisms with diabetic complications in other populations. The present study aims to explore the possibility of using RAGE polymorphisms as candidate markers of CKD in Malaysian population by using association analysis.
p53 gene mutation is not a frequent event in the tumorigenesis of lymphomas and the expression of p53 protein is independent of p53 gene mutations. The present study aimed to investigate mutations in the p53 gene in a series of extranodal B-cell lymphomas, and its association with p53 protein expression. A total of 52 cases were graded histologically into Grade 1, Grade 2 and Grade 3 tumors and p53 protein expression was detected using immunohistochemistry. Mutations in the p53 gene were analyzed using polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) and mobility shifts were confirmed by direct sequencing. The tumors comprised 26 (50%) Grade 1, 9 (17%) Grade 2 and 15 (29%) Grade 3. A high proportion of Grade 2 (25%) tumors expressed p53 protein (P = 0.051) and carried p53 gene mutation (33%) (P = 0.218). However, p53 protein expression was not associated with p53 gene mutations (P = 0.057). Transversion mutations (88%) were more frequently detected than transition mutations (12%). The present study revealed that p53 gene mutations and p53 protein expression occurred in higher frequencies in Grade 2 tumors, which may be of pathogenetic importance. The high frequency of transversion mutations may reflect the influence of an etiological agent in the tumorigenesis of mucosa-associated lymphoid tissue (MALT lymphoma).
In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations.