MyMedR

Displaying publications 1 - 20 of 47 in total

Abstract:

Sort:

Fulltext Mutation analysis of the BRCA1 gene in Malaysian breast cancer patients

Balraj P, Khoo AS, Volpi L, Tan JA, Nair S, Abdullah H

Singapore Med J, 2002 Apr;43(4):194-7.
PMID: 12188064

Thirty patients with early onset breast cancer or familial breast cancer from Malaysia were analysed for germline mutation in the early onset breast cancer I gene (BRCA1). Direct sequencing of the entire coding region of BRCA1 identified a frameshift mutation, c.5447-5448insC (insC5447) (codon 1776 of exon 21) in a patient aged 32 of the Malay ethnic origin, who had no family history of breast and/or ovarian cancer. Eight polymorphisms (2201C > T, 2430T > C, P871L, E1038G, K1183R, 4427T > C, S1613G and IVS8-57delT) were identified in the samples tested.
Paraoxonase 1 status in keratoconus: a preliminary study of activity and polymorphism

Poh R, Tan JA, Deva JP, Poo D, Yong Y, Arjunan S

West Indian Med J, 2012 Sep;61(6):569-73.
PMID: 23441349

To determine the activity of paraoxonase 1 (PON1) in keratoconus in a Malaysian population in comparison with non-keratoconic subjects.
Fulltext Phenotypic and Genetic Diversity of Aeromonas Species Isolated from Fresh Water Lakes in Malaysia

Khor WC, Puah SM, Tan JA, Puthucheary SD, Chua KH

PLoS One, 2015;10(12):e0145933.
PMID: 26710336 DOI: 10.1371/journal.pone.0145933

Gram-negative bacilli of the genus Aeromonas are primarily inhabitants of the aquatic environment. Humans acquire this organism from a wide range of food and water sources as well as during aquatic recreational activities. In the present study, the diversity and distribution of Aeromonas species from freshwater lakes in Malaysia was investigated using glycerophospholipid-cholesterol acyltransferase (GCAT) and RNA polymerase sigma-factor (rpoD) genes for speciation. A total of 122 possible Aeromonas strains were isolated and confirmed to genus level using the API20E system. The clonality of the isolates was investigated using ERIC-PCR and 20 duplicate isolates were excluded from the study. The specific GCAT-PCR identified all isolates as belonging to the genus Aeromonas, in agreement with the biochemical identification. A phylogenetic tree was constructed using the rpoD gene sequence and all 102 isolates were identified as: A. veronii 43%, A. jandaei 37%, A. hydrophila 6%, A. caviae 4%, A. salmonicida 2%, A. media 2%, A. allosaccharophila 1%, A. dhakensis 1% and Aeromonas spp. 4%. Twelve virulence genes were present in the following proportions--exu 96%, ser 93%, aer 87%, fla 83%, enolase 70%, ela 62%, act 54%, aexT 33%, lip 16%, dam 16%, alt 8% and ast 4%, and at least 2 of these genes were present in all 102 strains. The ascV, aexU and hlyA genes were not detected among the isolates. A. hydrophila was the main species containing virulence genes alt and ast either present alone or in combination. It is possible that different mechanisms may be used by each genospecies to demonstrate virulence. In summary, with the use of GCAT and rpoD genes, unambiguous identification of Aeromonas species is possible and provides valuable data on the phylogenetic diversity of the organism.
Fulltext High prevalence of alpha- and beta-thalassemia in the Kadazandusuns in East Malaysia: challenges in providing effective health care for an indigenous group

Tan JA, Lee PC, Wee YC, Tan KL, Mahali NF, George E, et al.

J Biomed Biotechnol, 2010;2010.
PMID: 20871816 DOI: 10.1155/2010/706872

Thalassemia can lead to severe transfusion-dependent anemia, and it is the most common genetic disorder in Malaysia. This paper aims to determine the prevalence of thalassemia in the Kadazandusuns, the largest indigenous group in Sabah, East Malaysia. α- and β-thalassemia were confirmed in 33.6% and 12.8%, of the individuals studied respectively. The high prevalence of α- and β-thalassemia in the Kadazandusuns indicates that thalassemia screening, genetic counseling, and prenatal diagnosis should be included as part of their healthcare system. This preliminary paper serves as a baseline for further investigations into the health and genetic defects of the major indigenous population in Sabah, East Malaysia.
Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations

Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.

Public Health Genomics, 2015;18(1):60-4.
PMID: 25412720 DOI: 10.1159/000368342

BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
The use of Taqman genotyping assays for rapid confirmation of β-thalassaemia mutations in the Malays: accurate diagnosis with low DNA concentrations

Teh LK, Lee TY, Tan JA, Lai MI, George E

Int J Lab Hematol, 2015 Feb;37(1):79-89.
PMID: 24725998 DOI: 10.1111/ijlh.12240

In Malaysia, β-thalassaemia is a common inherited blood disorder in haemoglobin synthesis with a carrier rate of 4.5%. Currently, PCR-incorporating techniques such as amplification refractory mutation system (ARMS) or reverse dot blot hybridization (RDBH) are used in β-thalassaemia mutation detection. ARMS allows single-mutation identification using two reactions, one for wild type and another for mutant alleles. RDBH requires probe immobilization and optimization of hybridization and washing temperatures which is time consuming. The aim of our study was to investigate whether β-thalassaemia mutations can be identified in samples with low DNA concentrations.
Fulltext Screening of concurrent alpha-thalassaemia 1 in beta-thalassaemia carriers

Chong YM, Tan JA, Zubaidah Z, Rahimah A, Kuldip K, George E

Med J Malaysia, 2006 Jun;61(2):217-20.
PMID: 16898315

Thalassaemia is an inherited blood disorder and is a significant public health problem in Malaysia, with many not knowing they carry the gene for thalassaemia. The two major forms are alpha and beta thalassaemia. An individual can co-inherit both the alpha and beta thalassaemia genes. This study determined the frequency of concurrent carriers of alpha thalassaemia in 231 beta thalassaemia carriers. Gap-PCR was done on extracted DNA of the beta thalassaemia samples to check for alpha thalassaemia 1 molecular defect. Eight (3.5%) samples were found to have concurrently inherited the alpha thalassaemia 1 (- -SEA) deletion. The significant carrier rate for alpha thalassaemia 1 indicates the need for the implementation of DNA analysis to complement thalassaemia screening in high risk populations.
Fulltext DNA studies are necessary for accurate patient diagnosis in compound heterozygosity for Hb Adana (HBA2:c.179>A) with deletional or nondeletional α-thalassaemia

Tan JA, Kho SL, Ngim CF, Chua KH, Goh AS, Yeoh SL, et al.

Sci Rep, 2016 06 08;6:26994.
PMID: 27271331 DOI: 10.1038/srep26994

Haemoglobin (Hb) Adana (HBA2:c.179>A) interacts with deletional and nondeletional α-thalassaemia mutations to produce HbH disorders with varying clinical manifestations from asymptomatic to severe anaemia with significant hepatosplenomegaly. Hb Adana carriers are generally asymptomatic and haemoglobin subtyping is unable to detect this highly unstable α-haemoglobin variant. This study identified 13 patients with compound heterozygosity for Hb Adana with either the 3.7 kb gene deletion (-α(3.7)), Hb Constant Spring (HbCS) (HBA2:c.427T>C) or Hb Paksé (HBA2:429A>T). Multiplex Amplification Refractory Mutation System was used for the detection of five deletional and six nondeletional α-thalassaemia mutations. Duplex-PCR was used to confirm Hb Paksé and HbCS. Results showed 84.6% of the Hb Adana patients were Malays. Using DNA studies, compound heterozygosity for Hb Adana and HbCS (α(codon 59)α/α(CS)α) was confirmed in 11 patients. A novel point in this investigation was that DNA studies confirmed Hb Paksé for the first time in a Malaysian patient (α(codon 59)α/α(Paksé)α) after nine years of being misdiagnosis with Hb Adana and HbCS (α(codon 59)α/α(CS)α). Thus, the reliance on haematology studies and Hb subtyping to detect Hb variants is inadequate in countries where thalassaemia is prevalent and caused by a wide spectrum of mutations.
Fulltext Analysis of α1 and α2 globin genes among patients with hemoglobin Adana in Malaysia

Lee TY, Lai MI, Ismail P, Ramachandran V, Tan JA, Teh LK, et al.

Genet. Mol. Res., 2016 Apr 07;15(2).
PMID: 27173219 DOI: 10.4238/gmr.15027400

Hemoglobin (Hb) Adana [HBA2: c179G>A (or HBA1); p.Gly60Asp] is a non-deletional α-thalassemia variant found in Malaysia. An improvement in the molecular techniques in recent years has made identification of Hb Adana much easier. For this study, a total of 26 Hb Adana α-thalassemia intermedia and 10 Hb Adana trait blood samples were collected from patients. Common deletional and non-deletional α-thalassemia genotypes were determined using multiplex gap polymerase chain reaction (PCR) and multiplex ARMS PCR techniques. Identification of the Hb Adana location on the α-globin gene was carried out using genomic sequencing and the location of the mutation was confirmed via restriction fragment length polymorphism-PCR. Among the 36 samples, 24 (66.7%) had the -α(3.7)/α(Cd59)α mutation, while the -α(3.7)/α(Cd59)α mutation accounted for 2 samples (5.6%) and the remaining 10 (27.8%) samples were α/α(Cd59)α. All 36 samples were found to have the Hb Adana mutation on the α2-globin gene. The position of the α-globin gene mutation found in our cases was similar to that reported in Indonesia (16%) but not to that in Turkey (0.6%). Our results showed that the Hb Adana mutation was preferentially present in the α2-globin genes in Malays compared to the other ethnicities in Malaysia. Thus, the Malays might have similar ancestry based on the similarities in the Hb Adana position.
Fulltext Non-invasive prenatal diagnosis using fetal DNA in maternal plasma: a preliminary study for identification of paternally-inherited alleles using single nucleotide polymorphisms

Chen JJ, Tan JA, Chua KH, Tan PC, George E

BMJ Open, 2015 Jul 22;5(7):e007648.
PMID: 26201722 DOI: 10.1136/bmjopen-2015-007648

OBJECTIVES: Single nucleotide polymorphism (SNP) with a mutation can be used to identify the presence of the paternally-inherited wild-type or mutant allele as result of the inheritance of either allele in the fetus and allows the prediction of the fetal genotype. This study aims to identify paternal SNPs located at the flanking regions upstream or downstream from the β-globin gene mutations at CD41/42 (HBB:c.127_130delCTTT), IVS1-5 (HBB:c.92+5G>C) and IVS2-654 (HBB:c.316-197C>T) using free-circulating fetal DNA.
SETTING: Haematology Lab, Department of Biomedical Science, University of Malaya.
PARTICIPANTS: Eight couples characterised as β-thalassaemia carriers where both partners posed the same β-globin gene mutations at CD41/42, IVS1-5 and IVS2-654, were recruited in this study.
OUTCOME MEASURES: Genotyping was performed by allele specific-PCR and the locations of SNPs were identified after sequencing alignment.
RESULTS: Genotype analysis revealed that at least one paternal SNP was present for each of the couples. Amplification on free-circulating DNA revealed that the paternal mutant allele of SNP was present in three fcDNA. Thus, the fetuses may be β-thalassaemia carriers or β-thalassaemia major. Paternal wild-type alleles of SNP were present in the remaining five fcDNA samples, thus indicating that the fetal genotypes would not be homozygous mutants.
CONCLUSIONS: This preliminary research demonstrates that paternal allele of SNP can be used as a non-invasive prenatal diagnosis approach for at-risk couples to determine the β-thalassaemia status of the fetus.
Interaction of Hb South Florida (codon 1; GTG-->ATG) and HbE, with beta-thalassemia (IVS1-1; G-->A): expression of different clinical phenotypes

Tan JA, Tan KL, Omar KZ, Chan LL, Wee YC, George E

Eur J Pediatr, 2009 Sep;168(9):1049-54.
PMID: 19034506 DOI: 10.1007/s00431-008-0877-9

INTRODUCTION: Interactions of different hemoglobin variants with thalassemia alleles can result in various clinical phenotypes. HbE-beta-thalassemia generally manifests with severe anemia where individuals exhibit beta-thalassemia major with regular blood transfusions or beta-thalassemia intermedia with periodic blood transfusions. This study presents a unique Malay family with three beta-globin gene defects-HbE, Hb South Florida, and IVS1-1 (G-->A).
MATERIALS AND METHODS: HbE activates a cryptic splice site that produces non-functional mRNAs. Hb South Florida is a rare beta-hemoglobin variant, and its interactions with other beta-thalassemia alleles have not been reported. IVS1-1 is a Mediterranean mutation that affects mRNA processing giving rise to beta(o)-thalassemia.
RESULTS AND DISCUSSION: Fifteen mutations along the beta-globin gene complex were analyzed using the amplification refractory mutation system. Hb South Florida was identified by direct sequencing using genomic DNA.
CONCLUSION: The affected child with HbE/IVS1-1 produced a beta-thalassemia major phenotype. Compound heterozygosity for Hb South Florida/IVS1-1 produced a beta-thalassemia carrier phenotype in the mother.
Characterisation and confirmation of rare beta-thalassaemia mutations in the Malay, Chinese and Indian ethnic groups in Malaysia

Tan JA, Chin PS, Wong YC, Tan KL, Chan LL, George E

Pathology, 2006 Oct;38(5):437-41.
PMID: 17008283

In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations.
Rapid detection of α-thalassaemia variants using droplet digital PCR

Lee TY, Lai MI, Ramachandran V, Tan JA, Teh LK, Othman R, et al.

Int J Lab Hematol, 2016 Aug;38(4):435-43.
PMID: 27349818 DOI: 10.1111/ijlh.12520

INTRODUCTION: Alpha thalassaemia is a highly prevalent disease globally and is a well-known public health problem in Malaysia. The deletional forms of the mutation are the most common forms found in alpha thalassaemia. The three most common deletional alpha thalassaemia found in this region include --(SEA) deletion, -α(3.7) rightward and -α(4.2) leftward deletions. The prevalence rate of triplication alpha cases such as ααα(anti3.7) and ααα(anti4.2) is not known in Malaysia although it plays a role in exacerbating the clinical phenotypes in beta thalassaemia carriers. Recently, there have been more reported cases of rare alpha thalassaemia mutations due to the advancement of molecular techniques involved in thalassaemia detections. Therefore, it is essential to develop a new method which allows the detection of different alpha thalassaemia mutations including the rare ones simultaneously and accurately.
METHODS: The purpose of this study was to design an assay for the detection of triplications, common and rare deletional alpha thalassaemia using droplet digital PCR (ddPCR).
RESULTS: This is a quantitative detection method to measure the changes of copy number which can detect deletions, duplications and triplications of the alpha globin gene simultaneously.
CONCLUSION: In conclusion, ddPCR is an alternative method for rapid detection of alpha thalassaemia variants in Malaysia.
Thalassemia intermedia in HbH-CS disease with compound heterozygosity for beta-thalassemia: challenges in hemoglobin analysis and clinical diagnosis

Tan JA, Kok JL, Tan KL, Wee YC, George E

Genes Genet Syst, 2009 Feb;84(1):67-71.
PMID: 19420802

Co-inheritance of alpha-thalassemia with homozygosity or compound heterozygosity for beta-thalassemia may ameliorate beta-thalassemia major. A wide range of clinical phenotypes is produced depending on the number of alpha-thalassemia alleles (-alpha/alphaalpha --/alphaalpha, --/-alpha). The co-inheritance of beta-thalassemia with alpha-thalassemia with a single gene deletion (-alpha/alphaalpha) is usually associated with thalassemia major. In contrast, the co-inheritance of beta-thalassemia with two alpha-genes deleted in cis or trans (--/alphaalpha or -alpha/-alpha) generally produces beta-thalassemia intermedia. In Southeast Asia, the most common defect responsible for alpha-thalassemia is the Southeast Asian (SEA) deletion of 20.5 kilobases. The presence of the SEA deletion with Hb Constant Spring (HbCS) produces HbH-CS disease. Co-inheritance of HbH-CS with compound heterozygosity for beta-thalassemia is very rare. This study presents a Malay patient with HbH-CS disorder and beta degrees/beta+-thalassemia. The SEA deletion was confirmed in the patient using a duplex-PCR. A Combine-Amplification Refractory Mutation System (C-ARMS) technique to simultaneously detect HbCS and Hb Quong Sze confirmed HbCS in the patient. Compound heterozygosity for CD41/42 and Poly A was confirmed using the ARMS. This is a unique case as the SEA alpha-gene deletion in cis (--SEA/alphaalpha) is generally not present in the Malays, who more commonly possess the two alpha-gene deletion in trans (-alpha/-alpha). In addition, the beta-globin gene mutation at CD41/42 is a common mutation in the Chinese and not in the Malays. The presence of both the SEA deletion and CD41/42 in the mother of the patient suggests the possible introduction of these two defects into the family by marriage with a Chinese.
Molecular basis of transfusion dependent beta-thalassemia major patients in Sabah

Teh LK, George E, Lai MI, Tan JA, Wong L, Ismail P

J Hum Genet, 2014 Mar;59(3):119-23.
PMID: 24369358 DOI: 10.1038/jhg.2013.131

Beta-thalassemia is one of the most prevalent inherited diseases and a public health problem in Malaysia. Malaysia is geographically divided into West and East Malaysia. In Sabah, a state in East Malaysia, there are over 1000 estimated cases of β-thalassemia major patients. Accurate population frequency data of the molecular basis of β-thalassemia major are needed for planning its control in the high-risk population of Sabah. Characterization of β-globin gene defects was done in 252 transfusion dependent β-thalassemia patients incorporating few PCR techniques. The study demonstrates that β-thalassemia mutations inherited are ethnically dependent. It is important to note that 86.9% of transfusion-dependent β-thalassemia major patients in Sabah were of the indigenous population and homozygous for a single mutation. The Filipino β(0)-deletion was a unique mutation found in the indigenous population of Sabah. Mutations common in West Malaysia were found in 11 (4.3%) patients. Four rare mutations (Hb Monroe, CD 8/9, CD 123/124/125 and IVS I-2) were also found. This study is informative on the population genetics of β-thalassemia major in Sabah.
Association between plasma soluble RAGE and renal function is unaffected by medication usage and enzymatic antioxidants in chronic kidney disease with type 2 diabetes

Wong FN, Tan JA, Keng TC, Ng KP, Chua KH, Kuppusamy UR

Clin Chim Acta, 2016 Jan 30;453:56-61.
PMID: 26657980 DOI: 10.1016/j.cca.2015.12.002

BACKGROUND: This study aimed to investigate the relationship between soluble RAGE and estimated glomerular filtration rate (eGFR) in patients with chronic kidney disease (CKD) after controlling for the potential confounding factors such as medication usage and enzymatic antioxidants.
METHODS: A total of 222 CKD patients whose eGFR is less than 60ml/min/1.73m(2) and 111 non-CKD individuals were recruited. The study subjects were classified based on their diabetes status. The plasma glutathione peroxidase (GPx) and superoxide dismutase (SOD) activities as well as plasma soluble RAGE level were measured.
RESULTS: The plasma GPx and SOD activities were significantly lower and the plasma soluble RAGE level was significantly higher in the CKD patients than in the non-CKD individuals, regardless of the diabetes status. Soluble RAGE was significantly correlated with eGFR in both diabetic CKD (D-CKD) and non-diabetic CKD (ND-CKD) patients. The association between soluble RAGE and eGFR remained largely unaffected by the confounding factors in D-CKD patients. However, the confounding effect of enzymatic antioxidants in the relationship between eGFR and soluble RAGE was observed in ND-CKD patients.
CONCLUSION: The increased plasma level of soluble RAGE is a better indicator of renal function decline in diabetic CKD patients instead of non-diabetic CKD patients.
KEYWORDS: Chronic kidney disease; Diabetes; Enzymatic antioxidants; Glomerular filtration rate; Medications; Soluble RAGE
Fulltext Screening for intermediate and severe forms of thalassaemia in discarded red blood cells: optimization and feasibility

George E, Lai MI, Teh LK, Ramasamy R, Goh EH, Asokan K, et al.

Med J Malaysia, 2011 Dec;66(5):429-34.
PMID: 22390095 MyJurnal

Detection and quantification of Hb subtypes of human blood is integral to presumptive identification of thalassaemias. It has been used in neonatal screening of thalassaemia and Hb variants. The use of discarded red blood cells following processing of the cord blood for stem cells provides readily available diagnostic material for thalassaemia screening. In this study, we determined the range of Hb subtypes in 195 consecutive cord blood samples collected for cord blood banking. The 'cord blood samples' analysed were those of the remaining red blood cells after the cord blood was processed for stem cell storage. Quantification of Hb subtypes by high performance liquid chromatography (HPLC) was done on BioRad Variant II Hb testing system. Only 73 (36.5%) of the samples could be analyzed neat without dilution. With a 1:300 dilution with wash solution the acceptable area as recommended by the manufacturer for reading of a C-gram within the 1 to 3 million ranges were achieved in all. Eighteen (9%) 12 showed classical Hb Barts (y4) prerun peaks were confirmed by Sebia Hydrasys automated Hb gel electrophoresis and quantified by Sebia Capillarys 2 capillary electrophoresis. Only 1 (0.5%) was presumptively identified with HbH disease. Due to the limited number of samples no beta-thalassaemia major, Hb E beta-thalassaemia and Hb Barts hydrops fetalis were found. The HPLC assay was possible at a cost US$ 5 per sample and a turnover time of 10 samples per hour without technical difficulties. This study reports an effective and valuable protocol for thalassaemia screening in red blood cells which would otherwise be discarded during cord blood processing. Cord blood with severe and intermediate forms of thalassaemia can be preselected and not stored.
Surgical Management of Cervical Ossification of Posterior Longitudinal Ligament: The Treatment Algorithm and Outcome

Ng BW, Tan JA, Sabri S, Baharuddin A, Muhamad Ariffin MH

Cureus, 2023 Mar;15(3):e36517.
PMID: 37090402 DOI: 10.7759/cureus.36517

Introduction Managing patients who present with symptoms of cervical myelopathy secondary to cervical ossification of the posterior longitudinal ligament (OPLL) is challenging. Various factors such as the number of levels involved with OPLL, types of OPLL, canal occupying ratio, K-line characteristics, and C2-C7 lordosis angle were found to guide decision-making and surgical approaches in managing this condition. However, no clear treatment algorithm has been published. This study aims to investigate the outcome of the management of cervical OPLL using a treatment algorithm used in a tertiary university hospital. Methods This is a retrospective cross-sectional study. Patients with cervical myelopathy secondary to cervical OPLL who were treated surgically in our center from 2014 to 2020 were included in this study. Demographic data and preoperative parameters that determined the treatment given according to our treatment algorithm were analyzed. Result A total of 24 patients fit the inclusion and exclusion criteria of the study. The mean recovery rate for all groups is 61.8[Formula: see text]21.9% and the mean postoperative neck disability index (NDI) is 17.83[Formula: see text]16.67%. There was a statistically significant difference between preoperative and postoperative Japanese Orthopaedic Association (JOA) scores for both anterior and posterior surgery subgroups. Conclusion We believe that the treatment algorithm used in our center could benefit other surgeons as a guide in managing patients who suffer from cervical myelopathy secondary to cervical OPLL. Further study including newer techniques would increase the surgeon's arsenal in providing the best outcome in managing this condition.
Fulltext Four-Year Outcomes of Corrective Surgery With Anterior and Posterior Instrumentation Combined With Kyphectomy for a Patient With Congenital Kyphoscoliosis and Underlying Myelomeningocele

Ng LH, Tan JA, Muhamad Ariffin MH

Cureus, 2023 Aug;15(8):e43259.
PMID: 37700956 DOI: 10.7759/cureus.43259

Patients with myelomeningocele associated with severe kyphoscoliosis usually presented with rigid and angulated gibbus at their back. The condition causes this group of patients to face difficulties in their daily activities, especially in sitting and lying in supine positions. They are also prone to have a pressure sore over the gibbus and encounter the risk of infection. Here the authors would present a case of a four-year-old girl with underlying myelomeningocele who was diagnosed with worsening kyphoscoliosis along her growth. Her whole spine x-ray radiograph revealed a kyphosis angle of 80° between the T11 and L4 levels. The patient underwent a deformity corrective surgery with total kyphectomy in a combination of anterior and posterior spinal instrumentation. In the present case, we were able to obtain sufficient correction of the spinal kyphotic deformity in that patient in a single-stage surgery with satisfactory surgical outcomes at a four years follow-up.
Higher frequency of p53 gene mutations in diffuse large B-cell lymphoma with MALT component

Tai YC, Tan JA, Peh SC

Pathol. Int., 2004 Nov;54(11):811-8.
PMID: 15533223

p53 gene mutation is not a frequent event in the tumorigenesis of lymphomas and the expression of p53 protein is independent of p53 gene mutations. The present study aimed to investigate mutations in the p53 gene in a series of extranodal B-cell lymphomas, and its association with p53 protein expression. A total of 52 cases were graded histologically into Grade 1, Grade 2 and Grade 3 tumors and p53 protein expression was detected using immunohistochemistry. Mutations in the p53 gene were analyzed using polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) and mobility shifts were confirmed by direct sequencing. The tumors comprised 26 (50%) Grade 1, 9 (17%) Grade 2 and 15 (29%) Grade 3. A high proportion of Grade 2 (25%) tumors expressed p53 protein (P = 0.051) and carried p53 gene mutation (33%) (P = 0.218). However, p53 protein expression was not associated with p53 gene mutations (P = 0.057). Transversion mutations (88%) were more frequently detected than transition mutations (12%). The present study revealed that p53 gene mutations and p53 protein expression occurred in higher frequencies in Grade 2 tumors, which may be of pathogenetic importance. The high frequency of transversion mutations may reflect the influence of an etiological agent in the tumorigenesis of mucosa-associated lymphoid tissue (MALT lymphoma).

Filters

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links