Displaying publications 1 - 20 of 47 in total

Abstract:
Sort:
  1. Ng LH, Tan JA, Muhamad Ariffin MH
    Cureus, 2023 Aug;15(8):e43259.
    PMID: 37700956 DOI: 10.7759/cureus.43259
    Patients with myelomeningocele associated with severe kyphoscoliosis usually presented with rigid and angulated gibbus at their back. The condition causes this group of patients to face difficulties in their daily activities, especially in sitting and lying in supine positions. They are also prone to have a pressure sore over the gibbus and encounter the risk of infection. Here the authors would present a case of a four-year-old girl with underlying myelomeningocele who was diagnosed with worsening kyphoscoliosis along her growth. Her whole spine x-ray radiograph revealed a kyphosis angle of 80° between the T11 and L4 levels. The patient underwent a deformity corrective surgery with total kyphectomy in a combination of anterior and posterior spinal instrumentation. In the present case, we were able to obtain sufficient correction of the spinal kyphotic deformity in that patient in a single-stage surgery with satisfactory surgical outcomes at a four years follow-up.
  2. Ariffin MH, Mohd-Mahdi SN, Baharudin A, M Tamil A, Abdul-Rhani S, Ibrahim K, et al.
    Malays Orthop J, 2023 Jul;17(2):35-42.
    PMID: 37583520 DOI: 10.5704/MOJ.2307.006
    INTRODUCTION: To investigate the use of a tubular retractor to provide access to the craniovertebral junction (CVJ) sparing the soft palate with the aim of reducing complications associated with traditional transoral approach but yet allowing adequate decompression of the CVJ.

    MATERIALS AND METHODS: Twelve consecutive patients with severe myelopathy (JOA-score less than 11) from ventral CVJ compression were operated between 2014-2020 using a tubular retractor assisted transoral decompression.

    RESULTS: All patients improved neurologically statistically (p=0.02). There were no posterior pharynx wound infections or rhinolalia. There was one case with incomplete removal of the lateral wall of odontoid and one incidental durotomy.

    CONCLUSIONS: A Tubular retractor provides adequate access for decompression of the ventral compression of CVJ. As the tubular retractor pushed away the uvula, soft palate and pillars of the tonsils as it docked on the posterior pharyngeal wall, the traditional complications associated with traditional transoral procedures is completely avoided.

  3. Tan JA, Khoo ET, Al-Chalabi MMM, Mohd Zainal H, Wan Sulaiman WA
    Cureus, 2023 Jul;15(7):e42572.
    PMID: 37637587 DOI: 10.7759/cureus.42572
    Conjunctival melanoma is a rare and potentially deadly tumor. Therefore, adequate oncological resection is essential, commonly leading to total orbital exenteration, which causes patients' extensive functional and cosmetic impairment. As a result, it is essential to reconstruct the orbital region post-exenteration to obliterate the cavity, provide adequate and pliable cutaneous covering, and restore a stable vascularized tissue that can withstand adjuvant radiotherapy. In recent years, the techniques used for orbital reconstruction have included the transorbital temporoparietal fascial flap, the anterolateral thigh flap, and local flaps, such as the paramedian forehead flap. A free radial forearm flap is currently not commonly used for orbital reconstruction due to potential donor site morbidity and cosmetic issues. In our case, we report a free radial forearm fasciocutaneous flap that has been utilized with promising surgical outcomes to reconstruct the orbital region following orbital exenteration.
  4. Khoo ET, Tan JA, Al-Chalabi MMM, Mat Zain MA, Wan Sulaiman WA
    Cureus, 2023 Jun;15(6):e40512.
    PMID: 37461779 DOI: 10.7759/cureus.40512
    Juvenile hyaline fibromatosis (JHF) is a rare, hereditary disease characterized by abnormal hyaline deposits within the skin, soft tissues, joints, and bones. The condition itself is often debilitating, with no curative treatment available. A definitive diagnosis is established by genetic testing. However, the hallmarks of gingival hypertrophy, subcutaneous scalp nodules, and joint contractures can be used as a clinical guide when genetic testing is unavailable. Here, we report an unusual case of a five-year-old child clinically diagnosed with juvenile hyaline fibromatosis with atypical nodules exclusively confined to the perioral region.
  5. Ng BW, Tan JA, Sabri S, Baharuddin A, Muhamad Ariffin MH
    Cureus, 2023 Mar;15(3):e36517.
    PMID: 37090402 DOI: 10.7759/cureus.36517
    Introduction Managing patients who present with symptoms of cervical myelopathy secondary to cervical ossification of the posterior longitudinal ligament (OPLL) is challenging. Various factors such as the number of levels involved with OPLL, types of OPLL, canal occupying ratio, K-line characteristics, and C2-C7 lordosis angle were found to guide decision-making and surgical approaches in managing this condition. However, no clear treatment algorithm has been published. This study aims to investigate the outcome of the management of cervical OPLL using a treatment algorithm used in a tertiary university hospital. Methods This is a retrospective cross-sectional study. Patients with cervical myelopathy secondary to cervical OPLL who were treated surgically in our center from 2014 to 2020 were included in this study. Demographic data and preoperative parameters that determined the treatment given according to our treatment algorithm were analyzed. Result A total of 24 patients fit the inclusion and exclusion criteria of the study. The mean recovery rate for all groups is 61.8[Formula: see text]21.9% and the mean postoperative neck disability index (NDI) is 17.83[Formula: see text]16.67%. There was a statistically significant difference between preoperative and postoperative Japanese Orthopaedic Association (JOA) scores for both anterior and posterior surgery subgroups. Conclusion We believe that the treatment algorithm used in our center could benefit other surgeons as a guide in managing patients who suffer from cervical myelopathy secondary to cervical OPLL. Further study including newer techniques would increase the surgeon's arsenal in providing the best outcome in managing this condition.
  6. Ng JB, Poh RY, Lee KR, Subrayan V, Deva JP, Lau AY, et al.
    Clin. Lab., 2016 Sep 01;62(9):1731-1737.
    PMID: 28164597 DOI: 10.7754/Clin.Lab.2016.160144
    BACKGROUND: Keratoconus is an ocular degeneration characterized by the thinning of corneal stroma that may lead to varying degrees of myopia and visual impairment. Genetic factors have been reported in the pathology of keratoconus where Asians have a higher incidence, earlier onset, and undergo earlier corneal grafts compared to Caucasians. The visual system homeobox 1 (VSX1) gene forms part of a paired-like homeodomain transcription factor which is responsible for ocular development. The gene was marked as a candidate in genetic studies of keratoconus in various populations. Single nucleotide polymorphisms (SNPs) in the VSX1 gene have been reported to be associated with keratoconus. The detection of the SNPs involves DNA amplification of the VSX1 gene followed by genomic sequencing. Thus, the objective of this study aims to establish sensitive and accurate screening protocols for the molecular characterization of VSX1 polymorphisms.

    METHODS: Keratoconic (n = 74) and control subjects (n = 96) were recruited based on clinical diagnostic tests and selection criteria. DNA extracted from the blood samples was used to genotype VSX1 polymorphisms. In-house designed primers and optimization of PCR conditions were carried out to amplify exons 1 and 3 of the VSX1 gene. PCR conditions including percentage GC content, melting temperatures, and differences in melting temperatures of primers were evaluated to produce sensitive and specific DNA amplifications.

    RESULTS: Genotyping was successfully carried out in 4 exons of the VSX1 gene. Primer annealing temperatures were observed to be crucial in enhancing PCR sensitivity and specificity. Annealing temperatures were carefully evaluated to produce increased specificity, yet not allowing sensitivity to be compromised. In addition, exon 1 of the VSX1 gene was amplified using 2 different sets of primers to produce 2 smaller amplified products with absence of non-specific bands. DNA amplification of exons 1 and 3 consistently showed single band products which were successfully sequenced to yield reproducible data.

    CONCLUSIONS: The use of in-house designed primers and optimized PCR conditions allowed sensitive and specific DNA amplifications that produced distinct single bands. The in-house designed primers and DNA amplification protocols established in this study provide an addition to the current repertoire of primers for accurate molecular characterization of VSX1 gene polymorphisms in keratoconus research.

  7. Lee TY, Lai MI, Ramachandran V, Tan JA, Teh LK, Othman R, et al.
    Int J Lab Hematol, 2016 Aug;38(4):435-43.
    PMID: 27349818 DOI: 10.1111/ijlh.12520
    INTRODUCTION: Alpha thalassaemia is a highly prevalent disease globally and is a well-known public health problem in Malaysia. The deletional forms of the mutation are the most common forms found in alpha thalassaemia. The three most common deletional alpha thalassaemia found in this region include --(SEA) deletion, -α(3.7) rightward and -α(4.2) leftward deletions. The prevalence rate of triplication alpha cases such as ααα(anti3.7) and ααα(anti4.2) is not known in Malaysia although it plays a role in exacerbating the clinical phenotypes in beta thalassaemia carriers. Recently, there have been more reported cases of rare alpha thalassaemia mutations due to the advancement of molecular techniques involved in thalassaemia detections. Therefore, it is essential to develop a new method which allows the detection of different alpha thalassaemia mutations including the rare ones simultaneously and accurately.

    METHODS: The purpose of this study was to design an assay for the detection of triplications, common and rare deletional alpha thalassaemia using droplet digital PCR (ddPCR).

    RESULTS: This is a quantitative detection method to measure the changes of copy number which can detect deletions, duplications and triplications of the alpha globin gene simultaneously.

    CONCLUSION: In conclusion, ddPCR is an alternative method for rapid detection of alpha thalassaemia variants in Malaysia.

  8. Tan JA, Kho SL, Ngim CF, Chua KH, Goh AS, Yeoh SL, et al.
    Sci Rep, 2016 06 08;6:26994.
    PMID: 27271331 DOI: 10.1038/srep26994
    Haemoglobin (Hb) Adana (HBA2:c.179>A) interacts with deletional and nondeletional α-thalassaemia mutations to produce HbH disorders with varying clinical manifestations from asymptomatic to severe anaemia with significant hepatosplenomegaly. Hb Adana carriers are generally asymptomatic and haemoglobin subtyping is unable to detect this highly unstable α-haemoglobin variant. This study identified 13 patients with compound heterozygosity for Hb Adana with either the 3.7 kb gene deletion (-α(3.7)), Hb Constant Spring (HbCS) (HBA2:c.427T>C) or Hb Paksé (HBA2:429A>T). Multiplex Amplification Refractory Mutation System was used for the detection of five deletional and six nondeletional α-thalassaemia mutations. Duplex-PCR was used to confirm Hb Paksé and HbCS. Results showed 84.6% of the Hb Adana patients were Malays. Using DNA studies, compound heterozygosity for Hb Adana and HbCS (α(codon 59)α/α(CS)α) was confirmed in 11 patients. A novel point in this investigation was that DNA studies confirmed Hb Paksé for the first time in a Malaysian patient (α(codon 59)α/α(Paksé)α) after nine years of being misdiagnosis with Hb Adana and HbCS (α(codon 59)α/α(CS)α). Thus, the reliance on haematology studies and Hb subtyping to detect Hb variants is inadequate in countries where thalassaemia is prevalent and caused by a wide spectrum of mutations.
  9. Lee TY, Lai MI, Ismail P, Ramachandran V, Tan JA, Teh LK, et al.
    Genet. Mol. Res., 2016 Apr 07;15(2).
    PMID: 27173219 DOI: 10.4238/gmr.15027400
    Hemoglobin (Hb) Adana [HBA2: c179G>A (or HBA1); p.Gly60Asp] is a non-deletional α-thalassemia variant found in Malaysia. An improvement in the molecular techniques in recent years has made identification of Hb Adana much easier. For this study, a total of 26 Hb Adana α-thalassemia intermedia and 10 Hb Adana trait blood samples were collected from patients. Common deletional and non-deletional α-thalassemia genotypes were determined using multiplex gap polymerase chain reaction (PCR) and multiplex ARMS PCR techniques. Identification of the Hb Adana location on the α-globin gene was carried out using genomic sequencing and the location of the mutation was confirmed via restriction fragment length polymorphism-PCR. Among the 36 samples, 24 (66.7%) had the -α(3.7)/α(Cd59)α mutation, while the -α(3.7)/α(Cd59)α mutation accounted for 2 samples (5.6%) and the remaining 10 (27.8%) samples were α/α(Cd59)α. All 36 samples were found to have the Hb Adana mutation on the α2-globin gene. The position of the α-globin gene mutation found in our cases was similar to that reported in Indonesia (16%) but not to that in Turkey (0.6%). Our results showed that the Hb Adana mutation was preferentially present in the α2-globin genes in Malays compared to the other ethnicities in Malaysia. Thus, the Malays might have similar ancestry based on the similarities in the Hb Adana position.
  10. Puah SM, Chua KH, Tan JA
    Int J Environ Res Public Health, 2016 Feb;13(2):199.
    PMID: 26861367 DOI: 10.3390/ijerph13020199
    Staphylococcus aureus is one of the leading causes of food poisoning. Its pathogenicity results from the possession of virulence genes that produce different toxins which result in self-limiting to severe illness often requiring hospitalization. In this study of 200 sushi and sashimi samples, S. aureus contamination was confirmed in 26% of the food samples. The S. aureus isolates were further characterized for virulence genes and antibiotic susceptibility. A high incidence of virulence genes was identified in 96.2% of the isolates and 20 different virulence gene profiles were confirmed. DNA amplification showed that 30.8% (16/52) of the S. aureus carried at least one SE gene which causes staphylococcal food poisoning. The most common enterotoxin gene was seg (11.5%) and the egc cluster was detected in 5.8% of the isolates. A combination of hla and hld was the most prevalent coexistence virulence genes and accounted for 59.6% of all isolates. Antibiotic resistance studies showed tetracycline resistance to be the most common at 28.8% while multi-drug resistance was found to be low at 3.8%. In conclusion, the high rate of S. aureus in the sampled sushi and sashimi indicates the need for food safety guidelines.
  11. Wong FN, Tan JA, Keng TC, Ng KP, Chua KH, Kuppusamy UR
    Clin Chim Acta, 2016 Jan 30;453:56-61.
    PMID: 26657980 DOI: 10.1016/j.cca.2015.12.002
    BACKGROUND: This study aimed to investigate the relationship between soluble RAGE and estimated glomerular filtration rate (eGFR) in patients with chronic kidney disease (CKD) after controlling for the potential confounding factors such as medication usage and enzymatic antioxidants.
    METHODS: A total of 222 CKD patients whose eGFR is less than 60ml/min/1.73m(2) and 111 non-CKD individuals were recruited. The study subjects were classified based on their diabetes status. The plasma glutathione peroxidase (GPx) and superoxide dismutase (SOD) activities as well as plasma soluble RAGE level were measured.
    RESULTS: The plasma GPx and SOD activities were significantly lower and the plasma soluble RAGE level was significantly higher in the CKD patients than in the non-CKD individuals, regardless of the diabetes status. Soluble RAGE was significantly correlated with eGFR in both diabetic CKD (D-CKD) and non-diabetic CKD (ND-CKD) patients. The association between soluble RAGE and eGFR remained largely unaffected by the confounding factors in D-CKD patients. However, the confounding effect of enzymatic antioxidants in the relationship between eGFR and soluble RAGE was observed in ND-CKD patients.
    CONCLUSION: The increased plasma level of soluble RAGE is a better indicator of renal function decline in diabetic CKD patients instead of non-diabetic CKD patients.
    KEYWORDS: Chronic kidney disease; Diabetes; Enzymatic antioxidants; Glomerular filtration rate; Medications; Soluble RAGE
  12. Wong FN, Chua KH, Kuppusamy UR, Wong CM, Lim SK, Tan JA
    PeerJ, 2016;4:e1908.
    PMID: 27114872 DOI: 10.7717/peerj.1908
    Chronic kidney disease (CKD) is a condition associated with progressive loss of kidney function and kidney damage. The two common causes of CKD are diabetes mellitus and hypertension. Other causes of CKD also include polycystic kidney disease, obstructive uropathy and primary glomerulonephritis. The receptor for advanced glycation end-products (RAGE) is a multi-ligand cell surface receptor of the immunoglobulin superfamily and it has been associated with kidney disease in both non-diabetic and diabetic patients. Presently, data on the association between RAGE polymorphisms and CKD in the Malaysian population is limited, while numerous studies have reported associations of RAGE polymorphisms with diabetic complications in other populations. The present study aims to explore the possibility of using RAGE polymorphisms as candidate markers of CKD in Malaysian population by using association analysis.
  13. Thevakumar K, Chandren JR, Perez-Perez GI, Chua EG, Teh LK, Salleh MZ, et al.
    PLoS One, 2016;11(7):e0159830.
    PMID: 27441568 DOI: 10.1371/journal.pone.0159830
    The epidemiology of Helicobacter pylori (H. pylori) infection is related to human poverty with marked differences between developing and developed countries. Socioeconomic factors and living standards are the main determinants of the age-dependent acquisition rate of H. pylori, and consequently its prevalence. The aim of this study was to assess the risk and sero-prevalence of H. pylori colonization among Orang Asli in Peninsula Malaysia. This cross-sectional study was conducted on Orang Asli subjects in seven isolated settlements spanning across all three major tribes (Negrito, Proto Malay and Senoi) in Malaysia. Socio-demographic characteristics of the subjects were obtained through interview. Subjects were tested for H. pylori colonization based on CagA and whole cell (WC) antigen serological assays. A total of 275 subjects participated in this study. Among these subjects, 115 (44.7%) were H. pylori sero-positive with highest sero-prevalence among Negrito (65.7%). Among subjects who were H. pylori sero-positive, CagA sero positivity was also significantly higher among Negrito. The highest proportion of respondents reported to be H. pylori sero-positive was from age group 30 years old and below (57.9%), males (56.2%), Negrito (48.6%) and live in bamboo house (92.3%). The highest proportion of respondents reported to be CagA sero-positive was from age group 30 years old and below (41.4%), males (35.6%) and Negrito (48.6%). The results of this study demonstrate that H. pylori colonization can be related to age, gender, tribes and house materials and CagA sero-positive stain closely associated with age, gender and tribes.
  14. Chen JJ, Tan JA, Chua KH, Tan PC, George E
    BMJ Open, 2015 Jul 22;5(7):e007648.
    PMID: 26201722 DOI: 10.1136/bmjopen-2015-007648
    OBJECTIVES: Single nucleotide polymorphism (SNP) with a mutation can be used to identify the presence of the paternally-inherited wild-type or mutant allele as result of the inheritance of either allele in the fetus and allows the prediction of the fetal genotype. This study aims to identify paternal SNPs located at the flanking regions upstream or downstream from the β-globin gene mutations at CD41/42 (HBB:c.127_130delCTTT), IVS1-5 (HBB:c.92+5G>C) and IVS2-654 (HBB:c.316-197C>T) using free-circulating fetal DNA.

    SETTING: Haematology Lab, Department of Biomedical Science, University of Malaya.

    PARTICIPANTS: Eight couples characterised as β-thalassaemia carriers where both partners posed the same β-globin gene mutations at CD41/42, IVS1-5 and IVS2-654, were recruited in this study.

    OUTCOME MEASURES: Genotyping was performed by allele specific-PCR and the locations of SNPs were identified after sequencing alignment.

    RESULTS: Genotype analysis revealed that at least one paternal SNP was present for each of the couples. Amplification on free-circulating DNA revealed that the paternal mutant allele of SNP was present in three fcDNA. Thus, the fetuses may be β-thalassaemia carriers or β-thalassaemia major. Paternal wild-type alleles of SNP were present in the remaining five fcDNA samples, thus indicating that the fetal genotypes would not be homozygous mutants.

    CONCLUSIONS: This preliminary research demonstrates that paternal allele of SNP can be used as a non-invasive prenatal diagnosis approach for at-risk couples to determine the β-thalassaemia status of the fetus.

  15. Teh LK, Lee TY, Tan JA, Lai MI, George E
    Int J Lab Hematol, 2015 Feb;37(1):79-89.
    PMID: 24725998 DOI: 10.1111/ijlh.12240
    In Malaysia, β-thalassaemia is a common inherited blood disorder in haemoglobin synthesis with a carrier rate of 4.5%. Currently, PCR-incorporating techniques such as amplification refractory mutation system (ARMS) or reverse dot blot hybridization (RDBH) are used in β-thalassaemia mutation detection. ARMS allows single-mutation identification using two reactions, one for wild type and another for mutant alleles. RDBH requires probe immobilization and optimization of hybridization and washing temperatures which is time consuming. The aim of our study was to investigate whether β-thalassaemia mutations can be identified in samples with low DNA concentrations.
  16. Khor WC, Puah SM, Tan JA, Puthucheary SD, Chua KH
    PLoS One, 2015;10(12):e0145933.
    PMID: 26710336 DOI: 10.1371/journal.pone.0145933
    Gram-negative bacilli of the genus Aeromonas are primarily inhabitants of the aquatic environment. Humans acquire this organism from a wide range of food and water sources as well as during aquatic recreational activities. In the present study, the diversity and distribution of Aeromonas species from freshwater lakes in Malaysia was investigated using glycerophospholipid-cholesterol acyltransferase (GCAT) and RNA polymerase sigma-factor (rpoD) genes for speciation. A total of 122 possible Aeromonas strains were isolated and confirmed to genus level using the API20E system. The clonality of the isolates was investigated using ERIC-PCR and 20 duplicate isolates were excluded from the study. The specific GCAT-PCR identified all isolates as belonging to the genus Aeromonas, in agreement with the biochemical identification. A phylogenetic tree was constructed using the rpoD gene sequence and all 102 isolates were identified as: A. veronii 43%, A. jandaei 37%, A. hydrophila 6%, A. caviae 4%, A. salmonicida 2%, A. media 2%, A. allosaccharophila 1%, A. dhakensis 1% and Aeromonas spp. 4%. Twelve virulence genes were present in the following proportions--exu 96%, ser 93%, aer 87%, fla 83%, enolase 70%, ela 62%, act 54%, aexT 33%, lip 16%, dam 16%, alt 8% and ast 4%, and at least 2 of these genes were present in all 102 strains. The ascV, aexU and hlyA genes were not detected among the isolates. A. hydrophila was the main species containing virulence genes alt and ast either present alone or in combination. It is possible that different mechanisms may be used by each genospecies to demonstrate virulence. In summary, with the use of GCAT and rpoD genes, unambiguous identification of Aeromonas species is possible and provides valuable data on the phylogenetic diversity of the organism.
  17. Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
  18. Abd Rahim MR, Kho SL, Kuppusamy UR, Tan JA
    Clin. Lab., 2015;61(9):1325-30.
    PMID: 26554253
    BACKGROUND: Beta-thalassemia is the most common genetic disorder in Malaysia. Confirmation of the β-globin gene mutations involved in thalassemia is usually carried out by molecular analysis of DNA extracted from leukocytes in whole blood. Molecular analysis is generally carried out when affected children are around 1 - 2 years as clinical symptoms are expressed during this period. Blood taking at this age can be distressing for the child. High yield and pure DNA extracted from non-invasive sampling methods can serve as alternative samples in molecular studies for genetic diseases especially in pediatric cases.

    METHODS: In this study, mouthwash, saliva, and buccal cytobrush samples were collected from β-thalassemia major patients who had previously been characterized using DNA extracted from peripheral blood. DNA was extracted from mouthwash, saliva, and buccal cytobrush samples using the conventional inexpensive phenol-chloroform method and was measured by spectrophotometry for yield and purity. Molecular characterization of β-globin gene mutations was carried out using the amplification refractory mutation system (ARMS).

    RESULTS: DNA extracted from mouthwash, saliva, and buccal cytobrush samples produced high concentration and pure DNA. The purified DNA was successfully amplified using ARMS. Results of the β-globin gene mutations using DNA from the three non-invasive samples were in 100% concordance with results from DNA extracted from peripheral blood.

    CONCLUSIONS: The conventional in-house developed methods for non-invasive sample collection and DNA extraction from these samples are effective and negate the use of more expensive commercial kits. In conclusion, DNA extracted from mouthwash, saliva, and buccal cytobrush samples provided sufficiently high amounts of pure DNA suitable for molecular analysis of β-thalassemia.

  19. Kho SL, Chua KH, George E, Tan JA
    Sci Rep, 2015;5:13937.
    PMID: 26365497 DOI: 10.1038/srep13937
    Homozygosity for the α-thalassaemia Southeast Asian (α-SEA) and Filipino β°-thalassaemia (β-FIL) deletions can cause serious complications leading to foetal death or life-long blood transfusions. A rapid and accurate molecular detection assay is essential in populations where the deletions are common. In this study, gap-polymerase chain reaction (PCR) with high resolution melting (HRM) analysis was developed to detect both the large deletions. Melting curves at 86.9 ± 0.1 °C were generated by normal individuals without the α-SEA deletion, 84.7 ± 0.1 °C by homozygous α-SEA deletion individuals and two melting curves at 84.7 ± 0.1 °C and 86.9 ± 0.1 °C by α-SEA deletion carriers. Normal individuals without the β-FIL deletion produce amplicons with a melting temperature (Tm) at 74.6 ± 0.1 °C, homozygous β-FIL individuals produce amplicons with Tm at 73.6 ± 0.1 °C and heterozygous β-FIL individuals generate two amplicons with Tm at 73.6 ± 0.1 °C and 74.6 ± 0.1 °C. Evaluation using blinded tests on 220 DNA samples showed 100% sensitivity and specificity. The developed assays are sensitive and specific for rapid molecular and prenatal diagnosis for the α-SEA and β-FIL deletions.
  20. Teh LK, George E, Lai MI, Tan JA, Wong L, Ismail P
    J Hum Genet, 2014 Mar;59(3):119-23.
    PMID: 24369358 DOI: 10.1038/jhg.2013.131
    Beta-thalassemia is one of the most prevalent inherited diseases and a public health problem in Malaysia. Malaysia is geographically divided into West and East Malaysia. In Sabah, a state in East Malaysia, there are over 1000 estimated cases of β-thalassemia major patients. Accurate population frequency data of the molecular basis of β-thalassemia major are needed for planning its control in the high-risk population of Sabah. Characterization of β-globin gene defects was done in 252 transfusion dependent β-thalassemia patients incorporating few PCR techniques. The study demonstrates that β-thalassemia mutations inherited are ethnically dependent. It is important to note that 86.9% of transfusion-dependent β-thalassemia major patients in Sabah were of the indigenous population and homozygous for a single mutation. The Filipino β(0)-deletion was a unique mutation found in the indigenous population of Sabah. Mutations common in West Malaysia were found in 11 (4.3%) patients. Four rare mutations (Hb Monroe, CD 8/9, CD 123/124/125 and IVS I-2) were also found. This study is informative on the population genetics of β-thalassemia major in Sabah.
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links