Displaying publications 1 - 20 of 47 in total

Abstract:
Sort:
  1. Ng JB, Poh RY, Lee KR, Subrayan V, Deva JP, Lau AY, et al.
    Clin. Lab., 2016 Sep 01;62(9):1731-1737.
    PMID: 28164597 DOI: 10.7754/Clin.Lab.2016.160144
    BACKGROUND: Keratoconus is an ocular degeneration characterized by the thinning of corneal stroma that may lead to varying degrees of myopia and visual impairment. Genetic factors have been reported in the pathology of keratoconus where Asians have a higher incidence, earlier onset, and undergo earlier corneal grafts compared to Caucasians. The visual system homeobox 1 (VSX1) gene forms part of a paired-like homeodomain transcription factor which is responsible for ocular development. The gene was marked as a candidate in genetic studies of keratoconus in various populations. Single nucleotide polymorphisms (SNPs) in the VSX1 gene have been reported to be associated with keratoconus. The detection of the SNPs involves DNA amplification of the VSX1 gene followed by genomic sequencing. Thus, the objective of this study aims to establish sensitive and accurate screening protocols for the molecular characterization of VSX1 polymorphisms.

    METHODS: Keratoconic (n = 74) and control subjects (n = 96) were recruited based on clinical diagnostic tests and selection criteria. DNA extracted from the blood samples was used to genotype VSX1 polymorphisms. In-house designed primers and optimization of PCR conditions were carried out to amplify exons 1 and 3 of the VSX1 gene. PCR conditions including percentage GC content, melting temperatures, and differences in melting temperatures of primers were evaluated to produce sensitive and specific DNA amplifications.

    RESULTS: Genotyping was successfully carried out in 4 exons of the VSX1 gene. Primer annealing temperatures were observed to be crucial in enhancing PCR sensitivity and specificity. Annealing temperatures were carefully evaluated to produce increased specificity, yet not allowing sensitivity to be compromised. In addition, exon 1 of the VSX1 gene was amplified using 2 different sets of primers to produce 2 smaller amplified products with absence of non-specific bands. DNA amplification of exons 1 and 3 consistently showed single band products which were successfully sequenced to yield reproducible data.

    CONCLUSIONS: The use of in-house designed primers and optimized PCR conditions allowed sensitive and specific DNA amplifications that produced distinct single bands. The in-house designed primers and DNA amplification protocols established in this study provide an addition to the current repertoire of primers for accurate molecular characterization of VSX1 gene polymorphisms in keratoconus research.

  2. Puah SM, Chua KH, Tan JA
    Int J Environ Res Public Health, 2016 Feb;13(2):199.
    PMID: 26861367 DOI: 10.3390/ijerph13020199
    Staphylococcus aureus is one of the leading causes of food poisoning. Its pathogenicity results from the possession of virulence genes that produce different toxins which result in self-limiting to severe illness often requiring hospitalization. In this study of 200 sushi and sashimi samples, S. aureus contamination was confirmed in 26% of the food samples. The S. aureus isolates were further characterized for virulence genes and antibiotic susceptibility. A high incidence of virulence genes was identified in 96.2% of the isolates and 20 different virulence gene profiles were confirmed. DNA amplification showed that 30.8% (16/52) of the S. aureus carried at least one SE gene which causes staphylococcal food poisoning. The most common enterotoxin gene was seg (11.5%) and the egc cluster was detected in 5.8% of the isolates. A combination of hla and hld was the most prevalent coexistence virulence genes and accounted for 59.6% of all isolates. Antibiotic resistance studies showed tetracycline resistance to be the most common at 28.8% while multi-drug resistance was found to be low at 3.8%. In conclusion, the high rate of S. aureus in the sampled sushi and sashimi indicates the need for food safety guidelines.
  3. Ariffin MH, Mohd-Mahdi SN, Baharudin A, M Tamil A, Abdul-Rhani S, Ibrahim K, et al.
    Malays Orthop J, 2023 Jul;17(2):35-42.
    PMID: 37583520 DOI: 10.5704/MOJ.2307.006
    INTRODUCTION: To investigate the use of a tubular retractor to provide access to the craniovertebral junction (CVJ) sparing the soft palate with the aim of reducing complications associated with traditional transoral approach but yet allowing adequate decompression of the CVJ.

    MATERIALS AND METHODS: Twelve consecutive patients with severe myelopathy (JOA-score less than 11) from ventral CVJ compression were operated between 2014-2020 using a tubular retractor assisted transoral decompression.

    RESULTS: All patients improved neurologically statistically (p=0.02). There were no posterior pharynx wound infections or rhinolalia. There was one case with incomplete removal of the lateral wall of odontoid and one incidental durotomy.

    CONCLUSIONS: A Tubular retractor provides adequate access for decompression of the ventral compression of CVJ. As the tubular retractor pushed away the uvula, soft palate and pillars of the tonsils as it docked on the posterior pharyngeal wall, the traditional complications associated with traditional transoral procedures is completely avoided.

  4. Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
  5. Teh LK, Lee TY, Tan JA, Lai MI, George E
    Int J Lab Hematol, 2015 Feb;37(1):79-89.
    PMID: 24725998 DOI: 10.1111/ijlh.12240
    In Malaysia, β-thalassaemia is a common inherited blood disorder in haemoglobin synthesis with a carrier rate of 4.5%. Currently, PCR-incorporating techniques such as amplification refractory mutation system (ARMS) or reverse dot blot hybridization (RDBH) are used in β-thalassaemia mutation detection. ARMS allows single-mutation identification using two reactions, one for wild type and another for mutant alleles. RDBH requires probe immobilization and optimization of hybridization and washing temperatures which is time consuming. The aim of our study was to investigate whether β-thalassaemia mutations can be identified in samples with low DNA concentrations.
  6. Abdullah WA, Jamaluddin NB, Kham SK, Tan JA
    PMID: 9031421
    The spectrum of beta-thalassemia mutations in Malays in Singapore and Kelantan (Northeast Malaysia) was studied. Allele specific priming was used to determine the mutations in beta-carriers at -28, Codon 17, IVSI #1, IVSI #5, Codon 41-42 and IVSII #654 along the beta-globin gene. The most common structural hemoglobin variant in Southeast Asia, Hb E, was detected by DNA amplification with restriction enzyme (Mnl1) analysis. Direct genomic sequencing was carried out to detect the beta-mutations uncharacterized by allele-specific priming. The most prevalent beta-mutations in Singaporean Malays were IVSI #5 (45.83%) followed by Hb E (20.83%), codon 15 (12.5%) and IVSI #1 and IVSII #654 at 4.17% each. In contrast, the distribution of the beta-mutations in Kelantan Malays differed, with Hb E as the most common mutation (39.29%) followed by IVSI #5 (17.86%), codon 41-42 (14.29%), codon 19 (10.71%) and codon 17 (3.57%). The beta-mutations in Kelantan Malays follow closely the distribution of beta-mutations in Thais and Malays of Southern Thailand and Malays of West Malaysia. The AAC-->AGC base substitution in codon 19 has been detected only in these populations. The spectrum of beta-mutations in the Singaporean Malays is more similar to those reported in Indonesia with the beta-mutation at codon 15 (TGG-->TAG) present in both populations. The characterization of beta-mutations in Singaporean and Kelantan Malays will facilitate the establishment of effective prenatal diagnosis programs for beta-thalassemia major in this ethnic group.
  7. Tan JA, Kok JL, Tan KL, Wee YC, George E
    Genes Genet Syst, 2009 Feb;84(1):67-71.
    PMID: 19420802
    Co-inheritance of alpha-thalassemia with homozygosity or compound heterozygosity for beta-thalassemia may ameliorate beta-thalassemia major. A wide range of clinical phenotypes is produced depending on the number of alpha-thalassemia alleles (-alpha/alphaalpha --/alphaalpha, --/-alpha). The co-inheritance of beta-thalassemia with alpha-thalassemia with a single gene deletion (-alpha/alphaalpha) is usually associated with thalassemia major. In contrast, the co-inheritance of beta-thalassemia with two alpha-genes deleted in cis or trans (--/alphaalpha or -alpha/-alpha) generally produces beta-thalassemia intermedia. In Southeast Asia, the most common defect responsible for alpha-thalassemia is the Southeast Asian (SEA) deletion of 20.5 kilobases. The presence of the SEA deletion with Hb Constant Spring (HbCS) produces HbH-CS disease. Co-inheritance of HbH-CS with compound heterozygosity for beta-thalassemia is very rare. This study presents a Malay patient with HbH-CS disorder and beta degrees/beta+-thalassemia. The SEA deletion was confirmed in the patient using a duplex-PCR. A Combine-Amplification Refractory Mutation System (C-ARMS) technique to simultaneously detect HbCS and Hb Quong Sze confirmed HbCS in the patient. Compound heterozygosity for CD41/42 and Poly A was confirmed using the ARMS. This is a unique case as the SEA alpha-gene deletion in cis (--SEA/alphaalpha) is generally not present in the Malays, who more commonly possess the two alpha-gene deletion in trans (-alpha/-alpha). In addition, the beta-globin gene mutation at CD41/42 is a common mutation in the Chinese and not in the Malays. The presence of both the SEA deletion and CD41/42 in the mother of the patient suggests the possible introduction of these two defects into the family by marriage with a Chinese.
  8. Tan JA, Tay JS, Aziz NB, Saha N
    Hum. Hered., 1996 Jul-Aug;46(4):236-8.
    PMID: 8807327
    Restriction fragment length polymorphism (RFLP) of the gene encoding the beta chain of the human T cell receptor (TcR) was studied in three ethnic groups in Singapore by Southern blotting. Polymorphism in the beta chain gene was identified in BglII-digested DNA samples using a 770-bp TcR beta cDNA clone containing the joining and constant region segments. The TcR beta/BglII polymorphism was studied in 136 Chinese, 93 Indian and 88 Malay samples. The frequency of the less frequent allele (TcR beta*2) in all the ethnic groups was significantly lower (0.15-0.29, p < 0.01) than that in the Caucasians (0.46). Indians had a significantly lower frequency of this allele (0.15) than the Chinese (0.29) and Malays (0.26).
  9. Ng BW, Tan JA, Sabri S, Baharuddin A, Muhamad Ariffin MH
    Cureus, 2023 Mar;15(3):e36517.
    PMID: 37090402 DOI: 10.7759/cureus.36517
    Introduction Managing patients who present with symptoms of cervical myelopathy secondary to cervical ossification of the posterior longitudinal ligament (OPLL) is challenging. Various factors such as the number of levels involved with OPLL, types of OPLL, canal occupying ratio, K-line characteristics, and C2-C7 lordosis angle were found to guide decision-making and surgical approaches in managing this condition. However, no clear treatment algorithm has been published. This study aims to investigate the outcome of the management of cervical OPLL using a treatment algorithm used in a tertiary university hospital. Methods This is a retrospective cross-sectional study. Patients with cervical myelopathy secondary to cervical OPLL who were treated surgically in our center from 2014 to 2020 were included in this study. Demographic data and preoperative parameters that determined the treatment given according to our treatment algorithm were analyzed. Result A total of 24 patients fit the inclusion and exclusion criteria of the study. The mean recovery rate for all groups is 61.8[Formula: see text]21.9% and the mean postoperative neck disability index (NDI) is 17.83[Formula: see text]16.67%. There was a statistically significant difference between preoperative and postoperative Japanese Orthopaedic Association (JOA) scores for both anterior and posterior surgery subgroups. Conclusion We believe that the treatment algorithm used in our center could benefit other surgeons as a guide in managing patients who suffer from cervical myelopathy secondary to cervical OPLL. Further study including newer techniques would increase the surgeon's arsenal in providing the best outcome in managing this condition.
  10. Kho SL, Chua KH, George E, Tan JA
    Genet. Mol. Res., 2013;12(3):2409-15.
    PMID: 23479149 DOI: 10.4238/2013.February.28.4
    Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.
  11. Chong YM, Tan JA, Zubaidah Z, Rahimah A, Kuldip K, George E
    Med J Malaysia, 2006 Jun;61(2):217-20.
    PMID: 16898315
    Thalassaemia is an inherited blood disorder and is a significant public health problem in Malaysia, with many not knowing they carry the gene for thalassaemia. The two major forms are alpha and beta thalassaemia. An individual can co-inherit both the alpha and beta thalassaemia genes. This study determined the frequency of concurrent carriers of alpha thalassaemia in 231 beta thalassaemia carriers. Gap-PCR was done on extracted DNA of the beta thalassaemia samples to check for alpha thalassaemia 1 molecular defect. Eight (3.5%) samples were found to have concurrently inherited the alpha thalassaemia 1 (- -SEA) deletion. The significant carrier rate for alpha thalassaemia 1 indicates the need for the implementation of DNA analysis to complement thalassaemia screening in high risk populations.
  12. George E, Lai MI, Teh LK, Ramasamy R, Goh EH, Asokan K, et al.
    Med J Malaysia, 2011 Dec;66(5):429-34.
    PMID: 22390095 MyJurnal
    Detection and quantification of Hb subtypes of human blood is integral to presumptive identification of thalassaemias. It has been used in neonatal screening of thalassaemia and Hb variants. The use of discarded red blood cells following processing of the cord blood for stem cells provides readily available diagnostic material for thalassaemia screening. In this study, we determined the range of Hb subtypes in 195 consecutive cord blood samples collected for cord blood banking. The 'cord blood samples' analysed were those of the remaining red blood cells after the cord blood was processed for stem cell storage. Quantification of Hb subtypes by high performance liquid chromatography (HPLC) was done on BioRad Variant II Hb testing system. Only 73 (36.5%) of the samples could be analyzed neat without dilution. With a 1:300 dilution with wash solution the acceptable area as recommended by the manufacturer for reading of a C-gram within the 1 to 3 million ranges were achieved in all. Eighteen (9%) 12 showed classical Hb Barts (y4) prerun peaks were confirmed by Sebia Hydrasys automated Hb gel electrophoresis and quantified by Sebia Capillarys 2 capillary electrophoresis. Only 1 (0.5%) was presumptively identified with HbH disease. Due to the limited number of samples no beta-thalassaemia major, Hb E beta-thalassaemia and Hb Barts hydrops fetalis were found. The HPLC assay was possible at a cost US$ 5 per sample and a turnover time of 10 samples per hour without technical difficulties. This study reports an effective and valuable protocol for thalassaemia screening in red blood cells which would otherwise be discarded during cord blood processing. Cord blood with severe and intermediate forms of thalassaemia can be preselected and not stored.
  13. Lee TY, Lai MI, Ramachandran V, Tan JA, Teh LK, Othman R, et al.
    Int J Lab Hematol, 2016 Aug;38(4):435-43.
    PMID: 27349818 DOI: 10.1111/ijlh.12520
    INTRODUCTION: Alpha thalassaemia is a highly prevalent disease globally and is a well-known public health problem in Malaysia. The deletional forms of the mutation are the most common forms found in alpha thalassaemia. The three most common deletional alpha thalassaemia found in this region include --(SEA) deletion, -α(3.7) rightward and -α(4.2) leftward deletions. The prevalence rate of triplication alpha cases such as ααα(anti3.7) and ααα(anti4.2) is not known in Malaysia although it plays a role in exacerbating the clinical phenotypes in beta thalassaemia carriers. Recently, there have been more reported cases of rare alpha thalassaemia mutations due to the advancement of molecular techniques involved in thalassaemia detections. Therefore, it is essential to develop a new method which allows the detection of different alpha thalassaemia mutations including the rare ones simultaneously and accurately.

    METHODS: The purpose of this study was to design an assay for the detection of triplications, common and rare deletional alpha thalassaemia using droplet digital PCR (ddPCR).

    RESULTS: This is a quantitative detection method to measure the changes of copy number which can detect deletions, duplications and triplications of the alpha globin gene simultaneously.

    CONCLUSION: In conclusion, ddPCR is an alternative method for rapid detection of alpha thalassaemia variants in Malaysia.

  14. Wong LP, George E, Tan JA
    BMC Public Health, 2011;11:193.
    PMID: 21447191 DOI: 10.1186/1471-2458-11-193
    Thalassaemia is a common public health problem in Malaysia and about 4.5 to 6% of the Malays and Chinese are carriers of this genetic disorder. The major forms of thalassaemia result in death in utero of affected foetuses (α-thalassaemia) or life-long blood transfusions for survival in β-thalassaemia. This study, the first nationwide population based survey of thalassaemia in Malaysia, aimed to determine differences in public awareness, perceptions and attitudes toward thalassaemia in the multi-racial population in Malaysia.
  15. Saha N, Mak JW, Tay JS, Liu Y, Tan JA, Low PS, et al.
    Hum Biol, 1995 Feb;67(1):37-57.
    PMID: 7721278
    A population genetic study was undertaken to provide gene frequency data on the additional blood genetic markers in the Semai and to estimate the genetic relations between the Semai and their neighboring and linguistically related populations by genetic distance and principal components analyses. Altogether 10 polymorphic and 7 monomorphic blood genetic markers (plasma proteins and red cell enzymes) were studied in a group of 349 Senoi Semai from 11 aboriginal settlements (villages) in the Pahang State of western Malaysia. Both the red cell glucose-6-phosphate dehydrogenase (G6PD) and 6-phosphogluconate dehydrogenase (PGD) loci reveal the presence of polymorphic frequencies of a nondeficient slow allele at the G6PD locus and a fast allele at the PGD locus. The Semai are characterized by high prevalences of ahaptoglobinemia and G6PD deficiency, high frequencies of HP*1, HB*E, RH*R1, ACP*C, GLO1*1, PGM1*2+, and GC*1F and corresponding low frequencies of ABO*A, HbCoSp, HB*B0, TF*D, CHI, and GC*2. Genetic distance analyses by both cluster and principal components models were performed between the Semai and 14 other populations (Malay; Javanese; Khmer; Veddah; Tamils of Malaysia, Sri Lanka, and India; Sinhalese; Oraon; Toda and Irula of India; Chinese; Japanese; Koreans) on the basis of 30 alleles at 7 polymorphic loci. A more detailed analysis using 53 alleles at 13 polymorphic loci with 10 populations was carried out. Both analyses give genetic evidence of a close relationship between the Semai and the Khmer of Cambodia. Furthermore, the Semai are more closely related to the Javanese than to their close neighbors--the Malay, Chinese, and Tamil Indians. There is no evidence for close genetic relationship between the Semai and the Veddah or other Indian tribes. The evidence fits well with the linguistic relationship of the Semai with the Mon-Khmer branch of the Austro-Asiatic language family.
  16. Khor WC, Puah SM, Tan JA, Puthucheary SD, Chua KH
    PLoS One, 2015;10(12):e0145933.
    PMID: 26710336 DOI: 10.1371/journal.pone.0145933
    Gram-negative bacilli of the genus Aeromonas are primarily inhabitants of the aquatic environment. Humans acquire this organism from a wide range of food and water sources as well as during aquatic recreational activities. In the present study, the diversity and distribution of Aeromonas species from freshwater lakes in Malaysia was investigated using glycerophospholipid-cholesterol acyltransferase (GCAT) and RNA polymerase sigma-factor (rpoD) genes for speciation. A total of 122 possible Aeromonas strains were isolated and confirmed to genus level using the API20E system. The clonality of the isolates was investigated using ERIC-PCR and 20 duplicate isolates were excluded from the study. The specific GCAT-PCR identified all isolates as belonging to the genus Aeromonas, in agreement with the biochemical identification. A phylogenetic tree was constructed using the rpoD gene sequence and all 102 isolates were identified as: A. veronii 43%, A. jandaei 37%, A. hydrophila 6%, A. caviae 4%, A. salmonicida 2%, A. media 2%, A. allosaccharophila 1%, A. dhakensis 1% and Aeromonas spp. 4%. Twelve virulence genes were present in the following proportions--exu 96%, ser 93%, aer 87%, fla 83%, enolase 70%, ela 62%, act 54%, aexT 33%, lip 16%, dam 16%, alt 8% and ast 4%, and at least 2 of these genes were present in all 102 strains. The ascV, aexU and hlyA genes were not detected among the isolates. A. hydrophila was the main species containing virulence genes alt and ast either present alone or in combination. It is possible that different mechanisms may be used by each genospecies to demonstrate virulence. In summary, with the use of GCAT and rpoD genes, unambiguous identification of Aeromonas species is possible and provides valuable data on the phylogenetic diversity of the organism.
  17. Poh R, Tan JA, Deva JP, Poo D, Yong Y, Arjunan S
    West Indian Med J, 2012 Sep;61(6):569-73.
    PMID: 23441349
    To determine the activity of paraoxonase 1 (PON1) in keratoconus in a Malaysian population in comparison with non-keratoconic subjects.
  18. Tan JA, Khoo ET, Al-Chalabi MMM, Mohd Zainal H, Wan Sulaiman WA
    Cureus, 2023 Jul;15(7):e42572.
    PMID: 37637587 DOI: 10.7759/cureus.42572
    Conjunctival melanoma is a rare and potentially deadly tumor. Therefore, adequate oncological resection is essential, commonly leading to total orbital exenteration, which causes patients' extensive functional and cosmetic impairment. As a result, it is essential to reconstruct the orbital region post-exenteration to obliterate the cavity, provide adequate and pliable cutaneous covering, and restore a stable vascularized tissue that can withstand adjuvant radiotherapy. In recent years, the techniques used for orbital reconstruction have included the transorbital temporoparietal fascial flap, the anterolateral thigh flap, and local flaps, such as the paramedian forehead flap. A free radial forearm flap is currently not commonly used for orbital reconstruction due to potential donor site morbidity and cosmetic issues. In our case, we report a free radial forearm fasciocutaneous flap that has been utilized with promising surgical outcomes to reconstruct the orbital region following orbital exenteration.
  19. Chen JJ, Tan JA, Chua KH, Tan PC, George E
    BMJ Open, 2015 Jul 22;5(7):e007648.
    PMID: 26201722 DOI: 10.1136/bmjopen-2015-007648
    OBJECTIVES: Single nucleotide polymorphism (SNP) with a mutation can be used to identify the presence of the paternally-inherited wild-type or mutant allele as result of the inheritance of either allele in the fetus and allows the prediction of the fetal genotype. This study aims to identify paternal SNPs located at the flanking regions upstream or downstream from the β-globin gene mutations at CD41/42 (HBB:c.127_130delCTTT), IVS1-5 (HBB:c.92+5G>C) and IVS2-654 (HBB:c.316-197C>T) using free-circulating fetal DNA.

    SETTING: Haematology Lab, Department of Biomedical Science, University of Malaya.

    PARTICIPANTS: Eight couples characterised as β-thalassaemia carriers where both partners posed the same β-globin gene mutations at CD41/42, IVS1-5 and IVS2-654, were recruited in this study.

    OUTCOME MEASURES: Genotyping was performed by allele specific-PCR and the locations of SNPs were identified after sequencing alignment.

    RESULTS: Genotype analysis revealed that at least one paternal SNP was present for each of the couples. Amplification on free-circulating DNA revealed that the paternal mutant allele of SNP was present in three fcDNA. Thus, the fetuses may be β-thalassaemia carriers or β-thalassaemia major. Paternal wild-type alleles of SNP were present in the remaining five fcDNA samples, thus indicating that the fetal genotypes would not be homozygous mutants.

    CONCLUSIONS: This preliminary research demonstrates that paternal allele of SNP can be used as a non-invasive prenatal diagnosis approach for at-risk couples to determine the β-thalassaemia status of the fetus.

  20. Abd Rahim MR, Kho SL, Kuppusamy UR, Tan JA
    Clin. Lab., 2015;61(9):1325-30.
    PMID: 26554253
    BACKGROUND: Beta-thalassemia is the most common genetic disorder in Malaysia. Confirmation of the β-globin gene mutations involved in thalassemia is usually carried out by molecular analysis of DNA extracted from leukocytes in whole blood. Molecular analysis is generally carried out when affected children are around 1 - 2 years as clinical symptoms are expressed during this period. Blood taking at this age can be distressing for the child. High yield and pure DNA extracted from non-invasive sampling methods can serve as alternative samples in molecular studies for genetic diseases especially in pediatric cases.

    METHODS: In this study, mouthwash, saliva, and buccal cytobrush samples were collected from β-thalassemia major patients who had previously been characterized using DNA extracted from peripheral blood. DNA was extracted from mouthwash, saliva, and buccal cytobrush samples using the conventional inexpensive phenol-chloroform method and was measured by spectrophotometry for yield and purity. Molecular characterization of β-globin gene mutations was carried out using the amplification refractory mutation system (ARMS).

    RESULTS: DNA extracted from mouthwash, saliva, and buccal cytobrush samples produced high concentration and pure DNA. The purified DNA was successfully amplified using ARMS. Results of the β-globin gene mutations using DNA from the three non-invasive samples were in 100% concordance with results from DNA extracted from peripheral blood.

    CONCLUSIONS: The conventional in-house developed methods for non-invasive sample collection and DNA extraction from these samples are effective and negate the use of more expensive commercial kits. In conclusion, DNA extracted from mouthwash, saliva, and buccal cytobrush samples provided sufficiently high amounts of pure DNA suitable for molecular analysis of β-thalassemia.

Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links