Displaying publications 1 - 20 of 159 in total

Abstract:
Sort:
  1. Shafiee, M.N., NorAzlin, M.I., Lim, P.S., Arifuddin D, Trika I, Hatta, D.
    MyJurnal
    Fulminant haemorrhage in cervical cancer leads to severe anaemia and haemodynamic instability. Palliative management includes vaginal packing as temporary measure, radiotherapy and other invasive surgical procedures. High dose emergency chemotherapy is not commonly implemented particularly when complicated with anaemia and renal impairment. We discuss three case series on the usefulness of high dose chemotherapy to combat bleeding from cervical cancer as an emergency treatment. The first case was clinically staged as operable 2A disease with severe anaemia due to bleeding from the tumour mass. The haemoglobin was corrected by blood transfusion while the bleeding was being arrested by high dose chemotherapy. The second case was inoperable with invasion to the bladder mucosa. She had frank haematuria and bleeding from the tumour with severe anaemia. A course of chemotherapy and blood transfusion controlled the bleeding and anaemia was corrected. The third case presented late with obstructive uropathy and anaemia. She required dialysis, blood transfusion and high dose emergency chemotherapy to stop the bleeding before undergoing urinary diversion after an unsuccessful ureteric stenting. High dose chemotherapy consisting cisplatin, vincristine, bleomycin and mitomycin-C has a clinical value in arresting fulminant haemorrhage in cervical cancer.
    Matched MeSH terms: Blood Transfusion
  2. Glew S, Singh A
    Adv Contracept, 1989 Mar;5(1):51-3.
    PMID: 2782134
    A case is described of profuse uterine bleeding with a dislodged Multiload Cu 250 intrauterine device (IUD). Multiple blood transfusions were necessary, and ultimately, an emergency hysterectomy was performed.
    Matched MeSH terms: Blood Transfusion
  3. Yeap TB, Teah MK, Zenian S
    BMJ Case Rep, 2021 Mar 04;14(3).
    PMID: 33664045 DOI: 10.1136/bcr-2021-241916
    Jehovah's Witnesses (JW) is a branch of Christianity which was founded in 1872. However, their beliefs differ from other Christians in many ways. Majority of JW believe that it is against the teaching of God should they receive blood transfusion, while minority think receiving own blood or others is acceptable. These vast beliefs should always be respected by all medical practitioners to avoid medicolegal implications. The differing beliefs about blood transfusion is certainly a huge challenge to the surgeons and anesthesiologists, especially dealing with major surgeries. Thus, effective surgical and anaesthetic techniques are focused to minimise blood loss to avoid unnecessary blood transfusion. We report a JW patient who successfully underwent an emergency endoscopic transsphenoidal surgery secondary to pituitary apoplexy; highlighting our intraoperative acute hypervolaemic haemodilution technique to reduce blood loss.
    Matched MeSH terms: Blood Transfusion
  4. Lim CH, Benjamin NH, Kan FK
    Med J Malaysia, 2017 02;72(1):55-57.
    PMID: 28255142 MyJurnal
    Upper gastrointestinal haemorrhage (UGIH) in severe dengue represents a clinical dilemma in term of management. The recommended treatment in dengue with UGIH involves blood product transfusion support and proton pump inhibitor (PPI) infusion. Despite being the mainstay of treatment in non-dengue UGIH, the role of endoscopic haemostatic intervention in severe dengue remains controversial. In the present report, we present a case of severe dengue complicated with upper gastrointestinal haemorrhage successfully underwent early therapeutic endoscopic intervention in a district hospital.
    Matched MeSH terms: Blood Transfusion
  5. Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
    Matched MeSH terms: Blood Transfusion/methods*
  6. Abdullah MR, Faizli AA, Noordin SS, Lee CJ, Ahmad NH
    Transfus Apher Sci, 2021 Jun;60(3):103076.
    PMID: 33574008 DOI: 10.1016/j.transci.2021.103076
    H-deficient phenotype individuals with absent or weak anti-H activity may remain undetected on standard routine blood grouping. We report a case of a 59-year-old-man presented with symptomatic anaemia secondary to upper gastrointestinal bleed with haemoglobin level of 68 g/L who required two units of packed red blood cells. He was previously grouped as O Rh D positive and had a history of uneventful multiple blood transfusions. His latest pre-transfusion investigations showed ABO discrepancy between forward and reverse blood grouping, pan-agglutination in both antibody screening and identification with negative direct Coombs test and autocontrol. Further testing including anti-H lectin test and saliva secretor study confirmed that the patient blood group was para-Bombay B RhD positive. This case highlights that the para-Bombay phenotype can be mistakenly labelled as "O" if further investigations are not performed.
    Matched MeSH terms: Blood Transfusion/methods*
  7. Paul FM, Kleevens JW
    J Singapore Paediatr Soc, 1969 Apr;11(1):62-6.
    PMID: 5366340
    Matched MeSH terms: Blood Transfusion/adverse effects*
  8. Tai, C.C., Tan, S.H., Misnan, N.A., Nam, H.Y., Choon, S.K.
    Malays Orthop J, 2008;2(1):38-43.
    MyJurnal
    The safety of simultaneous bilateral total knee arthroplasty (TKA) remains controversial. The objective of the current study was to investigate perioperative morbidity and mortality rates within 30 days of simultaneous bilateral TKA. A detailed analysis of medical, surgical and anaesthesia records of 183 consecutive patients who underwent total knee arthroplasty between 2002 and 2006 was performed. The mean age of the patients was 67.6 years old. More than 80% had one or more co-morbidities, but none of them had ASA score greater than class 2. The mean hospital stay was 10 days, and the mean surgical time 156 minutes. Less than half of the patients (42.6%) required blood transfusion. The rate of perimorbidity was 15.3 % and there was no mortality in this series. We believe that simultaneous bilateral total knee arthroplasty is a safe and cost effective option for our patients, provided that patients are selected and informed appropriately.
    Matched MeSH terms: Blood Transfusion
  9. Al-Kubaisy, Waqar A., Niazi, Amjad D.
    Int J Public Health Res, 2011;1(2):72-78.
    MyJurnal
    Introduction Hepatitis C Virus (HCV) recently was identified as a major cause of post transfusion hepatitis world wide. To evaluate the role of blood transfusion on the prevalence of HCV infection, by testing antibody and RNA as well as the genotypes of HCV .Also to detect if Blood transfusion acts as unconfounding risk factor for HCV infection.
    Methods Sera from 3491 pregnant women were investigated for the presence of HCV antibodies (anti-HCV) by using third generation enzyme immunoassay (EIA-3) as screening test, followed by immunoblot assay (Lia Tek-III). In addition 94 sera of studied women were subjected to molecular analysis (at laboratories of Sorin BioMedica - Italy) for the detection of viral RNA and genotypes of HCV. Using RT-PCR & DNA Enzyme immunoassay (DEIA) method.
    Results Our study revealed, that seroprevalence rate of HCV specific Ab & RNA were significantly higher (16.32 %, 80% respectively) among women with a history of blood transfusion, compared to those (2.53%, 56.5%) with no such history P=0.0001, P=0.01. And there is a significant direct linear correlation between number of blood transfused and the seropositive rate of anti-HCV (r=0.7, p=0.046). Based on multivariate analysis, interestingly, this study confirmed that, blood transfusion significantly acting as unconfounding risk factor for acquiring HCV infection (Adjusted OR=1.938,95% C.I=1.646-2.28). And the risk of exposure is increases with increased number of blood transfused. Although, we found no significant association between, HCV genotypic distribution and history of blood transfusion. However, high proportion of women with a history of blood transfusion were harboring HCV genotype -4 or 1b, 50%,40%, resepctively.
    Conclusions Our study shows, evidence that, blood transfusion acts as unconfounding risk factor for acquiring and in a mode of transmission of HCV infection. Therefore strict screening of blood donor for HCV-Abs and / or RNA is highly recommended.
    Matched MeSH terms: Blood Transfusion
  10. Azizah Othman, Qarem Mohamed Mustafa, Ariffin Nasir, Norsarwany Mohamad, Nurul Shafira Adi, Nurul Ilyana Hashim, et al.
    MyJurnal
    Thalassaemia is a life-long illness that exists globally. The quality of life of adolescents with thalassaemia could differ based on the health policies of a specific region, existing levelof socio-economic development and the illness related variables. This study examines the relationship between socio-demographic and disease-related variables with the quality of life among adolescents with thalassaemia involving multiple treatment centers spread throughout various locations in Malaysia. Participants included 218 adolescents (male=108; female 112) with mean age of 13.86 (SD=2.40). They completed the questionnaire consisting of demographic information, illness-related variables, and Pediatric Quality of Life Inventory 4.0 (PedsQL). The participants in this study was found to have higher total summary score (Mean = 69.64, SD = 14.03), psychosocial health (Mean = 70.23, SD = 14.91), emotional (Mean = 72.12, SD = 20.66), social (Mean = 79.82, SD = 17.37), and school (Mean = 58.69, SD = 16.77) functioning but with lower physical health (Mean = 68.50, SD = 17.22) as compared to previous study that was done in Kuala Lumpur. Findings also shows a significant positive correlation between level of education and frequency of hospitalization (r = .156, p < 0.05), frequency of transfusion (r = .152, p < 0.05), and physical health (r = .186, p < 0.01). An increase in the frequency of transfusion was found to significantly increase social functioning (r = .137, p < 0.05). Other significant correlations are discussed in addition to the quality of life experienced by patients with thalassaemia in different region of theworld.
    Matched MeSH terms: Blood Transfusion
  11. Reid HA
    Clin. Toxicol., 1970 Sep;3(3):473-82.
    PMID: 5520050
    Matched MeSH terms: Blood Transfusion
  12. Menon BS, Aiyar S
    Med J Malaysia, 1997 Dec;52(4):331-4.
    PMID: 10968109
    This study examined the prevalence of hepatitis B and C markers in 55 paediatric oncology patients who had completed treatment at the Hospital Universiti Sains Malaysia in Kota Baru. All these children had received blood products and had been treated between 1985-1996. Forty seven per cent of patients were positive for hepatitis B or C. Twenty nine per cent were positive for hepatitis C and twenty two per cent were HBsAg positive. Two children were positive for both and none were HIV positive. Four children had an elevated ALT level and one child had jaundice and hepatomegaly. Some children were marker-positive despite immunization and screening of blood.
    Matched MeSH terms: Blood Transfusion/adverse effects
  13. Ng KP, Saw TL, Wong NW, Goh KL, Chuah SY, Nagaratnam M
    Med J Malaysia, 1995 Dec;50(4):302-5.
    PMID: 8668047
    Anti-HCV antibody was detected in 1.9% of the blood donors in University Hospital. Among the risk groups, 33.3% of the patients with post-transfusion hepatitis were tested positive for anti-HCV antibody. The anti-HCV antibody was detected in 30% of the IDU. Haemodialysis patients, patients with acute and chronic hepatitis and patients with liver cirrhosis appeared to have increased risk of Hepatitis C virus infection. The results indicate that the frequency of HCV infection increases with the exposure to blood or blood products.
    Matched MeSH terms: Blood Transfusion/adverse effects
  14. Krishnamoorthy A, Hadi FA, Naidu A, Sathar J
    Med J Malaysia, 2017 02;72(1):53-54.
    PMID: 28255141
    Anaemia is a common condition in Malaysia, and is mostly due to iron deficiency. In many cases, allogeneic blood transfusion (ABT) is administered unnecessarily to treat anaemia. Patient blood management (PBM) is a concept whereby a patient becomes his or her "own blood bank", instead of receiving ABT. The concept encompasses three pillars namely optimising erythropoiesis, minimising blood loss and harnessing human physiological reserve. We present a safe and fruitful outcome of managing severe anaemia without utilising any ABT, made possible with the PBM approach including administration of intravenous iron.
    Matched MeSH terms: Blood Transfusion
  15. Lyn PCW, Teh HC, Mulvey RF
    Med J Malaysia, 1985 Mar;40(1):3-10.
    PMID: 3831730
    This paper is based on the beta-thalassaemia programme at the Duchess of Kent Hospital, Sandakan, Sabah. It seeks to show that a hypertransfusion regimen which improves the quality of life of children with thalassaemia major can be practised in district and general hospitals if there is an organised blood recruitment programme, at least at departmental level. Such a programme reduces the demand on the hardpressed hospitals' blood banks. Frequent and regular transfusions can be given with minimal interference with the school and family life of affected children and reduces immeasurably the social, emotional and financial strain on the affected families. There is also an urgent need to define the magnitude of the problem of beta-thalassaemia through population studies so that genetic counselling can be given and adequate resources can be allocated to improve the quality of life of affected patients.
    Matched MeSH terms: Blood Transfusion*
  16. Yap S, Duraisamy G
    Med J Malaysia, 1992 Jun;47(2):150-3.
    PMID: 1494336
    Matched MeSH terms: Blood Transfusion/adverse effects*
  17. Wong LP, Lee HY, Khor CS, Abdul-Jamil J, Alias H, Abu-Amin N, et al.
    PMID: 33879981 DOI: 10.1007/s12288-021-01428-7
    Throughout the world, there has been growing concern over the risk of hepatitis E virus (HEV) transmission via blood transfusion. The present study screened blood donor samples for anti-HEV immunoglobulin M (IgM) and immunoglobulin G (IgG). The prevalence of HEV infection was assessed on a total of 1,003 archived serum samples obtained from the National Blood Centre, Malaysia. The samples were collected from healthy blood donor from Klang Valley between 2017 and 2018. All samples were tested for IgM and IgG antibodies to HEV using enzyme-linked immunosorbent assays (ELISA). HEV-specific IgG antibodies were detected in 31/1003 (3.1%; 95% confidence interval [CI] 2.1%-4.4%) and IgM in 9/1003 (0.9%; 95% CI 0.4%-1.7%) samples. In bivariate analysis, there was no significant difference in the prevalence of anti-HEV IgG with respect to gender and district of origin. Although not statistically significant, males had higher odds of having anti-HEV IgG than females (odds ratio [OR] = 2.86; 95% CI 0.95-8.64). All anti-HEV IgG positive individuals were people of Chinese descent. Anti-HEV IgG increased significantly with age, from 0.6% (95% CI 0.1%-2.6%) of 18-30-year-old donors to 7.4% (95% CI 2.7%-17.0%) of donors older than 50 years and was highest among non-professional workers (5.3%; 95% CI 2.5%-10.5%). Increasing age and a non-professional occupation remained significant predictors for anti-HEV IgG in the multivariable analysis. Screening of blood donations for HEV in Malaysia is important to safeguard the health of transfusion recipients. The higher rates of HEV infection in blood from older donors and donors who are non-professional workers may provide insights into targeted groups for blood screening.
    Matched MeSH terms: Blood Transfusion
  18. Ramli M, Zulkafli Z, Chambers GK, Zilan RSAR, Edinur HA
    Oman Med J, 2020 Nov;35(6):e189.
    PMID: 33110633 DOI: 10.5001/omj.2020.86
    Objectives: Blood bank centers routinely screen for hepatitis B virus (HBV), hepatitis C virus (HCV), and human immunodeficiency virus (HIV) to ensure the safety of blood supply and thus prevent the dissemination of these viruses via blood transfusion. We sought to evaluate the detection of transfusion-transmitted infection (TTI) markers using standard serological methods and nucleic acid testing (NAT) among blood donors in Hospital Universiti Sains Malaysia.

    Methods: Donated blood units were assessed for the presence or absence of HBV, HCV, and HIV using two screening method: serology and NAT. Reactive blood samples were then subjected to serological confirmatory and NAT discriminatory assays.

    Results: A total of 9669 donors were recruited from September 2017 to June 2018. Among these, 36 donors were reactive either for HBV, HCV, or HIV by serological testing and eight by NAT screening. However, only 10 (three for HBV and seven for HCV) donors tested positive using serological testing and five (two for HBV and three for HCV) by NAT discriminatory assays. Note that all five NAT positive donors detected in the NAT discriminatory assays were confirmed to be serologically reactive. Therefore, the prevalence of HBV, HCV, and HIV was 0.03%, 0.1%, and 0.0%, respectively, in our donor pool.

    Conclusions: Both serological and NAT screening and confirmatory assays should be used routinely to reduce the risk of infection transmission via the transfusion of blood and blood components.

    Matched MeSH terms: Blood Transfusion
  19. Wahab IA, Naznin M, Nora MZ, Suzanah AR, Zulaiho M, Faszrul AR, et al.
    Med J Malaysia, 2011 Oct;66(4):326-34.
    PMID: 22299552 MyJurnal
    Marked improvement in the management of thalassaemia has not been matched by progress in psychosocial rehabilitation as thalassaemia continues to pose challenges to patients and their family members. Few studies have been carried out in Malaysia to look at such issues. This study is therefore to explore the concerns, beliefs and feelings about thalassaemia. It was conducted in the year 2009 over 7 months on "focus groups", in patients aged 8-22 years and parents attending Paediatric Clinic of Tengku Ampuan Afzan Hospital, Kuantan, Pahang. Results showed that concerns and adverse impact were related to lower grades in education, poor self-image, less chance of employment, marriage, financial burden and social integration. Compliance to subcutaneous iron chelator was poor. There were various concerns related to blood transfusion therapy. It is evident that thalassaemia greatly affects the psychosocial dimensions and a more structured long term psychosocial support is needed to improve quality of life of patients.

    Study site: Paediatric Clinic of Tengku Ampuan Afzan Hospital, Kuantan, Pahang.
    Matched MeSH terms: Blood Transfusion
  20. Wong MH, Chee KH, Azman W
    Singapore Med J, 2009 Oct;50(10):e362-4.
    PMID: 19907876
    A 40-year-old Malay woman presented with increasing lethargy, palpitation and shortness of breath, 17 years after a mitral and aortic valve replacement. A Starr-Edwards prosthetic valve replaced the mitral valve, and a Bjork-Shiley prosthetic valve replaced the aortic valve. Biochemical parameters demonstrated intravascular haemolysis, as evidenced by haemoglobin 7.8 g/dL, reticulocyte count 8.4%, lactate dehydrogenase 2,057 IU/L and low haptoglobulin levels (less than 6 mg/dL). Transoesophageal echocardiography revealed a paravalvular leakage over the mitral valve. The haemoglobin levels remained persistently low despite frequent blood transfusions. She successfully underwent a second mitral valve replacement. Her anaemia resolved subsequently.
    Matched MeSH terms: Blood Transfusion
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links