Displaying publications 1 - 20 of 56 in total

Abstract:
Sort:
  1. Lim WF, Muniandi L, George E, Sathar J, Teh LK, Gan GG, et al.
    Blood Cells Mol. Dis., 2012 Jan 15;48(1):17-21.
    PMID: 22079025 DOI: 10.1016/j.bcmd.2011.10.002
    The alpha haemoglobin stabilising protein (AHSP) acts as a molecular chaperone for α-globin by stabilising nascent α-globin before transferring it to waiting free β-globin chains. Binding of AHSP to α-globin renders α-globin chemically inert whereby preventing it from precipitating and forming reactive oxygen species byproducts. The AHSP has been actively studied in the recent years, particularly in its relation to β-thalassaemia. Studies have shown that AHSP is a modifier in β-thalassaemia mice models. However, this relationship is less established in humans. Studies by some groups showed no correlation between the AHSP haplotypes and the severity of β-thalassaemia, whereas others have shown that certain AHSP haplotype could modify the phenotype of β-thalassaemia intermedia patients. We investigated the expression of AHSP in relation to selected demographic data, full blood count, HPLC results, HbE/β-thalassaemia genotype, Xmn-1 Gγ polymorphism, α-globin, β-globin and γ-globin expression. We found that AHSP expression was significantly correlated to mean cell haemoglobin level, HbF %, α-globin, β-globin and excess α-globin expression. We concluded that AHSP could be a secondary compensatory mechanism in red blood cells to counterbalance the excess α-globin chains in HbE/β-thalassaemia individuals.
    Matched MeSH terms: alpha-Globins/genetics*; beta-Globins/genetics; gamma-Globins/genetics
  2. Harano K, Harano T
    Rinsho Byori, 2010 Apr;58(4):325-31.
    PMID: 20496759
    Hb and gene analyses of a Malaysian mother and her two daughters with microcytic anemia living in Japan were performed. Hb analyses of their hemolysates by IEF and DEAE-HPLC revealed high values of Hb A2 and HbF, but abnormal Hbs such as Hb E and Hb Constant Spring, which cause beta- and alpha-thalassemia traits, were not detected. From these data, they were suspected to be beta-thalassemia carriers. The thalassemic mutations commonly found in the Asian area by ARMS and nucleotide sequencing methods were not detected, and the frameworks of the beta-globin gene and the haplotypes of the beta-like globin gene cluster between the mother and daughters were not identical. These results led us to conclude that there was a beta(0)-thalassemia mutation with a large deletion from the beta-globin gene beyond the 3'beta/BamHI polymorphic site 3' downstream to the beta-globin gene. However, the range of the deletion from the beta-like globin gene cluster has not yet been completed in detail. Recently, there have been many foreigners mainly from Asian countries in Japan. We may encounter people with the rare type thalassemic mutation described in the text besides the mutations frequently found in Asian countries.
    Matched MeSH terms: beta-Globins/genetics*
  3. Lie-Injo LE, Herrera AR, Kan YW
    Nucleic Acids Res, 1981 Aug 11;9(15):3707-17.
    PMID: 6269090
    DNA from healthy Malaysian newborns was studied on gene maps after digestion with different restriction endonucleases. Of 65 newborns, two were found to be carriers of two different variants of triplicated alpha-globin loci. In variant no. 1, found in an Malay, the three alpha-globin genes are in an elongated DNA fragment on digestion with Eco RI and Bam HI. The third alpha-globin gene was found in a additional 3.7-kb fragment on digestion with Hpa I, Bgl II and Hind III. In variant no. 2, a new type of triplicated alpha-globin loci, found in a Chinese, the three alpha-globin genes reside in an elongated DNA fragment longer than that of variant no. 1 on digestion with Eco RI and Bam HI. The third alpha-globin gene was found in an additional 4.2-kb fragment on digestion with Hpa I and Hind III. Digestion of this variant DNA with Bg1 II produced an abnormal 16.7-kb fragment in addition to the normal 7.0-kb Bgl-II fragment. The locations of the restriction sites in the two types of triplicated alpha-globin loci are compatible with a mechanism of unequal crossing over following two different modes of misalignment.
    Matched MeSH terms: Globins/genetics*
  4. Jankovic L, Efremov GD, Petkov G, Kattamis C, George E, Yang KG, et al.
    Br J Haematol, 1990 May;75(1):122-6.
    PMID: 2375910
    In an ongoing effort to identify point mutations causing beta-thalassaemia, we have found two previously unreported mutations which are located in the Poly A site of the beta-globin gene. The screening programme used amplified DNA and dot-blot hybridization with several 32P-labelled oligonucleotide probes. DNA samples which remained unidentified by this methodology were subjected to sequencing with 32P-labelled primers and modified T7 DNA polymerase. The newly discovered mutations were confirmed by the dot-blot hybridization technique. One type concerned an AATAAA----AATGAA mutation in the polyadenylation site and was found in one family from Yugoslavia (including one patient with the C----T mutation at codon 29 in trans), one from Bulgaria (the patient had the G----A mutation at IVS-I-110 in trans), and one from Greece (this patient had the C----G mutation at IVS-II-745 in trans). Haematological data for three simple heterozygotes suggested a rather mild beta(+)-thalassemia. The second type involved an AATAAA----AATAGA mutation and was found in one family from Malaysia. The propositus had the beta E mutation on the other chromosome, was originally diagnosed as mild Hb E-beta(+)-thalassaemia, and had Hb A and Hb E percentages which were nearly the same.
    Matched MeSH terms: Globins/genetics*
  5. Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
    Matched MeSH terms: beta-Globins/genetics*
  6. Teh LK, Lee TY, Tan JA, Lai MI, George E
    Int J Lab Hematol, 2015 Feb;37(1):79-89.
    PMID: 24725998 DOI: 10.1111/ijlh.12240
    In Malaysia, β-thalassaemia is a common inherited blood disorder in haemoglobin synthesis with a carrier rate of 4.5%. Currently, PCR-incorporating techniques such as amplification refractory mutation system (ARMS) or reverse dot blot hybridization (RDBH) are used in β-thalassaemia mutation detection. ARMS allows single-mutation identification using two reactions, one for wild type and another for mutant alleles. RDBH requires probe immobilization and optimization of hybridization and washing temperatures which is time consuming. The aim of our study was to investigate whether β-thalassaemia mutations can be identified in samples with low DNA concentrations.
    Matched MeSH terms: beta-Globins/genetics*
  7. Kutler A, Lanclos KD
    Hemoglobin, 1987;11(1):93-109.
    PMID: 3583769
    Matched MeSH terms: Globins/genetics
  8. Nopparatana C, Panich V, Saechan V, Sriroongrueng V, Nopparatana C, Rungjeadpha J, et al.
    PMID: 8629112
    Beta-thalassemia mutations in 282 alleles of 253 unrelated individuals originating from various provinces in the south of Thailand were characterized by dot blot hybridization, specific PCR-amplification and direct DNA sequencing. It was possible to characterize the mutations in 274 (97.2%) of alleles studied. Twelve different point mutations and two different large deletions of the beta-globin gene were identified. Seven common mutations, namely 4 bp deletion at codons 41/42. IVS1 position 5 (G-C), codon 19 (AAC-AGC), codon 17 (AAG-TAG), IVS1 position 1 (G-T), position -28 (A-G) and 3.5 kb deletion, accounted for about 91.5%. The mutations at mRNA cap site + 1 (A-C) and IVS1 position 1 (G-A), previously undescribed in Thailand, were found in 1 and 2 individuals, respectively. A novel mutation of 105 bp deletion at the 5' end of beta-globin gene was detected in a family originating from this area. The knowledge from this study should be useful for planning of genetic counseling and prenatal diagnosis programs for patients with beta-thalassemia in the south of Thailand.
    Matched MeSH terms: Globins/genetics*
  9. Abdullah WA, Jamaluddin NB, Kham SK, Tan JA
    PMID: 9031421
    The spectrum of beta-thalassemia mutations in Malays in Singapore and Kelantan (Northeast Malaysia) was studied. Allele specific priming was used to determine the mutations in beta-carriers at -28, Codon 17, IVSI #1, IVSI #5, Codon 41-42 and IVSII #654 along the beta-globin gene. The most common structural hemoglobin variant in Southeast Asia, Hb E, was detected by DNA amplification with restriction enzyme (Mnl1) analysis. Direct genomic sequencing was carried out to detect the beta-mutations uncharacterized by allele-specific priming. The most prevalent beta-mutations in Singaporean Malays were IVSI #5 (45.83%) followed by Hb E (20.83%), codon 15 (12.5%) and IVSI #1 and IVSII #654 at 4.17% each. In contrast, the distribution of the beta-mutations in Kelantan Malays differed, with Hb E as the most common mutation (39.29%) followed by IVSI #5 (17.86%), codon 41-42 (14.29%), codon 19 (10.71%) and codon 17 (3.57%). The beta-mutations in Kelantan Malays follow closely the distribution of beta-mutations in Thais and Malays of Southern Thailand and Malays of West Malaysia. The AAC-->AGC base substitution in codon 19 has been detected only in these populations. The spectrum of beta-mutations in the Singaporean Malays is more similar to those reported in Indonesia with the beta-mutation at codon 15 (TGG-->TAG) present in both populations. The characterization of beta-mutations in Singaporean and Kelantan Malays will facilitate the establishment of effective prenatal diagnosis programs for beta-thalassemia major in this ethnic group.
    Matched MeSH terms: Globins/genetics
  10. George E
    PMID: 8629111
    Beta-thalassemia in West Malaysia is caused by 14 molecular defects with differing clinical severity. In Chinese patients from West Malaysia, the main beta-thalassemia mutations seen were (a) a 4 base pair-TCTT deletion in codon 41-42 [frameshift mutation (FSC 41-42)]; (b) a C to T substitution at the second intervening sequence (IVS2-654); (c) an A to G substitution in the TATA box [-28 (A to G)], and (d) an A to T substitution in codon 17[17 A to T]. In the Malays, the main mutations seen were (a) a G to C in nucleotide 5 at the intervening sequence I [IVS1-5 (G to C)]; (b) G to T substitution in nucleotide I at the intervening sequence I [IVS1-1 (G to T)]; (c) a A to T substitution in codon 17 (17 A to T); (d) removal of C from codon 35 [codon 35 (-C)], and (e) a 4 base pairs-TCTT deletion in codon 41-42 [frameshift mutation (FSC 41-42)]. A scoring system (Tha1 CS) has been formulated to predict clinical severity. It is the type of beta-thalassemia mutation present that decides on the clinical phenotype. The most severe beta-thalassemia mutation is assigned a score of 4. A score of 8 indicates severe thalassemia.
    Matched MeSH terms: Globins/genetics*
  11. Mahmoud Ahmed NH, Lai MI
    PMID: 36734897 DOI: 10.2174/1871529X23666230123140926
    β-thalassaemia is a genetic disorder resulting in a reduction or absence of β-globin gene expression. Due to the high prevalence of β-thalassaemia and the lack of available treatment other than blood transfusion and haematopoietic stem cell (HSC) transplantation, the disease represents a considerable burden to clinical and economic systems. Foetal haemoglobin has an appreciated ameliorating effect in β-haemoglobinopathy, as the γ-globin chain substitutes the β-globin chain reduction by pairing with the excess α-globin chain in β-thalassaemia and reduces sickling in sickle cell disease (SCD). BCL11A is a critical regulator and repressor of foetal haemoglobin. Downregulation of BCL11A in adult erythroblasts and cell lines expressing adult haemoglobin led to a significant increase in foetal haemoglobin levels. Disruption of BCL11A erythroid enhancer resulted in disruption of the BCL11A gene solely in the erythroid lineages and increased γ-globin expression in adult erythroid cells. Autologous haematopoietic stem cell gene therapy represents an attractive treatment option to overcome the immune complications and donor availability associated with allogeneic transplantation. Using genome editing technologies, the disruption of BCL11A to induce γ- globin expression in HSCs has emerged as an alternative approach to treat β-thalassaemia. Targeting the +58 BCL11A erythroid enhancer or BCL11A binding motif at the γ-gene promoter with CRISPR-Cas9 or base editors has successfully disrupted the gene and the binding motif with a subsequent increment in HbF levels. This review outlines the critical role of BCL11A in γ-globin gene silencing and discusses the different genome editing approaches to downregulate BCL11A as a means for ameliorating β-thalassaemia.
    Matched MeSH terms: gamma-Globins/genetics
  12. Sumera A, Radhakrishnan A, Baba AA, George E
    Blood Cells Mol. Dis., 2015 Apr;54(4):348-52.
    PMID: 25648458 DOI: 10.1016/j.bcmd.2015.01.008
    Thalassemia is known as a diverse single gene disorder, which is prevalent worldwide. The molecular chaperones are set of proteins that help in two important processes while protein synthesis and degradation include folding or unfolding and assembly or disassembly, thereby helping in cell homeostasis. This review recaps current knowledge regarding the role of molecular chaperones in thalassemia, with a focus on beta thalassemia.
    Matched MeSH terms: alpha-Globins/genetics*
  13. Lama R, Yusof W, Shrestha TR, Hanafi S, Bhattarai M, Hassan R, et al.
    Hematol Oncol Stem Cell Ther, 2022 Mar 01;15(1):279-284.
    PMID: 33592169 DOI: 10.1016/j.hemonc.2021.01.004
    BACKGROUND: Beta-thalassemia is a genetic disorder that is inherited in an autosomal recessive pattern. This genetic disease leads to a defective beta-globin hemoglobin chain causing partial or complete beta-globin chain synthesis loss. Beta-thalassemia major patients need a continuous blood transfusion and iron chelation to maintain the normal homeostasis of red blood cells (RBCs) and other systems in the body. Patients also require treatment procedures that are costly and tedious, resulting in a serious health burden for developing nations such as Nepal.

    METHODS: A total of 61 individuals clinically diagnosed to have thalassemia were genotyped with multiplex amplification refractory mutation system-polymerase chain reaction (ARMS-PCR). Twenty-one major mutations were investigated using allele-specific primers grouped into six different panels.

    RESULTS: The most common mutations found (23%) were IVS 1-5 (G-C) and Cd 26 (G-A) (HbE), followed by 619 deletion, Cd 8/9 (+G), Cd 16 (-C), Cd 41/42 (-TTCT), IVS 1-1 (G-T), Cd 19 (A-G), and Cd 17 (A-T) at 20%, 12%, 8%, 6%, 4%, 3%, and 1%, respectively.

    CONCLUSION: The results of this study revealed that Nepal's mutational profile is comparable to that of its neighboring countries, such as India and Myanmar. This study also showed that thalassemia could be detected across 17 Nepal's ethnic groups, especially those whose ancestors originated from India and Central Asia.

    Matched MeSH terms: beta-Globins/genetics
  14. Nasri NW, Jamal AR, Abdullah NC, Razi ZR, Mokhtar NM
    Arch Med Res, 2009 Jan;40(1):1-9.
    PMID: 19064120 DOI: 10.1016/j.arcmed.2008.10.008
    Preimplantation genetic diagnosis (PGD) of monogenic autosomal hereditary disorders following assisted conception usually involves the removal of one or two blastomeres from preimplantation embryos. However, the amount of DNA from a single blastomere is insufficient to amplify the region of interest. Hence, the whole genome amplification (WGA) method is performed prior to amplifying the genes of interest before analysis of DNA material through polymerase chain reaction (PCR).
    Matched MeSH terms: beta-Globins/genetics*
  15. Liew PS, Chen Q, Ng AWR, Chew YC, Ravin NV, Sim EUH, et al.
    Anal Biochem, 2019 10 15;583:113361.
    PMID: 31306622 DOI: 10.1016/j.ab.2019.113361
    Phage N15 protelomerase (TelN) cleaves double-stranded circular DNA containing a telomerase-occupancy-site (tos) and rejoins the resulting linear-ends to form closed-hairpin-telomeres in Escherichia coli (E. coli). Continued TelN expression is essential to support resolution of the linear structure. In mammalian cells, no enzyme with TelN-like activities has been found. In this work, we show that phage TelN, expressed transiently and stably in human and mouse cells, recapitulates its native activities in these exogenous environments. We found TelN to accurately resolve tos-DNA in vitro and in vivo within human and mouse cells into linear DNA-containing terminal telomeres that are resistant to RecBCD degradation, a hallmark of protelomerase processing. In stable cells, TelN activity was detectable for at least 60 days, which suggests the possibility of limited silencing of its expression. Correspondingly, linear plasmid containing a 100 kb human β-globin gene expressed for at least 120 h in non-β-globin-expressing mouse cells with TelN presence. Our results demonstrate TelN is able to cut and heal DNA as hairpin-telomeres within mammalian cells, providing a tool for creating novel structures by DNA resolution in these hosts. The TelN protelomerase may be useful for exploring novel technologies for genome interrogation and chromosome engineering.
    Matched MeSH terms: beta-Globins/genetics*
  16. George E, Wong HB, Jamaluddin M, Huisman TH
    Singapore Med J, 1993 Jun;34(3):241-4.
    PMID: 8266182
    Following complete DNA characterisation patients with Hb H disease were assigned into two groups: deletional (alpha +/alpha o) and non deletional (HbCS/alpha o). Earlier studies have indicated that the group with (HbCS/alpha o) has more severe clinical problems. The serum malonyldialdehyde (MDA) levels, a secondary product of lipid peroxidation were within the normal range, though significantly higher levels of MDA were seen in the non-deletional type of Hb H disease when compared with the deletional type. Markedly low vitamin E levels were also seen in the former group. There were no significant differences in clinical severity may be attributed to an interplay of the accelerated destruction of damaged mature red blood cells secondary to the oxidative denaturation of Hb H and inclusion precipitation; higher levels of Hb H and more inclusion precipitation were seen in the group with (HbCS/alpha o). Low levels of vitamin E in the (HbCS/alpha o) group being due to its consumption in the neutralisation of free radicals formed with the oxidation of globin chains.
    Matched MeSH terms: Globins/genetics
  17. Teh AH, Saito JA, Najimudin N, Alam M
    Sci Rep, 2015;5:11407.
    PMID: 26094577 DOI: 10.1038/srep11407
    Globins are haem-binding proteins with a conserved fold made up of α-helices and can possess diverse properties. A putative globin-coupled sensor from Methylacidiphilum infernorum, HGbRL, contains an N-terminal globin domain whose open and closed structures reveal an untypical dimeric architecture. Helices E and F fuse into an elongated helix, resulting in a novel site-swapped globin fold made up of helices A-E, hence the distal site, from one subunit and helices F-H, the proximal site, from another. The open structure possesses a large cavity binding an imidazole molecule, while the closed structure forms a unique Lys-His hexacoordinated species, with the first turn of helix E unravelling to allow Lys52(E10) to bind to the haem. Ligand binding induces reorganization of loop CE, which is stabilized in the closed form, and helix E, triggering a large conformational movement in the open form. These provide a mechanical insight into how a signal may be relayed between the globin domain and the C-terminal domain of HGbRL, a Roadblock/LC7 domain. Comparison with HGbI, a closely related globin, further underlines the high degree of structural versatility that the globin fold is capable of, enabling it to perform a diversity of functions.
    Matched MeSH terms: Globins/genetics
  18. Chen JJ, Tan JA, Chua KH, Tan PC, George E
    BMJ Open, 2015 Jul 22;5(7):e007648.
    PMID: 26201722 DOI: 10.1136/bmjopen-2015-007648
    OBJECTIVES: Single nucleotide polymorphism (SNP) with a mutation can be used to identify the presence of the paternally-inherited wild-type or mutant allele as result of the inheritance of either allele in the fetus and allows the prediction of the fetal genotype. This study aims to identify paternal SNPs located at the flanking regions upstream or downstream from the β-globin gene mutations at CD41/42 (HBB:c.127_130delCTTT), IVS1-5 (HBB:c.92+5G>C) and IVS2-654 (HBB:c.316-197C>T) using free-circulating fetal DNA.

    SETTING: Haematology Lab, Department of Biomedical Science, University of Malaya.

    PARTICIPANTS: Eight couples characterised as β-thalassaemia carriers where both partners posed the same β-globin gene mutations at CD41/42, IVS1-5 and IVS2-654, were recruited in this study.

    OUTCOME MEASURES: Genotyping was performed by allele specific-PCR and the locations of SNPs were identified after sequencing alignment.

    RESULTS: Genotype analysis revealed that at least one paternal SNP was present for each of the couples. Amplification on free-circulating DNA revealed that the paternal mutant allele of SNP was present in three fcDNA. Thus, the fetuses may be β-thalassaemia carriers or β-thalassaemia major. Paternal wild-type alleles of SNP were present in the remaining five fcDNA samples, thus indicating that the fetal genotypes would not be homozygous mutants.

    CONCLUSIONS: This preliminary research demonstrates that paternal allele of SNP can be used as a non-invasive prenatal diagnosis approach for at-risk couples to determine the β-thalassaemia status of the fetus.

    Matched MeSH terms: beta-Globins/genetics*
  19. Kalle Kwaifa I, Lai MI, Md Noor S
    Orphanet J Rare Dis, 2020 06 29;15(1):166.
    PMID: 32600445 DOI: 10.1186/s13023-020-01429-1
    BACKGROUND: Defective synthesis of the α-globin chain due to mutations in the alpha-globin genes and/or its regulatory elements leads to alpha thalassaemia syndrome. Complete deletion of the 4 alpha-globin genes results in the most severe phenotype known as haemoglobin Bart's, which leads to intrauterine death. The presence of one functional alpha gene is associated with haemoglobin H disease, characterised by non-transfusion-dependent thalassaemia phenotype, while silent and carrier traits are mostly asymptomatic.

    MAIN BODY: Clinical manifestations of non-deletional in alpha thalassaemia are varied and have more severe phenotype compared to deletional forms of alpha thalassaemia. Literature for the molecular mechanisms of common non-deletional alpha thalassaemia including therapeutic measures that are necessarily needed for the understanding of these disorders is still in demand. This manuscript would contribute to the better knowledge of how defective production of the α-globin chains due to mutations on the alpha-globin genes and/or the regulatory elements leads to alpha thalassaemia syndrome.

    CONCLUSION: Since many molecular markers are associated with the globin gene expression and switching over during the developmental stages, there is a need for increased awareness, new-born and prenatal screening program, especially for countries with high migration impact, and for improving the monitoring of patients with α-thalassaemia.

    Matched MeSH terms: alpha-Globins/genetics
  20. Abd Rahim MR, Kho SL, Kuppusamy UR, Tan JA
    Clin. Lab., 2015;61(9):1325-30.
    PMID: 26554253
    BACKGROUND: Beta-thalassemia is the most common genetic disorder in Malaysia. Confirmation of the β-globin gene mutations involved in thalassemia is usually carried out by molecular analysis of DNA extracted from leukocytes in whole blood. Molecular analysis is generally carried out when affected children are around 1 - 2 years as clinical symptoms are expressed during this period. Blood taking at this age can be distressing for the child. High yield and pure DNA extracted from non-invasive sampling methods can serve as alternative samples in molecular studies for genetic diseases especially in pediatric cases.

    METHODS: In this study, mouthwash, saliva, and buccal cytobrush samples were collected from β-thalassemia major patients who had previously been characterized using DNA extracted from peripheral blood. DNA was extracted from mouthwash, saliva, and buccal cytobrush samples using the conventional inexpensive phenol-chloroform method and was measured by spectrophotometry for yield and purity. Molecular characterization of β-globin gene mutations was carried out using the amplification refractory mutation system (ARMS).

    RESULTS: DNA extracted from mouthwash, saliva, and buccal cytobrush samples produced high concentration and pure DNA. The purified DNA was successfully amplified using ARMS. Results of the β-globin gene mutations using DNA from the three non-invasive samples were in 100% concordance with results from DNA extracted from peripheral blood.

    CONCLUSIONS: The conventional in-house developed methods for non-invasive sample collection and DNA extraction from these samples are effective and negate the use of more expensive commercial kits. In conclusion, DNA extracted from mouthwash, saliva, and buccal cytobrush samples provided sufficiently high amounts of pure DNA suitable for molecular analysis of β-thalassemia.

    Matched MeSH terms: beta-Globins/genetics*
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links