Displaying publications 1 - 20 of 264 in total

Abstract:
Sort:
  1. ‘Emergency chemotherapy’ for bleeding cervical cancer: case series
    Shafiee, M.N., NorAzlin, M.I., Lim, P.S., Arifuddin D, Trika I, Hatta, D.
    Journal of Surgical Academia, 2012;2(2):35-37.
    MyJurnal
    Fulminant haemorrhage in cervical cancer leads to severe anaemia and haemodynamic instability. Palliative management includes vaginal packing as temporary measure, radiotherapy and other invasive surgical procedures. High dose emergency chemotherapy is not commonly implemented particularly when complicated with anaemia and renal impairment. We discuss three case series on the usefulness of high dose chemotherapy to combat bleeding from cervical cancer as an emergency treatment. The first case was clinically staged as operable 2A disease with severe anaemia due to bleeding from the tumour mass. The haemoglobin was corrected by blood transfusion while the bleeding was being arrested by high dose chemotherapy. The second case was inoperable with invasion to the bladder mucosa. She had frank haematuria and bleeding from the tumour with severe anaemia. A course of chemotherapy and blood transfusion controlled the bleeding and anaemia was corrected. The third case presented late with obstructive uropathy and anaemia. She required dialysis, blood transfusion and high dose emergency chemotherapy to stop the bleeding before undergoing urinary diversion after an unsuccessful ureteric stenting. High dose chemotherapy consisting cisplatin, vincristine, bleomycin and mitomycin-C has a clinical value in arresting fulminant haemorrhage in cervical cancer.
    Matched MeSH terms: Hemoglobins
  2. Fulltext α-Thalassemia with Haemoglobin Adana mutation: prenatal diagnosis
    Zainal NZ, Alauddin H, Ahmad S, Hussin NH
    Malays J Pathol, 2014 Dec;36(3):207-11.
    PMID: 25500521
    Thalassaemia carriers are common in the Asian region including Malaysia. Asymptomatic patients can be undiagnosed until they present for their antenatal visits. Devastating obstetric outcome may further complicate the pregnancy if both parents are thalassaemia carriers leading to hydrophic fetus due to haemoglobin Bart's disease. However in certain cases where unexplained hydrops fetalis occur in parents with heterozygous thalassaemia carrier,mutated α genes should be suspected. We report a twenty-nine year old woman in her third pregnancy with two previous pregnancies complicated by early neonatal death at 21 and 28 weeks of gestation due to hydrops fetalis. DNA analysis revealed the patient to have heterozygous (--SEA) α-gene deletion, while her husband has a compound heterozygosity for α(3.7) deletion and codon 59 (GGC → GAC) mutation of the α-gene. This mutation, also known as hemoglobin Adana, can explain hydrops fetalis resulting from two alpha gene deletions from the patient (mother) and a single alpha gene deletion with mutation from the father. The third pregnancy resulted in a grossly normal baby boy with 3 α-gene deletions (HbH disease). We postulate that, in view of heterogenisity of the α-thalassaemia in this patient with severely unstable haemoglobin Adana chains from her husband, there will be a 25% possibility of fetal hydrops in every pregnancy.
    Matched MeSH terms: Hemoglobins, Abnormal/genetics*
  3. X-linked Sideroblastic Anemia in a Malay Boy With ALAS2 S568G Mutation
    Susanto TAK, Bhattacharyya R
    J Pediatr Hematol Oncol, 2017 Jul;39(5):408-409.
    PMID: 28644307 DOI: 10.1097/MPH.0000000000000814
    Dimorphism in peripheral blood film was noted in a 16 year old Malay boy with anemia who was eventually diagnosed with X-linked sideroblastic anemia. A mutation in ALAS2 S568G was identified which has not been described previously in a Malay ethnic group.
    Matched MeSH terms: Hemoglobins/analysis
  4. Fulltext Urinary erythrocyte morphology as a diagnostic aid in haematuria
    Ahmad G, Segasothy M, Morad Z
    Singapore Med J, 1993 Dec;34(6):486-8.
    PMID: 8153706
    The value of urinary erythrocyte morphology in diagnosing glomerular and nonglomerular haematuria was studied using phase contrast microscopy in 105 patients with significant haematuria. Fifty-eight (93.6%) out of 62 patients with glomerulonephritis had dysmorphic erythrocytes and 40 (93.1%) out of the 43 patients with nonglomerular disease had isomorphic erythrocytes in the urine. A mixed picture of glomerular and nonglomerular haematuria was seen in 5 patients. The sensitivity was 93.6%, the specificity was 97.7% and the positive predictive value was 98.3% for glomerulonephritis in patients with dysmorphic haematuria. The positive predictive value for a nonglomerular source of bleeding was 96.7% with isomorphic haematuria. It is concluded that phase contrast microscopic examination of erythrocytes in urine is a simple, inexpensive and noninvasive technique that reliably distinguishes between glomerular and nonglomerular bleeding in patients.
    Matched MeSH terms: Hemoglobins/analysis
  5. Fulltext Unstable haemoglobin Köln disease in members of a Malay family
    Eng LL, Lopez CG, Eapen JS, Eravelly J, Wiltshire BG, Lehmann H
    J Med Genet, 1972 Sep;9(3):340-3.
    PMID: 5079107 DOI: 10.1136/jmg.9.3.340
    Matched MeSH terms: Hemoglobins/analysis; Hemoglobins, Abnormal/analysis*
  6. Fulltext Ultraviolet-visible study on acid-base equilibria of aporphine alkaloids with antiplasmodial and antioxidant activities from Alseodaphne corneri and Dehaasia longipedicellata
    Zahari A, Ablat A, Omer N, Nafiah MA, Sivasothy Y, Mohamad J, et al.
    Sci Rep, 2016;6:21517.
    PMID: 26898753 DOI: 10.1038/srep21517
    The UV-vis spectra of isocorydine 1, norisocorydine 2 and boldine 3 were studied in 2% v/v acetonitrile, at constant ionic strength (0.1 M NaCl, 35 degree Celsius). The pK(a) values of isocorydine 1 and norisocorydine 2 were 11.75 and 12.07, respectively. Boldine 3 gave a pK(a) value of 9.16 and 10.44. All of the alkaloids 1-3 were stable at physiological pH; thereby all of them will not ionize, thus permitting the basic nitrogen to be protonated and accumulated within the acidic food vacuole of Plasmodium via pH trapping. Subsequently, acidic food vacuoles that have been neutralized by alkaloids would result in enhancement of the antiplasmodial activity. The alkaloids showed antiplasmodial activity against Plasmodium falciparum and antioxidant activities; DPPH radical scavenging, metal chelating and ferric reducing power. The antioxidant properties of the alkaloids under investigation revealed that in addition to the antiplasmodial activity, the alkaloids can also prevent oxidative damage. It can be prevented by binding free heme and neutralizing the electrons produced during the Plasmodium falciparum mediated haemoglobin destruction in the host. Slightly basic properties of the aforementioned alkaloids, along with their antioxidant activities, are advantageous in improving the suppression of malaria infection that cause less damage to the host.
    Matched MeSH terms: Hemoglobins
  7. Two types of triplicated alpha-globin loci in humans
    Lie-Injo LE, Herrera AR, Kan YW
    Nucleic Acids Res, 1981 Aug 11;9(15):3707-17.
    PMID: 6269090
    DNA from healthy Malaysian newborns was studied on gene maps after digestion with different restriction endonucleases. Of 65 newborns, two were found to be carriers of two different variants of triplicated alpha-globin loci. In variant no. 1, found in an Malay, the three alpha-globin genes are in an elongated DNA fragment on digestion with Eco RI and Bam HI. The third alpha-globin gene was found in a additional 3.7-kb fragment on digestion with Hpa I, Bgl II and Hind III. In variant no. 2, a new type of triplicated alpha-globin loci, found in a Chinese, the three alpha-globin genes reside in an elongated DNA fragment longer than that of variant no. 1 on digestion with Eco RI and Bam HI. The third alpha-globin gene was found in an additional 4.2-kb fragment on digestion with Hpa I and Hind III. Digestion of this variant DNA with Bg1 II produced an abnormal 16.7-kb fragment in addition to the normal 7.0-kb Bgl-II fragment. The locations of the restriction sites in the two types of triplicated alpha-globin loci are compatible with a mechanism of unequal crossing over following two different modes of misalignment.
    Matched MeSH terms: Hemoglobins, Abnormal/genetics
  8. Fulltext Tubal Ectopic Pregnancy: Do Our Women Benefit From Laparoscopic Surgery?
    Lim, K.J., Omar, M.H., Jamil, M.A., Ng, S.P.
    International Medical Journal Malaysia, 2006;5(2):1-8.
    MyJurnal
    Introduction: Operative laparoscopy is the gold standard approach for treatment of tubal pregnancy. Although benefits of this approach are well established, data on its uptake trend in Malaysia is largely unknown. Objective: This study aims to determine the operative laparoscopy uptake in management of tubal pregnancy at a busy tertiary hospital and whether the benefits associated with laparoscopic surgery was achieved. Materials and Methods: This prospective observational study was conducted on all women admitted for tubal pregnancy at Hospital Sultanah Aminah, Johor Bahru, a public tertiary hospital over a period of 12 months. The on-call team was responsible for the surgical approach. Patient’s clinical presentation, operative laparoscopic uptake, factors affecting the choice of approach and duration of hospitalization were analyzed. Results: The tubal pregnancy rate was 7.6 per 1000 deliveries. Twenty- seven of the 138 cases (20%) had hypovolemic shock, requiring urgent laparotomy and were excluded from study. The operative laparoscopy rate for stable tubal pregnancy was only 42.3% (47 of 111 cases). Women managed laparoscopically were associated with a significantly higher pre-operative hemoglobin level, mostly nullipara and had surgery performed during office hours. They waited longer for their surgery but were discharged earlier compared to the laparotomy group. There was no difference in the duration of hospitalization. Conclusions: Less than half of all hemodynamically stable tubal pregnancies in our hospital had operative laparoscopy. The current laparoscopy uptake rate can be further improved.
    Matched MeSH terms: Hemoglobins
  9. Fulltext Trends of prevalence of anaemia among adolescents in a middle-income country: a cohort study
    Vanitha Krishnan, Hazreen Abdul Majid, Rafdzah Ahmad Zaki, Muhammad Yazid Jalaludin
    Malaysian Journal of Medicine and Health Sciences, 2019;15(104):105-105.
    MyJurnal
    Introduction: Anaemia is a significant public health problem among adolescents globally but there is limited data in many countries, including Malaysia. This study aims to investigate the 5-years incidence of anemia among Malaysian adolescents by gender, ethnicity, locality of schools, Body Mass Index, stature and diet intake. Methods: A secondary analysis of existing data from MyHeART study was conducted within a closed cohort of 528 adolescents (aged 13 years) attended 15 public secondary schools from Kuala Lumpur, Selangor and Perak. The adolescents who were followed up at 15 and 17 years old had completed haemoglobin assessment, anthropometric measurements and -days diet history. The data was cleaned and missingness was handled accordingly with multiple imputation. SPSS Software version 21 was used to analyse the data, with Generalised Estimating Equation (GEE) showing the effect of time on the trajectory of prevalence of anaemia over the 5 years. Results: The prevalence or incidence? of anaemia in 2012, 2014 and 2016 was 7.9% (95%CI: 5.0-12.3), 13.9% (95%CI: 10.0-19.0) and 15.8% (95%CI:11.3-21.7). In females, anaemia increased from 11.1% (95%CI:6.7-18.7) to 15.7% (11.4-21.3) and 23.1%(95%CI: 16.8-31.0); the change was significant from 13 to 15 years old. Similar trend was noticed in those who are stunted, overweight/obese, in both urban/rural schools and didn’t meet their daily recommended nutrient intake for total calorie, protein and iron. Conclusion: Anaemia is increasing in trend among the adolescents over the years and deems attention from the relevant stakeholders to create a robust anemia prevention program.
    Matched MeSH terms: Hemoglobins
  10. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations
    Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
    Matched MeSH terms: Hemoglobins, Abnormal/analysis
  11. Toxicological evaluation of dried kacangma herb (Leonurus sibiricus) in rats
    Chua HP, Aminah Abdullah, Murugaiyah M
    Sains Malaysiana, 2009;38.
    Kacangma (Leonurus sibiricus L.) is a popular traditional herb that has been consumed for decades by the people of Sarawak as a herbal medicine or culinary ingredient. The toxicity of dried kacangma herb on Sprague Dawley male and female rats was evaluated through 90-day sub-chronic studies. The rats were fed kacangma at the rate of 0.5 (low dose), 5 (medium dose) and 25 (high dose) g/kg body weight. The control groups of rats received only the commercial rat pellet. Minor treatment-related effects were observed for body weights, organ weights and the lipid profile parameters and these did not appear to be of toxicological significance. In the sub-chronic toxicity studies, some indications of renal and liver toxicity were evident in the medium and high dose groups when plasma creatinine and liver enzymes were found to be higher when compared with the control and the low dose groups. The hematology study reveals statistically significant mild anemia in rats from the medium and high dose groups as indicated by decreases in hemoglobin, red blood cell count and packed cell volume (hematocrit value). Administration of kacangma herb at medium and high dose was also found to cause adverse effects in histopathological structure of the liver and kidney of both male and female rats. However, low dose group showed no significant differences compared to the control. Therefore, it is considered safe and less chance of developing toxicity if the herb is consumed at the dose of 0.5 g/kg body weight as observed throughout the 90 days period of sub-chronic study.
    Matched MeSH terms: Hemoglobins
  12. Fulltext Toxic effects of Litsea elliptica Blume essential oil on red blood cells of Sprague-Dawley rats
    Taib IS, Budin SB, Siti Nor Ain SM, Mohamed J, Louis SR, Das S, et al.
    J Zhejiang Univ Sci B, 2009 Nov;10(11):813-9.
    PMID: 19882755 DOI: 10.1631/jzus.B0920199
    Litsea elliptica Blume leaves have been traditionally used as medicinal herbs because of its antimutagenicity, chemopreventative and insecticidal properties. In this study, the toxic effects of L. elliptica essential oil against Sprague-Dawley rat's red blood cells (RBCs) were evaluated. L. elliptica essential oil was given by oral gavage 5 times per week for 3 treated groups in the doses of 125, 250, and 500 mg/(kg body weight), respectively, and the control group received distilled water. Full blood count, RBC osmotic fragility, RBC morphological changes, and RBC membrane lipid were analyzed 28 d after the treatment. Although L. elliptica essential oil administration had significantly different effects on hemoglobin (Hb), mean cell hemoglobin concentration (MCHC), mean cell volume (MCV), and mean cell hemoglobin (MCH) in the experimental groups as compared to the control group (P<0.05), the values were still within the normal range. L. elliptica induced morphological changes of RBC into the form of echinocyte. The percentage of echinocyte increased significantly among the treated groups in a dose-response manner (P<0.001). The concentrations of RBC membrane phospholipids and cholesterol of all treated groups were significantly lower than those of control group (P<0.001). However, the RBC membrane osmotic fragility and total proteins of RBC membrane findings did not differ significantly between control and treated groups (P>0.05). It is concluded that structural changes in the RBC membrane due to L. elliptica essential oil administration did not cause severe membrane damage.
    Matched MeSH terms: Hemoglobins/metabolism
  13. Fulltext Tolerability, safety and intermediary pharmacological effects of cilostazol and isosorbide mononitrate, alone and combined, in patients with lacunar ischaemic stroke: The LACunar Intervention-1 (LACI-1) trial, a randomised clinical trial
    Blair GW, Appleton JP, Flaherty K, Doubal F, Sprigg N, Dooley R, et al.
    EClinicalMedicine, 2019 04 24;11:34-43.
    PMID: 31317131 DOI: 10.1016/j.eclinm.2019.04.001
    Background: Lacunar stroke, a frequent clinical manifestation of small vessel disease (SVD), differs pathologically from other ischaemic stroke subtypes and has no specific long-term secondary prevention. Licenced drugs, isosorbide mononitrate (ISMN) and cilostazol, have relevant actions to prevent SVD progression.

    Methods: We recruited independent patients with clinically confirmed lacunar ischaemic stroke without cognitive impairment to a prospective randomised clinical trial, LACunar Intervention-1 (LACI-1). We randomised patients using a central web-based system, 1:1:1:1 with minimisation, to masked ISMN 25 mg bd, cilostazol 100 mg bd, both ISMN and cilostazol started immediately, or both with start delayed. We escalated doses to target over two weeks, sustained for eight weeks. Primary outcome was the proportion achieving target dose. Secondary outcomes included symptoms, safety (haemorrhage, recurrent vascular events), cognition, haematology, vascular function, and neuroimaging. LACI-1 was powered (80%, alpha 0.05) to detect 35% (90% versus 55%) difference between the proportion reaching target dose on one versus both drugs at 55 patients. Registration ISRCTN12580546.

    Findings: LACI-1 enrolled 57 participants between March 2016 and August 2017: 18 (32%) females, mean age 66 (SD 11, range 40-85) years, onset-randomisation 203 (range 6-920) days. Most achieved full (64%) or over half (87%) dose, with no difference between cilostazol vs ISMN, single vs dual drugs. Headache and palpitations increased initially then declined similarly with dual versus single drugs. There was no between-group difference in BP, pulse-wave velocity, haemoglobin or platelet function, but pulse rate was higher (mean difference, MD, 6.4, 95%CI 1.2-11.7, p = 0.02), platelet count higher (MD 35.7, 95%CI 2.8, 68.7, p = 0.03) and white matter hyperintensities reduced more (Chi-square p = 0.007) with cilostazol versus no cilostazol.

    Interpretation: Cilostazol and ISMN are well tolerated when the dose is escalated, without safety concerns, in patients with lacunar stroke. Larger trials with longer term follow-up are justified.

    Funding: Alzheimer's Society (AS-PG-14-033).

    Matched MeSH terms: Hemoglobins
  14. Fulltext The prevalence of anaemia and associated factors among pregnant women in Tongod and Kinabatangan districts
    Glen Wendell Sibadogil, Aza Sherin Mohamad Yusuff, Shahrezza Suhaimi Rinin
    Malaysian Journal of Medicine and Health Sciences, 2019;15(106):27-27.
    MyJurnal
    Introduction: Anaemia in pregnancy is a major cause of disability worldwide, with a prevalence of more than 20% in >80% countries worldwide. Of those affected, roughly 50% are due to iron-deficiency anaemia, but there is some variation across different populations due to local culture and practices. Anaemia affects 38% of pregnant women worldwide, while in Malaysia the prevalence is 35%. The study aim is to determine the prevalence of anaemia among pregnant women in 2 rural districts in Sabah as well as knowledge, attitude and practices towards anaemia in these women. Methods: This retrospective cross-sectional study was done in Tongod and Kinabatangan Districts involving 217 pregnant women at 35-37 weeks of gestation who attended antenatal check-up at 6 government clin-ics in these districts. An interview using a standardized questionnaire was conducted by community nurses at the respective clinics. Sociodemographic and antenatal details was collected, including information about knowledge, attitude and practices toward anaemia. The Chi-square test was used to compare anaemia at 36 weeks with select-ed sociodemographic and antenatal factors, as well as KAP factors. Results: The mean age of women in the study was 28.4 ± 5.9 years, and the mean haemoglobin level at around 36 weeks age of gestation was 11.0 ± 1.1 g/dL. Prevalence of anaemia in these women was 52%. Most of the answers in the KAP section reflected the relatively high awareness about anaemia in pregnancy and methods to lessen its effects. A significant association was found between anaemia at 36 weeks and monthly family income, defaulting on iron supplements, caffeine beverages taken with meals, and dietary restrictions (p = 0.010, 0.001, 0.001, and 0.017 respectively). Conclusion: The high preva-lence of anaemia among pregnant women in these 2 districts reflects the practices of these women despite high levels of knowledge of anaemia. More effort needs to be done to apply this knowledge to decrease anaemia in pregnant women in rural areas.
    Matched MeSH terms: Hemoglobins
  15. Fulltext The mechanism of formation, structure and physiological relevance of covalent hemoglobin attachment to the erythrocyte membrane
    Welbourn EM, Wilson MT, Yusof A, Metodiev MV, Cooper CE
    Free Radic. Biol. Med., 2017 02;103:95-106.
    PMID: 28007575 DOI: 10.1016/j.freeradbiomed.2016.12.024
    Covalent hemoglobin binding to membranes leads to band 3 (AE1) clustering and the removal of erythrocytes from the circulation; it is also implicated in blood storage lesions. Damaged hemoglobin, with the heme being in a redox and oxygen-binding inactive hemichrome form, has been implicated as the binding species. However, previous studies used strong non-physiological oxidants. In vivo hemoglobin is constantly being oxidised to methemoglobin (ferric), with around 1% of hemoglobin being in this form at any one time. In this study we tested the ability of the natural oxidised form of hemoglobin (methemoglobin) in the presence or absence of the physiological oxidant hydrogen peroxide to initiate membrane binding. The higher the oxidation state of hemoglobin (from Fe(III) to Fe(V)) the more binding was observed, with approximately 50% of this binding requiring reactive sulphydryl groups. The hemoglobin bound was in a high molecular weight complex containing spectrin, ankyrin and band 4.2, which are common to one of the cytoskeletal nodes. Unusually, we showed that hemoglobin bound in this way was redox active and capable of ligand binding. It can initiate lipid peroxidation showing the potential to cause cell damage. In vivo oxidative stress studies using extreme endurance exercise challenges showed an increase in hemoglobin membrane binding, especially in older cells with lower levels of antioxidant enzymes. These are then targeted for destruction. We propose a model where mild oxidative stress initiates the binding of redox active hemoglobin to the membrane. The maximum lifetime of the erythrocyte is thus governed by the redox activity of the cell; from the moment of its release into the circulation the timer is set.
    Matched MeSH terms: Hemoglobins/metabolism*
  16. The identification of haemoglobin New York in Malaysia by isoelectric focusing on polyacrylamide gel
    George-Kodiseri E, Mokhtar AB, Farida K, Wong HB, Duraisamy G
    Family Physician, 1991;3:28-30.
    Matched MeSH terms: Hemoglobins
  17. The effectiveness of theory-based intervention to improve haemoglobin levels among women with anaemia in pregnancy
    Hasneezah H, Rosliza AM, Salmiah MS, Appanah G
    Med J Malaysia, 2020 11;75(6):626-634.
    PMID: 33219169
    BACKGROUND: Anaemia in pregnancy is considered a public health problem throughout the world. The effects of the existing intervention in ensuring compliance to the subscribed regimen and the impact of nutrition education in enhancing dietary modification during pregnancy in Malaysia have been minimal. This study aims to develop, implement and evaluate the effects of the Health Belief Model educational intervention on haemoglobin level among anaemic pregnant women.

    METHODS: This is a quasi-experimental research with prepost test design with control group involving 81 participants per group from two health clinics in Sepang. The primary outcome was a change in the haemoglobin levels following educational intervention. Secondary outcomes include knowledge on anaemia, Health Belief Model (HBM) constructs, dietary iron intake and compliance towards iron supplementation. The intervention group received a HBMbased education intervention programme.

    RESULTS: The response rate in the intervention and control group were 83.9% and 82.7% respectively. Generalised estimating equations analysis showed that the intervention was effective in improving the mean haemoglobin level (β=0.75, 95%CI=0.52, 0.99, p<0.001), the knowledge score (β=1.42, 95%CI=0.36, 2.49, p=0.009), perceived severity score (β=2.2, 95%CI= 1.02, 3.39, p<0.001) and increased proportion of high compliance level (AOR=4.59, 95%CI=1.58, 13.35, p=0.005).

    CONCLUSION: HBM-based health education programme has proven to be effective in improving the haemoglobin levels, knowledge scores, perceived severity scores and compliance level of participants. The study results emphasized on the effectiveness of such an approach, therefore it is recommended that future educational interventions which aim at increasing preventive healthy behaviours in pregnant women may benefit from the application of this model in primary health care settings.

    Matched MeSH terms: Hemoglobins
  18. The effectiveness of supervised weekly versus unsupervised daily oral iron supplementation regimes in improving the status of iron deficiency in preschool Orang Asli children
    Aisyah, H.M.R., Syed Zulkifli, S.Z., Noor Khatijah, N.
    Malaysian Journal of Paediatrics and Child Health, 2005;14(1):14-20.
    MyJurnal
    OBJECTIVE: To assess a better strategy to implement oral iron supplementation in preschool Orang Asli children with high prevalence of iron deficiency, as opposed to the current practice, yet inefficient, of daily oral iron supplementation regime.
    METHODS: A randomized controlled trial was conducted in preschool children presenting to a remote health center (Klinik Desa Kenang, Sungai Siput, Perak) with iron deficiency state. Oral iron prescribed as a daily unsupervised dose (group A) was compared to a weekly supervised administration (group B) over eight weeks.
    RESULTS: Before intervention, iron deficiency was prevalent in these children (91.2%). The mean baseline haemoglobin and ferritin levels of group A were 9.9 (+/- 1.1) g/dL and 8.9 (+/- 1.3) mg/L respectively, and that of group B were 9.9 (+/-1.2) g/dL and 9.7 (+/- 1.9) mg/L respectively. After eight weeks of treatment, the mean rise in haemoglobin and ferritin levels of group A were 1.2 (+/- 0.6) g/dL and 18.1 (+/- 15.1) mg/ L respectively, as compared to group B, where the mean rise in haemoglobin and ferritin levels were 1.8 (+/- 0.7) g/dL and 35.2 (+/- 21.8) mg/ L respectively. The differences in the rise of haemoglobin and ferritin levels of the two groups were statistically significant (p<0.025). Both regimes were however effective in improving the iron status in a short term (88% in group A and 100% in group B), but group B had a better iron improvement (35.2 +/- 21.8 versus 18.1 +/-15.1 mg/L).
    CONCLUSION: It was concluded that the supervised weekly oral iron supplementation regime was more effective than the unsupervised daily supplementation for treating iron deficiency in preschool Orang Asli children. Since iron deficiency is so common in these children and in view of the possibility of poor compliance with the unsupervised regime, an intermittent supervised treatment is proposed as the most effective strategy to address this nutritional problem.
    Matched MeSH terms: Hemoglobins
  19. Fulltext The effectiveness of iron education through a mobile application on donor return after deferral for low hemoglobin
    Hasan MI, Noordin SS, Hami R, Ishak N, Achuthan A
    Blood Transfus, 2022 Nov;20(6):446-453.
    PMID: 35848625 DOI: 10.2450/2022.0018-22
    BACKGROUND: Low hemoglobin level is a common cause of donor deferral and results in a huge loss of the donor pool. This study aimed to evaluate the effectiveness of a mobile application as an educational tool to enhance donor return and improve hemoglobin levels after deferral.

    MATERIALS AND METHODS: This was an interventional study involving 382 blood donors who were deferred for low hemoglobin. The donors were divided equally into two groups: a control group and the intervention group. The control group received standard management for low hemoglobin deferral, which includes a short counseling session and a 1-month course of oral iron therapy. The intervention group used a mobile application in addition to standard management. The primary endpoint was the number of blood donors who returned during the 7 months of follow-up. The secondary endpoints were the hemoglobin increment at the first visit after the donors' deferral.

    RESULTS: The return rate was higher in the intervention group, with 81.2% of the donors returning in the 7 months of follow-up compared to 66% of the control group (p<0.001). Male and female donors had mean hemoglobin increments of 1.0 g/dL and 0.7 g/dL, respectively, in the intervention group, compared to decrements of 0.2 g/dL and 0.4 g/dL, respectively, in the control group (p<0.001). Multivariable analysis showed a significant association between intervention method, education level and donation status on donor return (p=0.015, p<0.001, and p<0.001, respectively).

    DISCUSSION: Higher return rate and greater hemoglobin increase in the interventional group could be attributed to features in the mobile application. Repeat donors had the highest odds of returning to donate, followed by those with a tertiary level of education, and those given the mobile application. This study showed that a mobile application was effective in enhancing donor return and increasing hemoglobin level among deferred blood donors on their first return.

    Matched MeSH terms: Hemoglobins
  20. Fulltext The effectiveness of a theory-based intervention program for pregnant women with anemia: A randomized control trial
    Abd Rahman R, Idris IB, Md Isa Z, Abd Rahman R
    PLoS One, 2022;17(12):e0278192.
    PMID: 36473006 DOI: 10.1371/journal.pone.0278192
    Anemia in pregnancy is a public health concern. It has been diagnosed in 27% of pregnant women in Malaysia and up to 40% of pregnant women globally. This study aimed to develop and evaluate the effectiveness of an intervention initiative based on the health belief model. The MyPinkMom program was disseminated through a mobile messaging application to pregnant women to educate them on the prevention of anemia in pregnancy. We conducted a two-arm cluster-assignment, single-blinded, randomized control trial at two government antenatal clinics in Selangor. One clinic was randomly chosen as the intervention group, and the other was chosen as the control group. Sixty pregnant women with anemia from the intervention group received the MyPinkMom intervention program in the form of six infographic video clips, and 60 pregnant women with anemia from the control group received routine counseling on anemia in pregnancy. Pregnant women who had anemia secondary to hemoglobinopathy or other chronic diseases were excluded from this study. MANOVA showed significant increases in hemoglobin, knowledge, attitude, subjective norms, and perceived behavioral control scores for adherence to iron supplements, dietary iron, and dietary vitamin C intake (p < 0.001) in the intervention group at week 6. A significant reduction also occurred in dietary tannin intake (p < 0.001) in the intervention group at week 6. The intervention group at week 6 showed a large effect on hemoglobin level increments (partial eta squared, Ƞp2 0.268), dietary iron intake (Ƞp2 0.213), knowledge of anemia in pregnancy (Ƞp2 0.622), subjective norm scores for adherence to iron supplements (Ƞp2 0.167), and reduction in dietary tannin intake (Ƞp2 0.353). Similarly, repeated measures ANOVA showed that changes in hemoglobin levels were significantly different over time (i.e., at baseline, week 6, and week 12) between the intervention and control groups (p < 0.001). Hemoglobin increased rapidly over time among participants in the intervention group but gradually in the control group. To conclude, the newly developed MyPinkMom program that was delivered through a messaging application showed effectiveness in preventing anemia during pregnancy.
    Matched MeSH terms: Hemoglobins
Related Terms
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links