Displaying publications 1 - 20 of 309 in total

Abstract:
Sort:
  1. Kodama H, Ohno Y
    Hinyokika Kiyo, 1989 Jun;35(6):923-34.
    PMID: 2678977
    In this paper, urolithiasis is remarked from the standpoint of descriptive epidemiology, which examines the frequency distribution of a given disease in a population in terms of time, place and personal characteristics with an aim of identifying risk factors or some clues to the etiology. Some descriptive epidemiological features of urolithiasis are summarized. Prevalence rate is around 4% (4-15% in males and 4-8% in females), and incidence rate varies from area to area: 53.2 per 100,000 population in 1975 in Japan, 364 in 1976 in Malaysia, and 540 in 1979 in West Germany. Prevalence and/or incidence rates have, in general, increased in the developed countries since World War II and in the developing countries as well, where upward trends are quite analogous to the trends observed in the nineteenth century in Europe. Recurrence rate, which is much higher in males than in females, ranges from 31% to 75%, depending on the follow-up periods. In the industrialized countries, upper urinary (renal and ureteral) stones account for more than 90% of total stones, which are ordinarily calcium complexes in composition. More common in the developing countries are lower urinary (bladder and urethral) stones, frequently composed of magnesium ammonium phosphate, which indicates a close association with urinary tract infections. Variations in frequency are evident by season and by region within a country. Age and sex differentials in urinary stone formers are substantial: more common in males 30-40 years old in the industrialized countries and in children under 10 years old in the developing countries. Racial differentials are also noted; blacks appear to suffer less frequently than whites. Stone formers experience more frequent episodes of stone formation in their family members, particularly father and brothers, than non-stone formers. These findings on racial differentials and family preponderance suggest the possible relevance of genetic factors in stone formation. Stone formers are more likely to be occupationally sedentary and socially affluent. This observation and differentials by age and sex suggest the probable relevance of lifestyle and environmental factors in stone formation. Epidemiological factors incriminated for stone formation will be discussed in a separate paper.
    Matched MeSH terms: Continental Population Groups
  2. Bain O, Ramachandran CP, Petter F, Mak JW
    Ann Parasitol Hum Comp, 1977 7 1;52(4):471-9.
    PMID: 931324
    Onchocerca dewittei n. sp. was collected from a wild Boar at the metatarse level (tendons and subcutaneous connective tissue); it can be differentiated from other species by the female cuticle showing straight ridges which overlap in the lateral fields, and by its relatively thick microfilaria (length 228-247 mu and width 6-7 mu). This suidean Onchocerca displays some primitive characters such as straight ridges and persistency of ten pairs of caudal papillae in the male; but as a whole this species is undoubtedly more highly evolved than O. raillieti Bain, Müller and coll., 1976, a parasite of Equidae.
    Matched MeSH terms: Animal Population Groups/parasitology*
  3. Kruszka P, Porras AR, de Souza DH, Moresco A, Huckstadt V, Gill AD, et al.
    Am J Med Genet A, 2018 05;176(5):1128-1136.
    PMID: 29681090 DOI: 10.1002/ajmg.a.38672
    Williams-Beuren syndrome (WBS) is a common microdeletion syndrome characterized by a 1.5Mb deletion in 7q11.23. The phenotype of WBS has been well described in populations of European descent with not as much attention given to other ethnicities. In this study, individuals with WBS from diverse populations were assessed clinically and by facial analysis technology. Clinical data and images from 137 individuals with WBS were found in 19 countries with an average age of 11 years and female gender of 45%. The most common clinical phenotype elements were periorbital fullness and intellectual disability which were present in greater than 90% of our cohort. Additionally, 75% or greater of all individuals with WBS had malar flattening, long philtrum, wide mouth, and small jaw. Using facial analysis technology, we compared 286 Asian, African, Caucasian, and Latin American individuals with WBS with 286 gender and age matched controls and found that the accuracy to discriminate between WBS and controls was 0.90 when the entire cohort was evaluated concurrently. The test accuracy of the facial recognition technology increased significantly when the cohort was analyzed by specific ethnic population (P-value 
    Matched MeSH terms: Population Groups
  4. Burke DS, Heisey GB
    Am J Trop Med Hyg, 1984 Sep;33(5):940-4.
    PMID: 6486304
    Serum samples were obtained within 3 days of capture from 106 cynomolgus monkeys (Macaca fascicularis) in peninsular Malaysia. Fifty-two monkeys were trapped on the fringes of palm oil estates and 54 in dense primary jungle. Sera were tested for antibodies to hepatitis A virus (HAV) with a commercial radioimmunoassay. Twenty-four animals had detectable serum anti-HAV activity (6 of 52 from palm oil estate sites and 18 of 54 from primary jungle sites). Among monkeys at both sites, antibody prevalence was strongly correlated with animal weight: overall only four of 69 monkeys (6%) weighing less than 2.0 kg had serum anti-HAV antibodies, while 14 of 29 (48%) weighing 2.0 to 3.9 kg, and 6 of 8 (75%) weighing 4.0 kg or more, had serum anti-HAV antibodies. These data suggest that wild cynomolgus monkeys in Malaysian jungles become infected with HAV or an HAV-like virus at a rate comparable to that of humans in the same region, and raise the possibility of a sylvatic cycle for HAV.
    Matched MeSH terms: Animal Population Groups/immunology*
  5. Wadsworth GR
    Med J Malaysia, 1981 Sep;36(3):148-50.
    PMID: 7329371
    Matched MeSH terms: Continental Population Groups
  6. Yen WC, Shariff ZM, Adznam SN, Sulaiman N, Siew CY
    Asia Pac J Clin Nutr, 2018 7 27;27(4):886-892.
    PMID: 30045435 DOI: 10.6133/apjcn.072017.02
    BACKGROUND AND OBJECTIVES: Information on the growth status of indigenous children is useful for developing intervention strategies, but the data are limited. This study determined the prevalence of undernutrition among under-five indigenous children (Orang Asli) and tracked the growth status of Orang Asli children aged 0-3 years.

    METHODS AND STUDY DESIGN: This study had two phases: a cross-sectional growth study of under-five Orang Asli children (N=304; Phase 1) and a 2-year prospective cohort growth study of Orang Asli children aged 0-3 years (N=214; Phase 2) in the Temerloh district of Pahang, Malaysia. Weight-for-age, length/height-for-age, weight-for-length/height, and body mass index-for-age were determined.

    RESULTS: The prevalence rates of stunting, underweight, wasting, and thinness in under-five Orang Asli children (Phase 1) were 64%, 49%, 14%, and 12%, respectively. In the cohort of 214 children (Phase 2), weight-for-age was initially documented and maintained closely at -1.50 standard deviations (SD) in the first 6 months, but it declined to approximately -2.00 SD at 15 months and remained close to -2.00 SD thereafter. Length/height-for-age declined rapidly to approximately -2.50 SD at 18 months and fluctuated between -2.30 and -2.50 SD thereafter. Weight-for-length/height increased sharply to -0.40 SD at 2-3 months, declined gradually to less than -1.00 SD at 12 months, and plateaued between -1.00 and -1.30 SD thereafter.

    CONCLUSIONS: Undernutrition is prevalent among Orang Asli children, with length rather than weight faltering being more pronounced in the first 2 years of life. Identifying the causes of early growth retardation in this population is required to inform future preventive strategies.

    Matched MeSH terms: Population Groups
  7. Jagun ZT, Daud D, Ajayi OM, Samsudin S, Jubril AJ, Rahman MSA
    Environ Sci Pollut Res Int, 2023 Nov;30(55):116644-116655.
    PMID: 35867301 DOI: 10.1007/s11356-022-21990-5
    Growing populations, expanding economies, industrialisation, and urbanisation pose a problem for waste management in developing countries. Their waste management methods, on the other hand, are not as efficient as they could be. Most developing countries' current waste management practices do not fully conform to developed countries' best practices for meeting socioeconomic goals. As a result, the importance of waste management in developing countries has grown in recent years. In order to highlight the socioeconomic perspectives of waste management practices, the present study examines the existing literature, policies, information, and records on waste management in developing nations. The findings indicate that essential socioeconomic factors such as finances, population density, per capita income, education level, policies, and technology have a significant impact on waste management, which encompasses waste generation, collection, composition, and disposal/treatment. Nonetheless, waste management has a number of economic benefits, including financial stability, job creation, and community cohesion. This study will inspire further research on the need for developing nations to consider the socioeconomic benefits of proper waste management and to develop a policy plan to achieve these benefits.
    Matched MeSH terms: Population Groups
  8. Deurenberg P, Deurenberg-Yap M
    Acta Diabetol, 2003 Oct;40 Suppl 1:S246-9.
    PMID: 14618484
    Most in vivo body composition methods rely on assumptions that may vary among different population groups as well as within the same population group. The assumptions are based on in vitro body composition (carcass) analyses. The majority of body composition studies were performed on Caucasians and much of the information on validity methods and assumptions were available only for this ethnic group. It is assumed that these assumptions are also valid for other ethnic groups. However, if apparent differences across ethnic groups in body composition 'constants' and body composition 'rules' are not taken into account, biased information on body composition will be the result. This in turn may lead to misclassification of obesity or underweight at an individual as well as a population level. There is a need for more cross-ethnic population studies on body composition. Those studies should be carried out carefully, with adequate methodology and standardization for the obtained information to be valuable.
    Matched MeSH terms: Continental Population Groups*
  9. Chan WK, Tan AT, Vethakkan SR, Tah PC, Vijayananthan A, Goh KL
    Clin Res Hepatol Gastroenterol, 2014 Jun;38(3):284-91.
    PMID: 24736032 DOI: 10.1016/j.clinre.2014.02.009
    BACKGROUND: Non-alcoholic fatty liver disease (NAFLD) and cardiovascular diseases are both common among patients with diabetes mellitus.
    OBJECTIVE: The aim of this study is to determine if ultrasonography-diagnosed NAFLD is associated with prevalent ischemic heart disease (IHD) among patients with diabetes mellitus.
    METHODS: This is a cross-sectional study on consecutive patients seen at the Diabetic Clinic, University of Malaya Medical Centre. The medical record for each patient was reviewed for documented IHD. Patients without documented IHD but had symptoms and/or electrocardiographic changes suggestive of IHD were referred for cardiac evaluation.
    RESULTS: Data for 399 patients were analyzed. Mean age was 62.8±10.5 years with 43.1% male. NAFLD and IHD were present in 49.6 and 26.6%, respectively. The prevalence of IHD among patients with and without NAFLD was 24.7 and 28.4%, respectively (P=0.414). The prevalence of IHD was highest among the Indians (34.1%) followed by the Malays (29.2%) and the Chinese (20.1%). No association was found between NAFLD and IHD when analyzed according to ethnicity. On multivariate analysis, independent factors associated with IHD were older age, lower levels of physical activity, greater waist circumference and higher serum glycated hemoglobin level.
    CONCLUSIONS: Ultrasonography-diagnosed NAFLD was not associated with prevalent IHD among patients with diabetes mellitus in a multiracial Asian hospital clinic population.

    Study site: Diabetic clinc, University Malaya Medical Centre (UMMC)
    Matched MeSH terms: Continental Population Groups/statistics & numerical data
  10. Tan YM, Goh KL
    World J Gastroenterol, 2005 Oct 07;11(37):5859-62.
    PMID: 16270398
    AIM: Inflammatory bowel disease appears to be uncommon among Asians. This study was conducted to determine the prevalence of ulcerative colitis (UC) in Malaysian patients and to establish the spectrum of the disease seen in Malaysian patients. Three major Asian races: Malay, Chinese, and Indian co-exist in Malaysia and we sought to determine if there were any racial differences in the prevalence and presentation of disease. Racial differences for several other gastrointestinal diseases have previously been observed and found to be extremely interesting.

    METHODS: Data were obtained retrospectively from a review of the medical records of in- and out-patients with a diagnosis of UC at the University Hospital, Kuala Lumpur between 1985 and 1998.

    RESULTS: There were 45 confirmed cases of UC of which 3 were foreigners, who were excluded from analysis. Thirty new cases of UC were diagnosed during the study period. Their mean age at presentation was 33.0+/-10.0 years. The highest prevalence of UC was 17.9/100 000 hospital admissions in the Indians, followed by 11.2/100 000 hospital admissions in the Chinese. The lowest prevalence was 3.7/100 000 hospital admissions in the Malays. The prevalence of UC was significantly higher in the Indians and the Chinese when compared with the Malays with an OR of 4.89 (CI = 2.02-12.24; chi2 = 15.45, P<0.001) and 3.06 (CI = 1.24-7.78; chi2 = 6.30; P = 0.012) respectively. The extent of colonic disease was similar in the Malay and Indian patients. In contrast, distal or left-sided colitis predominated in the Chinese with an OR of 8.17 (95%CI = 1.31-64.87; chi2 = 5.53, P = 0.02). Extraintestinal manifestations were uncommon (11.9%).

    CONCLUSION: UC is an uncommon disease in Malaysia, but racial differences exist. The Indians had the highest prevalence of UC with the Chinese demonstrating the least extensive disease.

    Matched MeSH terms: Continental Population Groups
  11. Roy RN
    Med J Malaya, 1968 Mar;22(3):204-16.
    PMID: 4234357
    Matched MeSH terms: Continental Population Groups
  12. Hartini Yusof, Mohamed Kamel Abd. Ghani
    MyJurnal
    A cross-sectional study was conducted in February 2006 to determine the prevalence of Trichuris trichiura infection among Orang Asli (Aborigine) children at Pos Lenjang, Pahang. A total of 71 faecal samples were collected from the children (40 girls and 31 boys) aged between 1-12 years. The samples were examined for the presence of Trichuris trichiura ova using direct smear and formalin-ether concentration techniques. The result revealed that the overall prevalence of Trichuris trichiura infection was 43.7%. The infection was higher in males (51.6%) compared to females (37.5%), though not statistically significant (p > 0.05). According to age group, the school-aged children had higher prevalence of infection (56.8%) than preschool children (29.4%) (p < 0.05). Low socioeconomic status, large family size, poor environmental sanitation and poor personal hygiene are possible contributing factors that increase the prevalence of infection among the Orang Asli children at Pos Lenjang. In 31 samples positive for Trichuris trichiura, a detection rate of 100% was obtained using formalin-ether concentration, compared to 25.8% with direct smear technique. Thus, it is recommended that both techniques be performed in routine faecal examination for a more accurate diagnosis.
    Matched MeSH terms: Population Groups
  13. Dharmalingam SK, Taek YS, Mahadev V
    Med J Malaya, 1970 Sep;25(1):3-7.
    PMID: 4249493
    Matched MeSH terms: Continental Population Groups
  14. Nusee Z, Rusly A, Jamalludin AR, Abdulwahab DF, Ismail R
    Malays J Med Sci, 2016 May;23(3):57-63.
    PMID: 27418870
    BACKGROUND: Urinary incontinence (UI) demonstrates major prevalence in women of different population groups. Reduced quality of life (QOL) is observed due to incontinence problems. Urogenital Distress Inventory (UDI-6) and Incontinence Impact Quality of Life (IIQ-7) are useful disease-specific questionnaires evaluating the impact of urinary incontinence on the QOL of women which is accepted internationally.

    OBJECTIVE: This study aims to translate and validate UDI-6 and IIQ-7 in Malay language.

    METHODS: A cross sectional study, which recruited 100 participants from two urogynecology clinics. Both questionnaires were initially translated from English to Bahasa Malaysia followed by back translation and final correction done by the professional translators. The participants were requested to maintain a urinary record of the upcoming week for three days that assisted in quantifying the severity of symptoms. None of the subjects were assigned any treatment during the study period. Validity and reliability of the translated questionnaires were determined by checking the internal consistency and also by doing test-retest.

    RESULTS: The internal consistency levels of the UDI-6 and IIQ-7 Bahasa Malaysia questionnaires were 0.73 and 0.90 respectively with good test-retest (0.86 and 0.95). Incontinence episodes were strongly associated with obstructive, irritative, and stress symptoms. The factor of day time voiding had strong correlation with obstructive and irritative symptoms.

    CONCLUSION: UDI-6 and IIQ-7 did not measure similar outcomes; however, both questionnaires have their strengths in clinical settings. Analysis has also revealed that the Malaysian versions of both questionnaires had appropriate test-retest validity and reliability. Thus, it can be said that both of the questionnaires had great importance for screening patients with urinary incontinence in Malaysia.

    Matched MeSH terms: Population Groups
  15. Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
    Matched MeSH terms: Population Groups/ethnology; Population Groups/genetics
  16. Conti DV, Darst BF, Moss LC, Saunders EJ, Sheng X, Chou A, et al.
    Nat Genet, 2021 Jan;53(1):65-75.
    PMID: 33398198 DOI: 10.1038/s41588-020-00748-0
    Prostate cancer is a highly heritable disease with large disparities in incidence rates across ancestry populations. We conducted a multiancestry meta-analysis of prostate cancer genome-wide association studies (107,247 cases and 127,006 controls) and identified 86 new genetic risk variants independently associated with prostate cancer risk, bringing the total to 269 known risk variants. The top genetic risk score (GRS) decile was associated with odds ratios that ranged from 5.06 (95% confidence interval (CI), 4.84-5.29) for men of European ancestry to 3.74 (95% CI, 3.36-4.17) for men of African ancestry. Men of African ancestry were estimated to have a mean GRS that was 2.18-times higher (95% CI, 2.14-2.22), and men of East Asian ancestry 0.73-times lower (95% CI, 0.71-0.76), than men of European ancestry. These findings support the role of germline variation contributing to population differences in prostate cancer risk, with the GRS offering an approach for personalized risk prediction.
    Matched MeSH terms: Continental Population Groups/genetics*
  17. Nasr NA, Al-Mekhlafi HM, Ahmed A, Roslan MA, Bulgiba A
    Parasit Vectors, 2013;6:27.
    PMID: 23356952 DOI: 10.1186/1756-3305-6-27
    Despite the continuous efforts to improve the quality of life of Orang Asli (Aborigines) communities, these communities are still plagued with a wide range of health problems including parasitic infections. The first part of this study aimed at determining the prevalence of soil-transmitted helminth (STH) infections and identifying their associated factors among rural Orang Asli children.
    Matched MeSH terms: Population Groups
  18. Milosevic A, Lo MS
    Int Dent J, 1996 Dec;46(6):572-8.
    PMID: 9023582
    The prevalence and associated aetiologies of tooth wear were investigated in three ethnic groups in Sabah (Northern Borneo) using the Tooth Wear Index (TWI). The number of surfaces with enamel wear only, dentine exposed for less than a third or dentine exposed for more than a third were categorised into the TW minimal, moderate or severe respectively. A structured questionnaire was used to elicit medical/dental history, oral hygiene practices, satisfaction with body image, diet and other personal habits/details. The sample comprised of a self selected sample of 148 dental hospital attenders; 47 (32 per cent) each of ethnic Chinese and Malay and 54 (36 per cent) of ethnic Kadazan, matched for age and with a similar number of scoreable teeth per subject. Dentine exposure within the total sample was a common finding (95 per cent TW with moderate, 41 per cent TW severe). The Kadazan group had significantly (P < 0.05) more surfaces with severe tooth wear than the Chinese or Malay. Tobacco chewing was positively associated (rho = +0.4, P < 0.05) with both moderate and severe tooth wear, as was the habit of crushing/eating bones. Neither carbonated beverages or fresh fruit intake were associated with tooth wear, but their frequency of consumption was low. The buccal and occlusal surfaces of the posterior teeth were the most severely worn. Generally, wear was greater in the upper anterior sextant compared to the lower anterior sextant, with the exception of the lower incisal edges in the Kadazan group. Tooth wear into dentine was a common occurrence, especially among the Kadazan subjects and least among the Chinese subjects. The aetiological factors associated with this tooth wear are different to those encountered in Western cultures.
    Matched MeSH terms: Continental Population Groups
  19. Foong HF, Lim SY, Koris R, Haron SA
    PMID: 33922295 DOI: 10.3390/ijerph18094459
    Time-use of older adults can be different than in earlier life, especially during the transition from pre- to post-retirement or after experiencing major life events, and the changes could affect their mental health. However, the extent and nature of such research in gerontology have not been examined to date. Therefore, this scoping review sought to map the literature on time-use and mental health in the older population to examine the extent and nature of those research activities. A scoping review was conducted using four databases-PubMed, Scopus, CINAHL, and EMBASE according to PRISMA guidelines. Data were extracted using a pretested tool to develop a descriptive analysis and thematic summary. A total of 11 articles met the eligibility criteria. Seven out of 11 studies involved cross-sectional design, while the remainder were longitudinal studies. The longitudinal studies mainly were secondary data analysis. Time-use data were mainly collected using daily diaries, and the most common mental health outcome included was depression. Only two studies did not evaluate the direct relationship between time-use and mental health. Our review has revealed studies evaluating time-use and mental health in older adults. Limitations of review and recommendations for future studies are discussed.
    Matched MeSH terms: Population Groups*
  20. Ali O, Tan TT, Sakinah O, Khalid BA, Wu LL, Wan Nazaimoon WM, et al.
    Ann Acad Med Singap, 1994 Nov;23(6):852-5.
    PMID: 7741498
    Thyroid function and pubertal development of aborigines (Orang Asli) and Malays at different socioeconomic strata were assessed among 1136 subjects aged 7 years and above. Anthropometric measurements, goitre and pubertal staging were done. Serum thyroxine (T4), triiodothyronine (T3) and growth hormone were measured using radioimmunoassays (RIA) and serum thyroid stimulating hormone (TSH) by immunoradiometric assays (IRMA). It was found that serum T3 in children was significantly higher in Malays from rural areas, girls and children aged less than 13 years. However, in adults, T3 was significantly associated with anthropometric indices. On the contrary, serum T4 levels were higher among children from urban areas. In adults, serum T4 levels were significantly related to nutritional status and they increased according to the levels of social development, being lowest in remote areas and highest in urban areas. However, serum TSH levels were significantly higher in Orang Asli at all ages and among malnourished children. By using multiple regression, apart from age, gender and ethnicity, nutritional status was a significant predictor for T3 levels in children and adults. Presence of goitre was an important factor which determined the T4 levels in children and adults after controlling for other factors. It was also a predictor for TSH levels in children but not in adults. Fasting serum growth hormone (GH) levels were significantly higher among less privileged groups and decreased according to social development. Serum growth hormone was negatively correlated with anthropometric indices and had a significant association with malnutrition.(ABSTRACT TRUNCATED AT 250 WORDS)
    Matched MeSH terms: Continental Population Groups
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links