Displaying publications 21 - 40 of 309 in total

Abstract:
Sort:
  1. Fulltext Stiff hands and feet, facial deformities
    Thuraisingham C, Sinniah D
    J Fam Pract, 2016 Feb;65(2):121-4.
    PMID: 26977463
    The appearance of the skin on this woman's face, hands, and feet helped us to recognize an advanced case of an autoimmune disease.
    Matched MeSH terms: Continental Population Groups
  2. Climate change, health, and discrimination: action towards racial justice
    Deivanayagam TA, Selvarajah S, Hickel J, Guinto RR, de Morais Sato P, Bonifacio J, et al.
    Lancet, 2023 Jan 07;401(10370):5-7.
    PMID: 36343651 DOI: 10.1016/S0140-6736(22)02182-1
    Matched MeSH terms: Continental Population Groups
  3. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations
    Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
    Matched MeSH terms: Population Groups/ethnology; Population Groups/genetics
  4. Attitudes toward epilepsy in East Malaysia using the Public Attitudes Toward Epilepsy (PATE) scale
    Chia ZJ, Lim KS, Fong SL, Sim RS, Rajahram GS, Narayanan V, et al.
    Epilepsy Behav, 2020 09;110:107158.
    PMID: 32512367 DOI: 10.1016/j.yebeh.2020.107158
    BACKGROUND: Epilepsy stigma is an important issue affecting people with epilepsy (PWE) in various social aspects of life. Most studies on stigma were among the metropolitan population but rarely on indigenous people. Hence, this study aimed to understand the attitudes toward epilepsy of the East Malaysians, comparing with the West Malaysians previously reported.

    METHOD: This study was performed among the indigenous people in Kuching and Sibu (Sarawak) and Kota Kinabalu (Sabah) using the Public Attitudes Toward Epilepsy (PATE) scale. A higher score indicates poorer attitude.

    RESULT: A total of 360 respondents (41.7% Kadazan-Dusun, 30.6% Bidayuh, and 24.7% Iban) aged 34.6 ± 12.6 years completed the questionnaire. They were predominantly females and had lower education level and income compared with the West Malaysians. The Sabah population had significantly lower mean scores (better attitudes) than those in Sarawak, in both personal and general domains (p 

    Matched MeSH terms: Population Groups/ethnology*; Population Groups/psychology
  5. Fulltext Racial/ancestral diversity in 174 toxicity-related radiogenomic studies: A systematic review
    Zuber SH, Yahya N
    J Cancer Res Ther, 2021 6 15;17(2):477-483.
    PMID: 34121695 DOI: 10.4103/jcrt.JCRT_896_18
    Purpose: This study systematically reviews the distribution of racial/ancestral features and their inclusion as covariates in genetic-toxicity association studies following radiation therapy.

    Materials and Methods: Original research studies associating genetic features and normal tissue complications following radiation therapy were identified from PubMed. The distribution of radiogenomic studies was determined by mining the statement of country of origin and racial/ancestrial distribution and the inclusion in analyses. Descriptive analyses were performed to determine the distribution of studies across races/ancestries, countries, and continents and the inclusion in analyses.

    Results: Among 174 studies, only 23 with a population of more one race/ancestry which were predominantly conducted in the United States. Across the continents, most studies were performed in Europe (77 studies averaging at 30.6 patients/million population [pt/mil]), North America (46 studies, 20.8 pt/mil), Asia (46 studies, 2.4 pt/mil), South America (3 studies, 0.4 pt/mil), Oceania (2 studies, 2.1 pt/mil), and none from Africa. All 23 studies with more than one race/ancestry considered race/ancestry as a covariate, and three studies showed race/ancestry to be significantly associated with endpoints.

    Conclusion: Most toxicity-related radiogenomic studies involved a single race/ancestry. Individual Participant Data meta-analyses or multinational studies need to be encouraged.

    Matched MeSH terms: Continental Population Groups/genetics; Continental Population Groups/statistics & numerical data*
  6. Knowledge, attitudes, and perceptions of epilepsy in Asia: toward a uniform study protocol
    Lim SH, Pan A
    Epilepsia, 2005;46 Suppl 1:48-9.
    PMID: 15816980
    Knowledge, attitudes, and perceptions of epilepsy (KAPE) among the public play a major role in determining the extent to which people with epilepsy can be integrated into their society.
    Matched MeSH terms: Continental Population Groups/psychology; Continental Population Groups/statistics & numerical data
  7. Herbal medicines: predictors of recommendation by physicians
    Aziz Z
    J Clin Pharm Ther, 2004 Jun;29(3):241-6.
    PMID: 15153085
    We hypothesized that as the use of herbal medicines increases in the general population, so do patients' requests to physicians for recommendations. However, why some physicians recommend herbal medicines while others do not is not well understood.
    Matched MeSH terms: Continental Population Groups/ethnology; Continental Population Groups/statistics & numerical data
  8. The population genomic landscape of human genetic structure, admixture history and local adaptation in Peninsular Malaysia
    Deng L, Hoh BP, Lu D, Fu R, Phipps ME, Li S, et al.
    Hum Genet, 2014 Sep;133(9):1169-85.
    PMID: 24916469 DOI: 10.1007/s00439-014-1459-8
    Peninsular Malaysia is a strategic region which might have played an important role in the initial peopling and subsequent human migrations in Asia. However, the genetic diversity and history of human populations--especially indigenous populations--inhabiting this area remain poorly understood. Here, we conducted a genome-wide study using over 900,000 single nucleotide polymorphisms (SNPs) in four major Malaysian ethnic groups (MEGs; Malay, Proto-Malay, Senoi and Negrito), and made comparisons of 17 world-wide populations. Our data revealed that Peninsular Malaysia has greater genetic diversity corresponding to its role as a contact zone of both early and recent human migrations in Asia. However, each single Orang Asli (indigenous) group was less diverse with a smaller effective population size (N(e)) than a European or an East Asian population, indicating a substantial isolation of some duration for these groups. All four MEGs were genetically more similar to Asian populations than to other continental groups, and the divergence time between MEGs and East Asian populations (12,000--6,000 years ago) was also much shorter than that between East Asians and Europeans. Thus, Malaysian Orang Asli groups, despite their significantly different features, may share a common origin with the other Asian groups. Nevertheless, we identified traces of recent gene flow from non-Asians to MEGs. Finally, natural selection signatures were detected in a batch of genes associated with immune response, human height, skin pigmentation, hair and facial morphology and blood pressure in MEGs. Notable examples include SYN3 which is associated with human height in all Orang Asli groups, a height-related gene (PNPT1) and two blood pressure-related genes (CDH13 and PAX5) in Negritos. We conclude that a long isolation period, subsequent gene flow and local adaptations have jointly shaped the genetic architectures of MEGs, and this study provides insight into the peopling and human migration history in Southeast Asia.
    Matched MeSH terms: Population Groups/ethnology; Population Groups/genetics*
  9. The influence of ethnicity on health-related quality of life in diabetes mellitus: a population-based, multiethnic study
    Wee HL, Li SC, Cheung YB, Fong KY, Thumboo J
    J Diabetes Complications, 2006;20(3):170-8.
    PMID: 16632237 DOI: 10.1016/j.jdiacomp.2005.06.010
    OBJECTIVES: The aims of this study were to evaluate the influence of ethnicity on health-related quality of life (HRQoL) in diabetic participants using both profile [the Short-Form 36 (SF-36)] and single-index (the SF-6D) instruments and to evaluate the usefulness of the SF-6D as a summary measure for the SF-36.
    RESEARCH DESIGN AND METHODS: Using data from a cross-sectional, population-based survey of Chinese, Malay, and Indians in Singapore, we analyzed the influence of ethnicity and other variables on each SF-36 scale and SF-6D scores using linear regression models to adjust for the influence of known determinants of HRQoL.
    RESULTS: Data from 309 diabetic respondents were analyzed. Compared with other ethnicities, Indians were most likely to report impaired HRQoL. The unadjusted influence of ethnicity on HRQoL exceeded the minimum clinically important difference (MCID) for all SF-36 scales (MCID: 5 points) and the SF-6D (MCID: 0.033 points). After adjusting for gender, age, and education, the influence of Chinese ethnicity exceeded the MCID for all SF-36 scales, except vitality (VT) and mental health (MH), as well as for the SF-6D. The influence of Malay ethnicity exceeded the MCID only for the SF-36 MH scale and the SF-6D. The influence of ethnicity on HRQoL persisted after adjusting further for other determinants of HRQoL. The SF-6D reflected the ethnic trends for some but not all SF-36 scales.
    CONCLUSIONS: After adjusting for demographic, socioeconomic, and other factors known to influence HRQoL, ethnicity remained an important factor influencing HRQoL in this population-based multiethnic sample of diabetic Asians. Further studies to identify modifiable factors explaining the ethnic disparities in HRQoL among diabetic participants are needed. The SF-6D may be a useful summary measure for the SF-36.
    Matched MeSH terms: Population Groups/ethnology; Population Groups/statistics & numerical data
  10. Fulltext A review of Orang Asli newborns admitted to a neonatal unit in a Malaysian general hospital
    Kandasamy Y, Somasundram P
    Singapore Med J, 2007 Oct;48(10):926-8.
    PMID: 17909678
    The Orang Asli are the indigenous population in peninsular Malaysia and are in fact a diverse sub-ethnic group with different languages. Our aim was to collect data on Orang Asli newborns, from western and central Pahang, that were admitted to a general hospital with paediatric specialist services.
    Matched MeSH terms: Population Groups/ethnology; Population Groups/statistics & numerical data*
  11. A new species of clearwing moth (Lepidoptera: Sesiidae: Osminiini) from Peninsular Malaysia, exhibiting bee-like morphology and behaviour
    Skowron MA, Munisamy B, Hamid SB, Węgrzyn G
    Zootaxa, 2015;4032(4):426-34.
    PMID: 26624378 DOI: 10.11646/zootaxa.4032.4.7
    A new species of Sesiidae, tribe Osminiini from Peninsular Malaysia, Heterosphecia pahangensis Skowron, displaying numerous bee-mimicking features, is described. DNA barcodes showed significant differences with related taxa. However, the paucity of Sesiidae barcodes from Southeast Asia prevents meaningful taxonomic comparisons. The closest match out of published data on Sesiidae barcodes is Heterosphecia bantanakai, Arita & Gorbunov (2000a) from the tribe Osminiini, which has 9.98% sequence divergence from Heterosphecia pahangensis. Photographs of the moth in its natural habitat are shown. Behavioural aspects, such as mud-puddling and mode of flight, are described and presented in a video.
    Matched MeSH terms: Population Groups
  12. A comparative study on radiographic analysis of impacted third molars among three ethnic groups of patients attending AIMST Dental Institute, Malaysia
    Kanneppady SK, Balamanikandasrinivasan, Kumaresan R, Sakri SB
    Dent Res J (Isfahan), 2013 May;10(3):353-8.
    PMID: 24019804
    The patterns of facial growth, jaw and tooth size are inherited and are likely to differ among population and races. Aim of this study is to evaluate and compare the pattern of third molar (3M) impaction among three different ethnic groups (Chinese, Indian, Malay) of patients attending AIMST Dental Institute, Malaysia.
    Matched MeSH terms: Continental Population Groups
  13. Fulltext Ethnomedical survey of plants used by the Orang Asli in Kampung Bawong, Perak, West Malaysia
    Samuel AJ, Kalusalingam A, Chellappan DK, Gopinath R, Radhamani S, Husain HA, et al.
    J Ethnobiol Ethnomed, 2010;6:5.
    PMID: 20137098 DOI: 10.1186/1746-4269-6-5
    A qualitative ethnomedical survey was carried out among a local Orang Asli tribe to gather information on the use of medicinal plants in the region of Kampung Bawong, Perak of West Malaysia in order to evaluate the potential medicinal uses of local plants used in curing different diseases and illnesses.
    Matched MeSH terms: Population Groups
  14. Fulltext Chronic cough with multiple causes
    Chew BH
    Malays Fam Physician, 2010;5(2):101-4.
    PMID: 25606197 MyJurnal
    This case reports a 57-year-old lady presented with cough of two months duration despite repeated treatments from multiple general practitioners. It took her another two months to know her diagnoses and a further couple of months to be relieved of her cough and became asymptomatic. Chronic cough management in primary care often needs an empiric integrative approach and requires good doctor-patient rapport with informed follow ups and continuity of care to be successful.
    Matched MeSH terms: Continental Population Groups
  15. Leprosy in sarawak, East malaysian borneo
    Yap FB
    Scand. J. Infect. Dis., 2009;41(4):320.
    PMID: 19117243 DOI: 10.1080/00365540802680409
    Matched MeSH terms: Population Groups
  16. Pediatric cardiology in Asia
    Vongprateep C
    Cor Vasa, 1981;23(1):4-7.
    PMID: 7238054
    The problems of pediatric cardiology in Asia can be summarized as follows. In the countries like India, Indonesia, Malaysia, Pakistan and some other countries especially with government support like Thailand, the priority is primary health care. Except in Japan, cardiac care for children is not well supported financially. Training in pediatric cardiology is not readily available. Consequently small numbers of pediatric cardiologists, pediatric cardiac surgeons and active centres are available even in Japan. It is importannt to reduce the incidence of rheumatic fever and rheumatic heart disease by prevention of streptococcal infections and to increase the standard of living and environment. Transportation and referral system diagnosis, and treatment and follow-up is a special problem in neonatal care in relation to heart disease. Concentration of physicians, medical schools and cardiac centers in urban areas, old customs and poor understanding of people about the treatability and preventability of heart diseases in children complicate the improvement in the management of children with heart diseases.
    Matched MeSH terms: Continental Population Groups
  17. Antibodies to Sarcocystis in Malaysians
    Thomas V, Dissanaike AS
    Trans R Soc Trop Med Hyg, 1978;72(3):303-6.
    PMID: 97821
    Sera from 243 donors belonging to the four main ethnic groups in West Malaysia (Orang Asli, Malays, Chinese and Indians) were tested, using the indirect fluorescent antibody technique for the prevalence of antibodies to Sarcocystis. Almost 20% reacted positively at dilutions of 1:64 or higher and eight among the Orang Asli and Malays gave the highest titres of 1:256. Prevalence was highest in the Orang Asli and lowest in Chinese. 22 sera also reacted positively to Toxoplasma, whether due to polyparasitism or cross-reaction is, as yet, unknown.
    Matched MeSH terms: Continental Population Groups
  18. Fulltext Demographics characteristics and analysis of malocclusions of orthodontic patients seen at IIUM Dental Specialist Clinic, Kuantan, Pahang
    Ismail, K., Ghazali@Suhaimi, S.S., Abu Bakar, N., Mokhtar, K.I., Kharuddin, A.F.
    International Medical Journal Malaysia, 2017;16(2):107-111.
    MyJurnal
    Introduction: Malocclusion is one of the most common dental problems observed. Limited data is currently
    available regarding the demographics of malocclusion observed locally.

    Materials And Methods: This is a
    retrospective study where 770 patients were recruited from May 2009 till December 2014. 560 orthodontic
    study models that met the inclusion criteria were examined and the malocclusions were classified according
    to the British Standard Institute (BSI) incisor classification. Demographic pattern and their relationship were
    analysed by structural equation modelling using SPSS (version 23.0).

    Results: From 560 study models
    analysed, 72% were female. The age of the patients ranges from 7-12 years old (17.1%), 13-17 years old
    (55.9%) and >18 years old (27.0%). Majority of the patients were Malay followed by Chinese (5.7%), Indian
    (1.8%) and other races (1.8%) Treatments received were fixed appliances (FA) (60.0%), removable appliances
    (RA) (12.5%), functional appliances (FnA) (1.1%), combination of RA and FA (16.1%), combination of FnA and
    FA (2.1%) and consultation (8.2%). Types of malocclusions observed were Class I (25.7%), Class II/1(32.7%),
    Class II/2 (7.5%) and Class III (34.1%). There was significant association (p
    Matched MeSH terms: Continental Population Groups
  19. Fulltext Comparison of Knowledge, Attitude, and Practice among Communities Living in Hotspot and Non-Hotspot Areas of Dengue in Selangor, Malaysia
    Ghani NA, Shohaimi S, Hee AK, Chee HY, Emmanuel O, Alaba Ajibola LS
    Trop Med Infect Dis, 2019 Feb 15;4(1).
    PMID: 30781369 DOI: 10.3390/tropicalmed4010037
    BACKGROUND: Dengue has affected more than one-third of the world population and Malaysia has recorded an increase in the number of dengue cases since 2012. Selangor state recorded the highest number of dengue cases in Malaysia. Most of the dengue infections occur among people living in hotspot areas of dengue. This study aims to compare Knowledge, Attitude, and Practice among communities living in hotspot and non-hotspot dengue areas.

    METHOD: Communities living in 20 hotspot and 20 non-hotspot areas in Selangor were chosen in this study where 406 participants were randomly selected to answer questionnaires distributed at their housing areas. Total marks of each categories were compared using t-test.

    RESULT: Results show that there were significant mean differences in marks in Knowledge (p value: 0.003; 15.41 vs. 14.55) and Attitude (p value: < 0.001; 11.41 vs. 10.33), but not Practice (p value 0.101; 10.83 vs. 10.47) categories between communities of non-hotspot and hotspot areas. After considering two confounding variables which are education level and household income, different mean marks are found to be significant in Knowledge when education level acts as a covariate and Attitude when both act as covariates.

    CONCLUSION: Overall results show that people living in non-hotspot areas had better knowledge and attitude than people living in hotspot areas, but no difference was found in practice. This suggests that public health education should be done more frequently with people with a low education background and low household income, especially in hotspot areas to fight dengue outbreak and make dengue cases decrease effectively.

    Matched MeSH terms: Population Groups
  20. The Endurance and Contestations of Colonial Constructions of Race Among Malaysians and Singaporeans
    Reddy G, Gleibs IH
    Front Psychol, 2019;10:792.
    PMID: 31040805 DOI: 10.3389/fpsyg.2019.00792
    Psychological literature on race has discussed in depth how racial identities are dialogically constructed and context dependent. However, racial identity construction is often not compared across different socio-political contexts. By researching racial identity construction in three different multicultural countries, Malaysia, Singapore, and the United Kingdom, we examined how three racial identities, Chinese, Malay, and Indian, are constructed among Malaysians and Singaporeans in this qualitative study comprised of 10 focus group discussions (N = 39). We applied Dialogical Analysis to the data. This paper shows that both racial ingroups and outgroups constructed all three racial identities, with ingroups constructing their identities more heterogeneously compared to outgroups. Participants also engaged with colonial constructions of the three racial identities. The geographical locations, and therefore their perceptual contexts, of the participants differed. Yet, colonial constructions of race endured in contemporary identity construction and were contested in the group settings. We conclude that the socio-political context as understood by the context of colonialism and post-coloniality influenced their racial identity constructions. Participants, regardless of differences in geographical location, used similar colonial constructions of Malay, Chinese, and Indian identities to position themselves as well as Others in their group interactions. These findings show that there is value in conceptualising the context beyond that which individuals are immediately presented with, and that psychologists should consider the inclusion of cultural legacies of colonialism in their conceptualisation of the present context.
    Matched MeSH terms: Continental Population Groups
Related Terms
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links