MyMedR

Displaying publications 41 - 47 of 47 in total

Abstract:

Sort:

Fulltext Molecular characterisation of Haemoglobin Constant Spring and Haemoglobin Quong Sze with a Combine-Amplification Refractory Mutation System

Wee YC, Tan KL, Chua KH, George E, Tan JA

Malays J Med Sci, 2009 Jul;16(3):21-8.
PMID: 22589661 MyJurnal

BACKGROUND: The interaction of the non-deletional α(+)-thalassaemia mutations Haemoglobin Constant Spring and Haemoglobin Quong Sze with the Southeast Asian double α-globin gene deletion results in non-deletional Haemoglobin H disease. Accurate detection of non-deletional Haemoglobin H disease, which is associated with severe phenotypes, is necessary as these mutations have been confirmed in the Malaysian population.
METHODS: DNA from two families with Haemoglobin H disease was extracted from EDTA-anticoagulated whole blood and subjected to molecular analysis for α-thalassaemia. A duplex polymerase chain reaction was used to detect the Southeast Asian α-globin gene deletion. Polymerase chain reaction-restriction fragment length polymorphism analysis was then carried out to determine the presence of Haemoglobin Constant Spring and Haemoglobin Quong Sze. A combine-amplification refractory mutation system protocol was optimised and implemented for the rapid and specific molecular characterisation of Haemoglobin Constant Spring and Haemoglobin Quong Sze in a single polymerase chain reaction.
RESULTS AND CONCLUSIONS: The combine-amplification refractory mutation system for Haemoglobin Constant Spring and Haemoglobin Quong Sze, together with the duplex polymerase chain reaction, provides accurate pre- and postnatal diagnosis of non-deletional Haemoglobin H disease and allows detailed genotype analyses using minimal quantities of DNA.
KEYWORDS: Combine-ARMS; Hb Constant Spring; Hb Quong Sze; medical sciences
Fulltext Screening for intermediate and severe forms of thalassaemia in discarded red blood cells: optimization and feasibility

George E, Lai MI, Teh LK, Ramasamy R, Goh EH, Asokan K, et al.

Med J Malaysia, 2011 Dec;66(5):429-34.
PMID: 22390095 MyJurnal

Detection and quantification of Hb subtypes of human blood is integral to presumptive identification of thalassaemias. It has been used in neonatal screening of thalassaemia and Hb variants. The use of discarded red blood cells following processing of the cord blood for stem cells provides readily available diagnostic material for thalassaemia screening. In this study, we determined the range of Hb subtypes in 195 consecutive cord blood samples collected for cord blood banking. The 'cord blood samples' analysed were those of the remaining red blood cells after the cord blood was processed for stem cell storage. Quantification of Hb subtypes by high performance liquid chromatography (HPLC) was done on BioRad Variant II Hb testing system. Only 73 (36.5%) of the samples could be analyzed neat without dilution. With a 1:300 dilution with wash solution the acceptable area as recommended by the manufacturer for reading of a C-gram within the 1 to 3 million ranges were achieved in all. Eighteen (9%) 12 showed classical Hb Barts (y4) prerun peaks were confirmed by Sebia Hydrasys automated Hb gel electrophoresis and quantified by Sebia Capillarys 2 capillary electrophoresis. Only 1 (0.5%) was presumptively identified with HbH disease. Due to the limited number of samples no beta-thalassaemia major, Hb E beta-thalassaemia and Hb Barts hydrops fetalis were found. The HPLC assay was possible at a cost US$ 5 per sample and a turnover time of 10 samples per hour without technical difficulties. This study reports an effective and valuable protocol for thalassaemia screening in red blood cells which would otherwise be discarded during cord blood processing. Cord blood with severe and intermediate forms of thalassaemia can be preselected and not stored.
Alpha-thalassaemia in association with beta-thalassaemia patients in Malaysia: a study on the co-inheritance of both disorders

Wee YC, Tan KL, Kuldip K, Tai KS, George E, Tan PC, et al.

Community Genet, 2008;11(3):129-34.
PMID: 18376108 DOI: 10.1159/000113874

BACKGROUND/AIMS: Individuals with double heterozygosity for alpha- and beta-thalassaemia and heterozygous beta-thalassaemia show a similar haematological picture. Co-inheritance of alpha- and beta-thalassaemia in both partners may result in pregnancies with either Hb Bart's hydrops foetalis or beta-thalassaemia major, or pregnancies with both disorders.
METHODS: The co-inheritance of alpha-thalassaemia in 322 beta-thalassaemia carriers in Malaysia was studied.
RESULTS: The frequency of alpha-thalassaemia in the beta-thalassaemia carriers was 12.7% (41/322), with a carrier frequency of 7.8% for the SEA deletion, 3.7% for the -alpha(3.7) deletion, 0.9% for Hb Constant Spring and 0.3% for the -alpha(4.2) deletion.
CONCLUSION: Double heterozygosity for alpha- and beta-thalassaemia was confirmed in 5 out of the 41 couples and the risk of the fatal condition Hb Bart's hydrops foetalis was confirmed in two of these couples. Detection of the Southeast Asian (SEA) deletion in the Malaysian Malays in this study confirms that Hb Bart's hydrops foetalis can occur in this ethnic group. Results of this study have provided new information on the frequency and different types of alpha-thalassaemia (--(SEA), -alpha(3.7) and -alpha(4.2) deletions, Hb Constant Spring) in Malaysian beta-thalassaemia carriers.
Fulltext Analysis of α1 and α2 globin genes among patients with hemoglobin Adana in Malaysia

Lee TY, Lai MI, Ismail P, Ramachandran V, Tan JA, Teh LK, et al.

Genet. Mol. Res., 2016 Apr 07;15(2).
PMID: 27173219 DOI: 10.4238/gmr.15027400

Hemoglobin (Hb) Adana [HBA2: c179G>A (or HBA1); p.Gly60Asp] is a non-deletional α-thalassemia variant found in Malaysia. An improvement in the molecular techniques in recent years has made identification of Hb Adana much easier. For this study, a total of 26 Hb Adana α-thalassemia intermedia and 10 Hb Adana trait blood samples were collected from patients. Common deletional and non-deletional α-thalassemia genotypes were determined using multiplex gap polymerase chain reaction (PCR) and multiplex ARMS PCR techniques. Identification of the Hb Adana location on the α-globin gene was carried out using genomic sequencing and the location of the mutation was confirmed via restriction fragment length polymorphism-PCR. Among the 36 samples, 24 (66.7%) had the -α(3.7)/α(Cd59)α mutation, while the -α(3.7)/α(Cd59)α mutation accounted for 2 samples (5.6%) and the remaining 10 (27.8%) samples were α/α(Cd59)α. All 36 samples were found to have the Hb Adana mutation on the α2-globin gene. The position of the α-globin gene mutation found in our cases was similar to that reported in Indonesia (16%) but not to that in Turkey (0.6%). Our results showed that the Hb Adana mutation was preferentially present in the α2-globin genes in Malays compared to the other ethnicities in Malaysia. Thus, the Malays might have similar ancestry based on the similarities in the Hb Adana position.
Visual System Homeobox 1 (VSX1) Gene Analysis in Keratoconus: Design of Specific Primers and DNA Amplification Protocols for Accurate Molecular Characterization

Ng JB, Poh RY, Lee KR, Subrayan V, Deva JP, Lau AY, et al.

Clin. Lab., 2016 Sep 01;62(9):1731-1737.
PMID: 28164597 DOI: 10.7754/Clin.Lab.2016.160144

BACKGROUND: Keratoconus is an ocular degeneration characterized by the thinning of corneal stroma that may lead to varying degrees of myopia and visual impairment. Genetic factors have been reported in the pathology of keratoconus where Asians have a higher incidence, earlier onset, and undergo earlier corneal grafts compared to Caucasians. The visual system homeobox 1 (VSX1) gene forms part of a paired-like homeodomain transcription factor which is responsible for ocular development. The gene was marked as a candidate in genetic studies of keratoconus in various populations. Single nucleotide polymorphisms (SNPs) in the VSX1 gene have been reported to be associated with keratoconus. The detection of the SNPs involves DNA amplification of the VSX1 gene followed by genomic sequencing. Thus, the objective of this study aims to establish sensitive and accurate screening protocols for the molecular characterization of VSX1 polymorphisms.
METHODS: Keratoconic (n = 74) and control subjects (n = 96) were recruited based on clinical diagnostic tests and selection criteria. DNA extracted from the blood samples was used to genotype VSX1 polymorphisms. In-house designed primers and optimization of PCR conditions were carried out to amplify exons 1 and 3 of the VSX1 gene. PCR conditions including percentage GC content, melting temperatures, and differences in melting temperatures of primers were evaluated to produce sensitive and specific DNA amplifications.
RESULTS: Genotyping was successfully carried out in 4 exons of the VSX1 gene. Primer annealing temperatures were observed to be crucial in enhancing PCR sensitivity and specificity. Annealing temperatures were carefully evaluated to produce increased specificity, yet not allowing sensitivity to be compromised. In addition, exon 1 of the VSX1 gene was amplified using 2 different sets of primers to produce 2 smaller amplified products with absence of non-specific bands. DNA amplification of exons 1 and 3 consistently showed single band products which were successfully sequenced to yield reproducible data.
CONCLUSIONS: The use of in-house designed primers and optimized PCR conditions allowed sensitive and specific DNA amplifications that produced distinct single bands. The in-house designed primers and DNA amplification protocols established in this study provide an addition to the current repertoire of primers for accurate molecular characterization of VSX1 gene polymorphisms in keratoconus research.
Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations

Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.

Public Health Genomics, 2015;18(1):60-4.
PMID: 25412720 DOI: 10.1159/000368342

BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
Fulltext Assessment of Risk and Sero-Prevalence of Helicobacter pylori Colonization among Remote Orang Asli Tribes in Peninsula Malaysia

Thevakumar K, Chandren JR, Perez-Perez GI, Chua EG, Teh LK, Salleh MZ, et al.

PLoS One, 2016;11(7):e0159830.
PMID: 27441568 DOI: 10.1371/journal.pone.0159830

The epidemiology of Helicobacter pylori (H. pylori) infection is related to human poverty with marked differences between developing and developed countries. Socioeconomic factors and living standards are the main determinants of the age-dependent acquisition rate of H. pylori, and consequently its prevalence. The aim of this study was to assess the risk and sero-prevalence of H. pylori colonization among Orang Asli in Peninsula Malaysia. This cross-sectional study was conducted on Orang Asli subjects in seven isolated settlements spanning across all three major tribes (Negrito, Proto Malay and Senoi) in Malaysia. Socio-demographic characteristics of the subjects were obtained through interview. Subjects were tested for H. pylori colonization based on CagA and whole cell (WC) antigen serological assays. A total of 275 subjects participated in this study. Among these subjects, 115 (44.7%) were H. pylori sero-positive with highest sero-prevalence among Negrito (65.7%). Among subjects who were H. pylori sero-positive, CagA sero positivity was also significantly higher among Negrito. The highest proportion of respondents reported to be H. pylori sero-positive was from age group 30 years old and below (57.9%), males (56.2%), Negrito (48.6%) and live in bamboo house (92.3%). The highest proportion of respondents reported to be CagA sero-positive was from age group 30 years old and below (41.4%), males (35.6%) and Negrito (48.6%). The results of this study demonstrate that H. pylori colonization can be related to age, gender, tribes and house materials and CagA sero-positive stain closely associated with age, gender and tribes.