Displaying publications 61 - 80 of 264 in total

Abstract:
Sort:
  1. Sthaneshwar P, Shanmugam H, Arumugam S
    Pathology, 2014 Apr;46(3):263-5.
    PMID: 24614705 DOI: 10.1097/PAT.0000000000000090
    Matched MeSH terms: Hemoglobins, Abnormal/analysis*; Hemoglobins, Abnormal/genetics
  2. Prasad KN, Chew LY, Khoo HE, Kong KW, Azlan A, Ismail A
    PMID: 20936182 DOI: 10.1155/2010/871379
    Antioxidant capacities of ethylacetate, butanol, and water fractions of peel, pulp, and seeds of Canarium odontophyllum Miq. (CO) were determined using various in vitro antioxidant models. Ethylacetate fraction of peel (EAFPE) exhibited the highest total phenolic (TPC), total flavonoid content (TFC), and antioxidant activities compared to pulp, seeds, and other solvent fractions. Antioxidant capacities were assayed by total antioxidant capability, 1,1-diphenyl-2-picryl hydrazyl (DPPH) radical activity, ferric reducing antioxidant power (FRAP), and hemoglobin oxidation assay. Total phenolic content of ethylacetate fractions was positively correlated with the antioxidant activity. This is the first report on the antioxidant activities from CO fruit fractions. Thus, EAFPE can be used potentially as a readily accessible source of natural antioxidants and as a possible pharmaceutical supplement.
    Matched MeSH terms: Hemoglobins/metabolism; Hemoglobins/chemistry
  3. Eng LL, Lopez CG, Eapen JS, Eravelly J, Wiltshire BG, Lehmann H
    J Med Genet, 1972 Sep;9(3):340-3.
    PMID: 5079107 DOI: 10.1136/jmg.9.3.340
    Matched MeSH terms: Hemoglobins/analysis; Hemoglobins, Abnormal/analysis*
  4. George-Kodiseri E, Faridah K, Mariam S
    Family Physician, 1989;1:31-33.
    Anaemia is present in 31.3% of male and 73.6% of female subjects heterogenous for beta thalassaemia. In males, none had serum ferritin (SF) levels less than 10 ng/ml. In contrast, female subjects with haemoglobins less than 12 gm/dl, had SF levels less than 20 ng/ml. Statistical differences in the Hb, RBC, MCV, MCH, MCHC abd HBA were found with the normal groups (p<0.001). Comparison of the SF levels in both the males and females show no difference from those in the normal groups (p<0.10). Iron loading was not a significant feature in both the males and females. Correlation of the SF with age shows a weak negative correlation. Married females with children showed that the SF levels fell significantly with increasing age, suggesting the possibility that repeated pregnancies may deplete iron stores as reflected by the SF levels. In countries where iron deficiency and thalassaemia are highly prevalent, assays of serum ferittin will indicate if there is a need for supplemental iron in subjects hetergenous for beta thalassaemia.
    Matched MeSH terms: Hemoglobins
  5. Wee, S.Y., Hafiza, A., Azma, R.Z., Azlin, I., Norunaluwar, J., Malisa, M.Y., et al.
    Medicine & Health, 2020;15(1):106-118.
    MyJurnal
    Hemoglobin S (HbS, α2β26GluVal) merupakan variasi hemoglobin yang terbentuk hasil daripada mutasi GAG GTG pada kodon 6 gen β-globin. Hemoglobinopati haemoglobin S (HbS) jarang ditemui di kalangan penduduk Malaysia tetapi selalunya dijumpai di kalangan pendatang asing dari Afrika. Walau bagaimanapun beberapa kes didapati dalam kaum India dan Melayu. Kajian ini meninjau keputusan makmal pesakit HbS dan penggunaan “multiplex ligation-dependent probe amplification” (MLPA) dan “flow-through hybridization” (FTH) dalam mengesan mutasi HbS. HbS dikenalpasti melalui kromatografi cecair prestasi tinggi (HPLC) dan/atau elektroforesis kapilari serta elektroforesis hemoglobin. Analisis molekul dijalankan menggunakan kaedah MLPA, FTH dan penjujukan Sanger. Dua warga Afrika, tiga Melayu dan dua India berusia antara 2-31 tahun telah dikenalpasti. Lima pesakit adalah HbS homozigot, seorang kompaun heterozigot HbS/β-talasemia dan seorang lagi pembawa HbS. Tahap hemoglobin (Hb) kes HbS homozigot adalah antara 7.4-10.2 g/dL dengan aras HbS dan HbF diantara 58.3-94.7% dan 1.5-35.5%. Hb untuk kes kompaun heterozigot HbS/β-talasemia adalah 5.8 g/dL dan normal pada pembawa HbS. Aras HbS, HbF dan HbA2 untuk HbS/β-talasemia dan pembawa HbS adalah 67%, 27.2% dan 4.2%, dan 38.6%, 0.1% and 2.8% setiap satu. Kedua-dua kaedah MLPA dan FTH berjaya mengesan mutasi HbS dalam semua kes, manakala cuma FTH dapat menentukan zygositi mutasi HbS dan β-talasemia dalam satu ujian yang sama.
    Matched MeSH terms: Hemoglobins
  6. Aisyah, H.M.R., Syed Zulkifli, S.Z., Noor Khatijah, N.
    MyJurnal
    OBJECTIVE: To assess a better strategy to implement oral iron supplementation in preschool Orang Asli children with high prevalence of iron deficiency, as opposed to the current practice, yet inefficient, of daily oral iron supplementation regime.
    METHODS: A randomized controlled trial was conducted in preschool children presenting to a remote health center (Klinik Desa Kenang, Sungai Siput, Perak) with iron deficiency state. Oral iron prescribed as a daily unsupervised dose (group A) was compared to a weekly supervised administration (group B) over eight weeks.
    RESULTS: Before intervention, iron deficiency was prevalent in these children (91.2%). The mean baseline haemoglobin and ferritin levels of group A were 9.9 (+/- 1.1) g/dL and 8.9 (+/- 1.3) mg/L respectively, and that of group B were 9.9 (+/-1.2) g/dL and 9.7 (+/- 1.9) mg/L respectively. After eight weeks of treatment, the mean rise in haemoglobin and ferritin levels of group A were 1.2 (+/- 0.6) g/dL and 18.1 (+/- 15.1) mg/ L respectively, as compared to group B, where the mean rise in haemoglobin and ferritin levels were 1.8 (+/- 0.7) g/dL and 35.2 (+/- 21.8) mg/ L respectively. The differences in the rise of haemoglobin and ferritin levels of the two groups were statistically significant (p<0.025). Both regimes were however effective in improving the iron status in a short term (88% in group A and 100% in group B), but group B had a better iron improvement (35.2 +/- 21.8 versus 18.1 +/-15.1 mg/L).
    CONCLUSION: It was concluded that the supervised weekly oral iron supplementation regime was more effective than the unsupervised daily supplementation for treating iron deficiency in preschool Orang Asli children. Since iron deficiency is so common in these children and in view of the possibility of poor compliance with the unsupervised regime, an intermittent supervised treatment is proposed as the most effective strategy to address this nutritional problem.
    Matched MeSH terms: Hemoglobins
  7. Houssein, Hend Abubaker, Mohamad Suhaimi Jaafar, Zalila Ali, Al Timimi, Zahra, Mustafa, Farhad, Ismail, Asaad
    MyJurnal
    The effect of low power 0.95 mW He-Ne laser irradiation (? = 632.8 nm) on the subpopulations of human blood parameters such as hemoglobin concentration (HGB), mean cellular volume of red blood cell (MCV), and mean cellular hemoglobin (MCH) were investigated by electronic sizing at the Wellness Centre of Universiti Sains Malaysia (USM). These parameters were correlated with human characteristics such as age, gender, ethnic, and blood types. The correlations were obtained by finding patterns in changes of blood parameters after radiation, non-parametric tests using SPSS version 11.5, centroid and peak positions, and flux variations. The analysis revealed significant changes according to human characteristics, for age (p = 0.067), gender (p = 0.044), ethnic (p = 0.094), and blood types (p = 0.099). This finding shows that the centroid and peak positions, flux peak and total flux, were highly correlated with human characteristics and can become a significant indicator for blood analysis. Furthermore, the encircled flux analysis demonstrated a good future prospect in blood research, thus leading the way as a vibrant diagnosis tool to clarify diseases associated with blood.
    Matched MeSH terms: Hemoglobins
  8. Aris N, Abdul Rahman S, Shahidan N
    Sains Malaysiana, 2009;38(6):953–958.
    The prevalence of anaemia and nutritional status was evaluated among 88 Malay elderly (20 men and 68 women) aged 60 to 85 years (mean age 69.8 ± 6.0 years) from four villages in Rembau district, Negeri Sembilan. In addition, the relationship between hemoglobin with nutrient intake, cognitive and functional status of the elderly were also investigated. Subjects were interviewed to obtain information on demographic and nutrient intake. Cognitive status was assessed using Elderly Cognitive Assessment Questionnaire (ECAQ) while functional status was measured using Instrumental Activity Daily Living (IADL) and hand grip measurement. Hemoglobin level was determined using HemoCue method. The findings indicated that the prevalence of anaemia was 22.7%. Prevalence of anaemia for male subject was 30.0% with mean of hemoglobin as 11.7 ± 1.0 g/dL while 20.6% of female subject was anaemic with mean of hemoglobin was 11.2 ± 0.5 g/dL. As much as 21.6% of the subjects have cognitive impairment with the prevalence is high in old-old age group (57.9%) compared to the young-old age group (11.6%). Results from functional assessment showed that mean for IADL score as 11 ± 3. The IADL score was lower in old-old age group (9 ± 4) compared to the young-old age group (12 ± 2). For hand grip measurement, overall mean was 16.8 ± 8.7 kg (14.2 ± 8.4 kg for old-old age group and 17.6 ± 8.7 kg for young-old age group). Nutrient analysis showed that the mean calorie intake for men (1310 ± 448 kcal/day) and women (1180 ± 300 kcal) were lower than the RNI. However, only intakes of iron, niacin and vitamin A achieved the Malaysian Recommended Nutrient Intake (RNI). Correlation between hemoglobin and nutrients was only showed with calorie intake (r=0.486, p=0.048) and not with other nutrients. Besides that, there was no correlation between hemoglobin with ECAQ and IADL scores but hemoglobin was correlated with hand grip strength (r=0.265, p=0.013). As a conclusion, 22.7% case of anaemia was reported in this study. However, correlations were only formed between hemoglobin with calorie intake and hemoglobin with hand grip. Anaemia in elderly increases the inability of the elderly to live independently.
    Keywords: Anemia; cognitive status; elderly; functional status
    Matched MeSH terms: Hemoglobins
  9. Hasan MI, Noordin SS, Hami R, Ishak N, Achuthan A
    Blood Transfus, 2022 Nov;20(6):446-453.
    PMID: 35848625 DOI: 10.2450/2022.0018-22
    BACKGROUND: Low hemoglobin level is a common cause of donor deferral and results in a huge loss of the donor pool. This study aimed to evaluate the effectiveness of a mobile application as an educational tool to enhance donor return and improve hemoglobin levels after deferral.

    MATERIALS AND METHODS: This was an interventional study involving 382 blood donors who were deferred for low hemoglobin. The donors were divided equally into two groups: a control group and the intervention group. The control group received standard management for low hemoglobin deferral, which includes a short counseling session and a 1-month course of oral iron therapy. The intervention group used a mobile application in addition to standard management. The primary endpoint was the number of blood donors who returned during the 7 months of follow-up. The secondary endpoints were the hemoglobin increment at the first visit after the donors' deferral.

    RESULTS: The return rate was higher in the intervention group, with 81.2% of the donors returning in the 7 months of follow-up compared to 66% of the control group (p<0.001). Male and female donors had mean hemoglobin increments of 1.0 g/dL and 0.7 g/dL, respectively, in the intervention group, compared to decrements of 0.2 g/dL and 0.4 g/dL, respectively, in the control group (p<0.001). Multivariable analysis showed a significant association between intervention method, education level and donation status on donor return (p=0.015, p<0.001, and p<0.001, respectively).

    DISCUSSION: Higher return rate and greater hemoglobin increase in the interventional group could be attributed to features in the mobile application. Repeat donors had the highest odds of returning to donate, followed by those with a tertiary level of education, and those given the mobile application. This study showed that a mobile application was effective in enhancing donor return and increasing hemoglobin level among deferred blood donors on their first return.

    Matched MeSH terms: Hemoglobins
  10. GBD 2021 Anaemia Collaborators
    Lancet Haematol, 2023 Sep;10(9):e713-e734.
    PMID: 37536353 DOI: 10.1016/S2352-3026(23)00160-6
    BACKGROUND: Anaemia is a major health problem worldwide. Global estimates of anaemia burden are crucial for developing appropriate interventions to meet current international targets for disease mitigation. We describe the prevalence, years lived with disability, and trends of anaemia and its underlying causes in 204 countries and territories.

    METHODS: We estimated population-level distributions of haemoglobin concentration by age and sex for each location from 1990 to 2021. We then calculated anaemia burden by severity and associated years lived with disability (YLDs). With data on prevalence of the causes of anaemia and associated cause-specific shifts in haemoglobin concentrations, we modelled the proportion of anaemia attributed to 37 underlying causes for all locations, years, and demographics in the Global Burden of Disease Study 2021.

    FINDINGS: In 2021, the global prevalence of anaemia across all ages was 24·3% (95% uncertainty interval [UI] 23·9-24·7), corresponding to 1·92 billion (1·89-1·95) prevalent cases, compared with a prevalence of 28·2% (27·8-28·5) and 1·50 billion (1·48-1·52) prevalent cases in 1990. Large variations were observed in anaemia burden by age, sex, and geography, with children younger than 5 years, women, and countries in sub-Saharan Africa and south Asia being particularly affected. Anaemia caused 52·0 million (35·1-75·1) YLDs in 2021, and the YLD rate due to anaemia declined with increasing Socio-demographic Index. The most common causes of anaemia YLDs in 2021 were dietary iron deficiency (cause-specific anaemia YLD rate per 100 000 population: 422·4 [95% UI 286·1-612·9]), haemoglobinopathies and haemolytic anaemias (89·0 [58·2-123·7]), and other neglected tropical diseases (36·3 [24·4-52·8]), collectively accounting for 84·7% (84·1-85·2) of anaemia YLDs.

    INTERPRETATION: Anaemia remains a substantial global health challenge, with persistent disparities according to age, sex, and geography. Estimates of cause-specific anaemia burden can be used to design locally relevant health interventions aimed at improving anaemia management and prevention.

    FUNDING: Bill & Melinda Gates Foundation.

    Matched MeSH terms: Hemoglobins
  11. Alauddin H, Mohamad Nasir S, Ahadon M, Raja Sabudin RZ, Ithnin A, Hussin NH, et al.
    Malays J Pathol, 2015 Dec;37(3):287-92.
    PMID: 26712677
    Haemoglobin (Hb) Lepore is a variant Hb consisting of two α-globin and two δβ-globin chains. In a heterozygote, it is associated with clinical findings of thalassaemia minor, but interactions with other haemoglobinopathies can lead to various clinical phenotypes and pose diagnostic challenges. We reported a pair of siblings from a Malay family, who presented with pallor and hepatosplenomegaly at the ages of 21 months and 14 months old. The red cell indices and peripheral blood smears of both patients showed features of thalassaemia intermedia. Other laboratory investigations of the patients showed conflicting results. However, laboratory investigation results of the parents had led to a presumptive diagnosis of compound heterozygote Hb Lepore/β-thalassaemia and co-inheritance α+-thalassaemia (-α3.7). Hb Lepore has rarely been detected in Southeast Asian countries, particularly in Malaysia. These two cases highlight the importance of family studies for accurate diagnosis, hence appropriate clinical management and genetic counseling.
    Matched MeSH terms: Hemoglobins, Abnormal/genetics*
  12. Zainal NZ, Alauddin H, Ahmad S, Hussin NH
    Malays J Pathol, 2014 Dec;36(3):207-11.
    PMID: 25500521
    Thalassaemia carriers are common in the Asian region including Malaysia. Asymptomatic patients can be undiagnosed until they present for their antenatal visits. Devastating obstetric outcome may further complicate the pregnancy if both parents are thalassaemia carriers leading to hydrophic fetus due to haemoglobin Bart's disease. However in certain cases where unexplained hydrops fetalis occur in parents with heterozygous thalassaemia carrier,mutated α genes should be suspected. We report a twenty-nine year old woman in her third pregnancy with two previous pregnancies complicated by early neonatal death at 21 and 28 weeks of gestation due to hydrops fetalis. DNA analysis revealed the patient to have heterozygous (--SEA) α-gene deletion, while her husband has a compound heterozygosity for α(3.7) deletion and codon 59 (GGC → GAC) mutation of the α-gene. This mutation, also known as hemoglobin Adana, can explain hydrops fetalis resulting from two alpha gene deletions from the patient (mother) and a single alpha gene deletion with mutation from the father. The third pregnancy resulted in a grossly normal baby boy with 3 α-gene deletions (HbH disease). We postulate that, in view of heterogenisity of the α-thalassaemia in this patient with severely unstable haemoglobin Adana chains from her husband, there will be a 25% possibility of fetal hydrops in every pregnancy.
    Matched MeSH terms: Hemoglobins, Abnormal/genetics*
  13. Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
    Matched MeSH terms: Hemoglobins, Abnormal/analysis
  14. Alauddin H, Jaapar NA, Azma RZ, Ithnin A, Razak NF, Loh CK, et al.
    Hemoglobin, 2014;38(4):277-81.
    PMID: 24829075 DOI: 10.3109/03630269.2014.916720
    Hb Adana [HBA2: c179G>A (or HBA1); p.Gly60Asp] is a rare hemoglobin (Hb) variant due to a mutation at codon 59 of the α2- or α1-globin gene resulting in a glycine to aspartic acid substitution. Two siblings with a unique coinheritance of Hb Adana and Hb Constant Spring (Hb CS, α142, Term→Gln, TAA>CAA; HBA2: c.427 T>C) (α(codon 59)α/α(CS)α), were compared phenotypically with another two siblings carrying the Hb Adana mutation and a 3.7 kb deletion (α(codon 59)α/-α(3.7)). Although they all had α-thalassemia intermedia (α-TI), the former were clinically more severe than the latter. The first pair of siblings presented at a much younger age than the second pair and showed lower Hb levels and significant extramedullay hemopoiesis. Another case of a hydropic fetus as a result of Hb H/Hb Adana is also described. Their clinical phenotypes and hematological parameters are all presented for comparison.
    Matched MeSH terms: Hemoglobins, Abnormal/genetics*
  15. Paydar M, Wong YL, Wong WF, Hamdi OA, Kadir NA, Looi CY
    J Food Sci, 2013 Dec;78(12):T1940-7.
    PMID: 24279333 DOI: 10.1111/1750-3841.12313
    Edible bird nests (EBNs) are important ethnomedicinal commodity in the Chinese community. Recently, But and others showed that the white EBNs could turn red by vapors from sodium nitrite (NaNO2) in acidic condition or from bird soil, but this color-changing agent remained elusive. The aim of this study was to determine the prevalence of nitrite and nitrate contents and its affects on EBN's color. EBNs were collected from swiftlet houses or caves in Southeast Asia. White EBNs were exposed to vapor from NaNO2 in 2% HCl, or bird soil. The levels of nitrite (NO2-) and nitrate (NO3-) in EBNs were determined through ion chromatography analysis. Vapors from NaNO2 in 2% HCl or bird soil stained white bird nests to brown/red colors, which correlated with increase nitrite and nitrate levels. Moreover, naturally formed cave-EBNs (darker in color) also contained higher nitrite and nitrate levels compared to white house-EBNs, suggesting a relationship between nitrite and nitrate with EBN's color. Of note, we detected no presence of hemoglobin in red "blood" nest. Using infrared spectra analysis, we demonstrated that red/brown cave-EBNs contained higher intensities of C-N and N-O bonds compared to white house-EBNs. Together, our study suggested that the color of EBNs was associated with the prevalence of the nitrite and nitrate contents.
    Matched MeSH terms: Hemoglobins/analysis
  16. Tan ACC, Leong EWK, Chua AC, Moy FM
    BMC Res Notes, 2013;6:173.
    PMID: 23634656 DOI: 10.1186/1756-0500-6-173
    BACKGROUND: Variations in racial haemoglobin had been previously described in multiple studies locally and abroad. This study was conducted to quantify the differences in haemoglobin of booking primigravidae amongst the three major races in Malaysia at the antenatal clinic of University Malaya Medical Centre, Kuala Lumpur.
    FINDINGS: One year prospective study of booking full blood count sample of primigravidae taken in one centre was conducted. Multiple comparative analyses of the booking haemoglobin were performed using the One-way ANOVA comparative mean test in each trimester. 622 primigravidae without any known history of haematological disorders were recruited into the study. The mean haemoglobin for the Indian race was the lowest compared to the two other races in the second and the third trimesters, and it was found to be statistically significant lower (p- value 0.001) than the Malay race in the second trimester. It was also found that the Indian race had a significantly higher incidence of moderate to severe anaemia (p- value: 0.029). The prevalence of anaemia in our study population is also significantly higher in the Indian population (p- value: 0.01 ).
    CONCLUSIONS: The findings from this study have established that there is racial preponderance to anaemia in pregnancy. The Indian race is at a higher risk of having anaemia in pregnancy particularly in the second trimester.
    Study site: Antenatal clinic, University Malaya Medical Centre (UMMC), Kuala Lumpur, Malaysia
    Matched MeSH terms: Hemoglobins/metabolism*
  17. Teh AH, Saito JA, Baharuddin A, Tuckerman JR, Newhouse JS, Kanbe M, et al.
    FEBS Lett., 2011 Oct 20;585(20):3250-8.
    PMID: 21925500 DOI: 10.1016/j.febslet.2011.09.002
    Hell's Gate globin I (HGbI), a heme-containing protein structurally homologous to mammalian neuroglobins, has been identified from an acidophilic and thermophilic obligate methanotroph, Methylacidiphilum infernorum. HGbI has very high affinity for O(2) and shows barely detectable autoxidation in the pH range of 5.2-8.6 and temperature range of 25-50°C. Examination of the heme pocket by X-ray crystallography and molecular dynamics showed that conformational movements of Tyr29(B10) and Gln50(E7), as well as structural flexibility of the GH loop and H-helix, may play a role in modulating its ligand binding behavior. Bacterial HGbI's unique resistance to the sort of extreme acidity that would extract heme from any other hemoglobin makes it an ideal candidate for comparative structure-function studies of the expanding globin superfamily.
    Matched MeSH terms: Hemoglobins/chemistry*
  18. Tan PC, Chai JN, Ling LP, Omar SZ
    Clin Exp Obstet Gynecol, 2011;38(2):150-4.
    PMID: 21793277
    OBJECTIVE: To evaluate maternal hemoglobin levels and red cell indices as predictive factors for gestational diabetes (GDM).

    METHOD: Data from 1,538 women were analyzed. At the first visit for prenatal care, the 50-gram glucose challenge test was followed by the 75-gram glucose tolerance test in those who screened positive. GDM was diagnosed based on the WHO (1999) criteria. Maternal complete blood count was obtained at the first visit, hospitalization for birth, and after birth. Receiver operator characteristic curves were generated to establish thresholds. Multivariable logistic regression analyses were performed to establish independent predictors of GDM.

    RESULTS: GDM was diagnosed in 182/1,538 (11.8%). GDM was associated with hemoglobin level, hematocrit and erythrocyte count at the first visit for prenatal care only. Hemoglobin threshold at the first visit was established at 11.5 g/dl. After adjustment, high hemoglobin [AOR 1.5 (95% CI 1.0-2.1); p = 0.027] remained predictive of GDM.

    CONCLUSIONS: High maternal hemoglobin level at the first prenatal visit is independently predictive of GDM.

    Matched MeSH terms: Hemoglobins/analysis*
  19. Kumar A
    Asian Pac J Trop Biomed, 2011 Jan;1(1):6-7.
    PMID: 23569715 DOI: 10.1016/S2221-1691(11)60058-0
    To investigate oxidative stress, hemoglobin percentage and erythrocyte osmotic fragility in various aging groups.
    Matched MeSH terms: Hemoglobins/analysis
  20. Soosean C, Marimuthu K, Sudhakaran S, Xavier R
    Eur Rev Med Pharmacol Sci, 2010 Jul;14(7):605-11.
    PMID: 20707250
    The efficacy of dietary inclusion of various parts of mangosteen (Garcinia mangostana L.) extract on growth and hematological parameters of African catfish (Clarias gariepinus) fingerlings were investigated.
    Matched MeSH terms: Hemoglobins/metabolism
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links