MyMedR

Displaying all 4 publications

Abstract:

Sort:

Fulltext Non-invasive prenatal diagnosis using fetal DNA in maternal plasma: a preliminary study for identification of paternally-inherited alleles using single nucleotide polymorphisms

Chen JJ, Tan JA, Chua KH, Tan PC, George E

BMJ Open, 2015 Jul 22;5(7):e007648.
PMID: 26201722 DOI: 10.1136/bmjopen-2015-007648

OBJECTIVES: Single nucleotide polymorphism (SNP) with a mutation can be used to identify the presence of the paternally-inherited wild-type or mutant allele as result of the inheritance of either allele in the fetus and allows the prediction of the fetal genotype. This study aims to identify paternal SNPs located at the flanking regions upstream or downstream from the β-globin gene mutations at CD41/42 (HBB:c.127_130delCTTT), IVS1-5 (HBB:c.92+5G>C) and IVS2-654 (HBB:c.316-197C>T) using free-circulating fetal DNA.
SETTING: Haematology Lab, Department of Biomedical Science, University of Malaya.
PARTICIPANTS: Eight couples characterised as β-thalassaemia carriers where both partners posed the same β-globin gene mutations at CD41/42, IVS1-5 and IVS2-654, were recruited in this study.
OUTCOME MEASURES: Genotyping was performed by allele specific-PCR and the locations of SNPs were identified after sequencing alignment.
RESULTS: Genotype analysis revealed that at least one paternal SNP was present for each of the couples. Amplification on free-circulating DNA revealed that the paternal mutant allele of SNP was present in three fcDNA. Thus, the fetuses may be β-thalassaemia carriers or β-thalassaemia major. Paternal wild-type alleles of SNP were present in the remaining five fcDNA samples, thus indicating that the fetal genotypes would not be homozygous mutants.
CONCLUSIONS: This preliminary research demonstrates that paternal allele of SNP can be used as a non-invasive prenatal diagnosis approach for at-risk couples to determine the β-thalassaemia status of the fetus.
Research Progress on the Antitumor Molecular Mechanism of Ginsenoside Rh2

Yang L, Chen JJ, Sheng-Xian Teo B, Zhang J, Jiang M

Am J Chin Med, 2024 Jan 31.
PMID: 38291582 DOI: 10.1142/S0192415X24500095

Cancer has evolved into a substantial public health concern as the second-leading cause of mortality globally. Radiotherapy and chemotherapy have been the two most widely used cancer therapies in recent years; however, both have drawbacks. Therefore, the focus has shifted to the creation of herbal medicines, the extraction of active ingredients, replacement therapy, and the adverse effects of these medications. Ginsenoside Rh2, which is extracted from ginseng, has been identified in many cancer cells. The immune system of the body is strengthened by ginsenoside Rh2, which can also cause the proliferation, death, and differentiation of tumor cells through various pathways. For instance, it inhibits the expression of the NF-[Formula: see text]B signaling pathway and induces cell apoptosis, affects the expression levels of mitochondrial apoptosis proteins Bcl-2 and Bax, and cooperates with the PD-1 blockade to reactivate T cells to promote an antitumor immune response. Furthermore, ginsenosides Rh2 has the effect of reversing the toxic effect of chemotherapy drugs on normal cells, reducing myocardial damage, and relieving bone marrow function suppression. For clinical applications, it is mainly used as an adjuvant drug for preoperative neoadjuvant chemotherapy, postoperative adjuvant chemotherapy, and rescue treatment of advanced cancer. This paper summarizes the pharmacological action and mechanism of ginsenosides Rh2 in all kinds of cancer and looks forward to its future development and application.
Yishen Tongluo formula alleviates diabetic kidney disease through regulating Sirt6/TGF-β1/Smad2/3 pathway and promoting degradation of TGF-β1

Zhang X, Zhao L, Xiang S, Sun Y, Wang P, Chen JJ, et al.

J Ethnopharmacol, 2023 May 10;307:116243.
PMID: 36791927 DOI: 10.1016/j.jep.2023.116243

ETHNOPHARMACOLOGICAL RELEVANCE: Yishen Tongluo formula (YSTLF) is formulated based on traditional Chinese medicine theory for the treatment of Diabetic kidney disease (DKD) and has been shown to be effective in improving the symptoms of DKD according to the clinical observation.
AIM OF THE STUDY: To explore the effect of YSTLF on DKD and figure out whether its effects were due to the regulation Sirt6/TGF-β1/Smad2/3 pathway and promoting degradation of TGF-β1.
MATERIALS AND METHODS: The extract of YSTLF at 1, 2.5 and 5 g/kg was orally administered to C57BLKS/J (db/db) mice for 8 weeks and db/db mice were given valsartan as a positive control. The littermate db/m and db/db mice were given vehicle as the control and model group, respectively. Blood urea nitrogen and serum creatinine were detected and the urinary albumin excretion, urea albumin creatinine ratio was calculated. The histopathological change of renal tissues in each group was determined. Simultaneously, the levels of fibrosis-related proteins and messenger RNA (mRNA) in kidney and high glucose (HG)-induced SV40-MES-13 cells were detected. The roles of YSTLF in regulating of Sirt6/TGF-β1/Smad2/3 signaling pathway were investigated in HG-stimulated SV40-MES-13 cells and validated in db/db mice. Furthermore, the effect of YSTLF on TGF-β1 degradation was investigated in HG-stimulated SV40-MES-13 cells.
RESULTS: YSTLF significantly improved the renal function in DKD mice. YSTLF dose-dependently attenuated pathological changes and suppressed the expression of type I collagen, alpha smooth muscle actin, type IV collagen, and fibronectin in vitro and in vivo, resulting in ameliorating of renal fibrosis. YSTLF positively regulated Sirt6 expression, while inhibited the activating of TGF-β1/Smad2/3 signaling pathway. TGF-β1 was steady expressed in HG-stimulated SV40-MES-13 cells, whereas was continuously degraded under YSTLF treatment.
CONCLUSIONS: YSTLF significantly ameliorates renal damages and fibrosis may via regulating Sirt6/TGF-β1/Smad2/3 signaling pathway as well as promoting the degradation of TGF-β1.
Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations

Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.

Public Health Genomics, 2015;18(1):60-4.
PMID: 25412720 DOI: 10.1159/000368342

BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.