MyMedR

Displaying all 5 publications

Abstract:

Sort:

Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations

Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.

Public Health Genomics, 2015;18(1):60-4.
PMID: 25412720 DOI: 10.1159/000368342

BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
2015 golden helix symposium - next generation pharmacogenomics. March 11-13, 2015, kuala lumpur, malaysia: abstracts

Public Health Genomics, 2015;18 Suppl 1:1-51.
PMID: 25823950 DOI: 10.1159/000381430
Southeast Asian Pharmacogenomics Research Network (SEAPharm): Current Status and Perspectives

Chumnumwat S, Lu ZH, Sukasem C, Winther MD, Capule FR, Abdul Hamid AAAT, et al.

Public Health Genomics, 2019;22(3-4):132-139.
PMID: 31587001 DOI: 10.1159/000502916

Pharmacogenomics (PGx) is increasingly being recognized as a potential tool for improving the efficacy and safety of drug therapy. Therefore, several efforts have been undertaken globally to facilitate the implementation process of PGx into routine clinical practice. Part of these efforts include the formation of PGx working groups working on PGx research, synthesis, and dissemination of PGx data and creation of PGx implementation strategies. In Asia, the Southeast Asian Pharmacogenomics Research Network (SEAPharm) is established to enable and strengthen PGx research among the various PGx communities within but not limited to countries in SEA; with the ultimate goal to support PGx implementation in the region. From the perspective of SEAPharm member countries, there are several key elements essential for PGx implementation at the national level. They include pharmacovigilance database, PGx research, health economics research, dedicated laboratory to support PGx testing for both research and clinical use, structured PGx education, and supportive national health policy. The status of these essential elements is presented here to provide a broad picture of the readiness for PGx implementation among the SEAPharm member countries, and to strengthen the PGx research network and practice in this region.
Fulltext Lifestyle Interventions for Weight Control Modified by Genetic Variation: A Review of the Evidence

Tan PY, Mitra SR, Amini F

Public Health Genomics, 2018;21(5-6):169-185.
PMID: 31117103 DOI: 10.1159/000499854

BACKGROUND/AIMS: Excess weight gain is a result of the interaction between diet, environment, and genes. Evidence suggests that responses to lifestyle interventions to manage weight are partially modified by genetic factors. This review is aimed at summarizing the current evidence from studies done on gene variants - single nucleotide polymorphisms (SNPs) - and intervention outcomes on weight loss and obesity-related traits.
METHODS: Intervention studies published in English between 2000 and August 2018 were retrieved from PubMed, Google Scholar, and Web of Science using various keywords.
RESULTS: This article is a review of 36 studies conducted in 13 different countries which included a total of 15,931 participants between 19 and 70 years of age. The effect of 26 genes and 64 SNPs on the reduction of body weight and metabolic risk factors in response to diet, exercise, and lifestyle interventions was reviewed.
CONCLUSION: Gene-lifestyle interaction studies on the same candidate gene in different populations have reported information which is challenging to interpret. Thus, it is difficult to arrive at a particular model for a strategy on weight management at this point in time. Most of the intervention studies focus on the effect of variants of a single candidate gene on weight loss. Further evidence from large-scale studies is necessary to assess the effect of multiple candidate genes to compute a gene score that could be used in a model intervention programme. Our review suggests that a healthy lifestyle with a balanced diet and regular physical activity will benefit individuals who carry the risk alleles of the obesity-related candidate genes. This message should be the mainstay of the recommendations and guidelines published by nutrition societies across the world.
Fulltext Generic Cost-Effectiveness Models: A Proof of Concept of a Tool for Informed Decision-Making for Public Health Precision Medicine

Snyder SR, Hao J, Cavallari LH, Geng Z, Elsey A, Johnson JA, et al.

Public Health Genomics, 2018;21(5-6):217-227.
PMID: 31189173 DOI: 10.1159/000500725

BACKGROUND/AIMS: Economic evaluation is integral to informed public health decision-making in the rapidly growing field of precision and personalized medicine (PM); however, this research requires specialized expertise and significant resources. Generic models are a novel innovation to efficiently address a critical PM evidence shortage and implementation barrier by enabling use of population-specific input values. This is a generic PM economic evaluation model proof-of-concept study for a pharmacogenomic use case.
METHODS: An 8-step generic economic model development process was applied to the use case of human leukocyte antigen (HLA)-B*15:02genotyping for prediction of carbamazepine-induced cutaneous reactions, with a user-friendly decision-making tool relying on user-provided input values. This generic model was transparently documented and validated, including cross-validation comparing cost-effectiveness results with 3 country-specific models.
RESULTS: A generic pharmacogenomic use case cost-effectiveness model with decision-making tool was successfully developed and cross-validated using input values for 6 populations which produced consistent results for HLA-B*15:02 screening at country-specific cost-effectiveness threshold values. Differences between the generic and country-specific model results were largely due to differences in model structure and assumptions.
CONCLUSION: This proof on concept demonstrates the feasibility of generic models to provide useful PM economic evidence, supporting their use as a pragmatic and timely approach to address a growing need.