MyMedR

Fulltext Haemoglobin E trait: microcytosis and erythrocytosis

George E, Sivagengei K

Med J Malaysia, 1982 Jun;37(2):102-3.

PMID: 7132828

Matched MeSH terms: Hemoglobins, Abnormal/analysis*

Small haemoglobin components accompanying Hb Bart's in newborns

Lie-Injo LE

Med J Malaya, 1972 Dec;27(2):120-4.

PMID: 4268037

Matched MeSH terms: Hemoglobins, Abnormal/analysis*

Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations

Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.

Public Health Genomics, 2015;18(1):60-4.

PMID: 25412720 DOI: 10.1159/000368342

BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.

Matched MeSH terms: Hemoglobins, Abnormal/analysis

Fulltext Identification of hemoglobin AC heterozygote status in a Malay family: a decision between hemoglobin electrophoresis and high performance liquid chromotography

Rosline H, Roshan TM, Ahmed SA, Ilunihayati I

Southeast Asian J. Trop. Med. Public Health, 2007 May;38(3):543-5.

PMID: 17877232

Thalassemia is a common public health problem among Malays. Hemoglobin C (Hb C) is a hemoglobin beta variant resulting from a single base mutation at the 6th position of the beta-globin gene leading to the substitution of glycine for glutamic acid. Hb C is commonly detected in West Africans and in African American but has not been reported in Malaysia. It can be falsely diagnosed as HbE trait in the Malaysian Thalassemia Screening Program which utilizes cellulose acetate hemoglobin electrophoresis. This is the first reported case of Hb AC heterozygote status in a Malay family, with unusual splenomegaly in one of the family members.

Matched MeSH terms: Hemoglobins, Abnormal/analysis*

Hb I-High Wycombe [beta 59(E3)Lys----Glu] in a woman of Malian origin

Lacombe C, Arous N, Pontet F, Blouquit Y, Bardakdjian J, Riou J, et al.

Hemoglobin, 1987;11(2):173-6.

PMID: 3114176

Matched MeSH terms: Hemoglobins, Abnormal/analysis*

Haemaglobin Bart's in cord blood of Malaysians

George E, Selamah G

Southeast Asian J. Trop. Med. Public Health, 1981 Mar;12(1):87-9.

PMID: 6894805

In the newborn the diagnosis of alpha thalassaemia trait is easier because of the presence of haemoglobin Bart's (Hb Bart's). Alpha thalassaemia is common in Southeast Asia. Malaysians are composed of the ethnic groups Malays, Chinese, Indians and Eurasians. Hb Bart's itself is not a simple inherited character but arises from genetically determined imbalance in the biosynthesis of alpha and non alpha chains. 58% of the cord blood samples tested showed raised levels of Hb Bart's. In the Chinese the most common cause of hereditary haemolytic anaemia is haemoglobin H and hydrops foetalis is seen. The rare occurrence of these syndromes in the Malays and Indians in spite of the presence of Hb Bart's indicates an altered expression of the alpha thalassaemia gene in these populations.

Matched MeSH terms: Hemoglobins, Abnormal/analysis*

Haemoglobin F Malaysia: alpha 2, gamma 2 1(NA1) glycine--cysteine; 136 glycine

Eng LI, Kamuzora H, Lehmann H

J Med Genet, 1974 Mar;11(1):25-30.

PMID: 4837284

Matched MeSH terms: Hemoglobins, Abnormal/analysis*

Hb Bart's level in cord blood and deletions of alpha-globin genes

Lie-Injo LE, Solai A, Herrera AR, Nicolaisen L, Kan YW, Wan WP, et al.

Blood, 1982 Feb;59(2):370-6.

PMID: 6895707

The white blood cell DNA of 36 cord blood samples with Hb Bart's in the red blood cells was studied for alpha-globin gene deletions by hybridization of DNA fragments digested by the restriction endonucleases Eco RI, Hpa I, Bam HI, and Bgl II. All 16 DNA samples from cord blood with Hb Bart's below 3% and no other abnormal hemoglobin had one alpha-globin gene deletion (alpha thal2), except one which had two alpha-globin gene deletions (alpha thal1). Most of the alpha thal2 were of the rightward deletion alpha thal2 genotype. Two new types of alpha thal2 variation was found, probably due to a polymorphism somewhere in an area outside the alpha-globin gene. All 14 cases with Hb Bart's between 3.5% and 8.5% and no other abnormal hemoglobin had two alpha-globin gene deletions (alpha thal1), except one that did not have any alpha-globin gene deletion and one that had one alpha-globin gene deletion. Three DNA samples of cord blood with Hb Bart's accompanied by Hb CoSp did not have any alpha-globin gene deletion. Sixty-five DNA samples from cord blood without Hb Bart's or other abnormal hemoglobin had no alpha-globin gene deletions, except one that had one alpha-globin gene deletion (alpha thal2). Two of the 65 DNA samples were found to have triplicated alpha-globin gene loci.

Matched MeSH terms: Hemoglobins, Abnormal/analysis*

Southeast Asian Ovalocytosis and Hemoglobinopathies in Newborns: Prevalence, Molecular, and Hematologic Analyses

Yamsri S, Kawon W, Duereh A, Fucharoen G, Fucharoen S

J Pediatr Hematol Oncol, 2021 04 01;43(3):e341-e345.

PMID: 32815885 DOI: 10.1097/MPH.0000000000001920

OBJECTIVES: Southeast Asian ovalocytosis (SAO) is an inherited red blood cell (RBC) membrane disorder, whereas hemoglobinopathies are inherited globin gene disorders. In an area where both diseases are prevalent, the interaction between them resulting in variable hematologic parameters can be encountered. However, little is known about the genetic interaction of SAO and thalassemia. We investigated the prevalence of SAO and hemoglobinopathy genotypes among newborns in southern Thailand.

PATIENTS AND METHODS: This study was carried out on 297 newborns recruited consecutively at Naradhiwas Rajanagarindra Hospital in the south of Thailand. The SAO was identified on blood smear examination and polymerase chain reaction analysis. Thalassemia genotypes were defined. Hematologic parameters and hemoglobin (Hb) profiles were recorded and analyzed.

RESULTS: Among 297 newborns, 15 (5.1%) carried SAO, whereas 70 (23.6%) had thalassemia with 15 different thalassemia genotypes. Abnormal Hb including Hb C, Hb Q-Thailand, and Hb D-Punjab were observed in 5 newborns. It was found in the nonthalassemic newborns that RBC count, Hb, and hematocrit of the nonthalassemic newborns with SAO were significantly lower than those without SAO. The same finding was also observed in the thalassemic newborns; RBC count, Hb, and hematocrit of the thalassemic newborns with SAO were significantly lower than those without SAO. However, the mean corpuscular volume, mean corpuscular Hb, and RBC distribution width of the SAO-newborns were significantly higher.

CONCLUSIONS: Both SAO and hemoglobinopathy genotypes are common in southern Thailand. One should take this into consideration when evaluating neonatal anemia and other hematologic abnormalities. Identification of both genetic defects and long-term monitoring on the clinical outcome of this genetic interaction should be essential to understand the pathogenesis of these common genetic disorders in the region.

Matched MeSH terms: Hemoglobins, Abnormal/analysis

Hemoglobin Constant Spring (slow-moving hemoglobin X components) and hemoglobin e in Malayan aborigines

Eng LI, Baer A, Lewis AN, Welch QB

Am J Hum Genet, 1973 Jul;25(4):382-7.

PMID: 4716657

Matched MeSH terms: Hemoglobins, Abnormal/analysis*

Haemoglobin Bart's and slow-moving haemoglobin x components in newborns. The homozygous state for the slow-moving X components in a Malay boy

Lie-Injo LE

Acta Haematol., 1973;49(1):25-35.

PMID: 4632449 DOI: 10.1159/000208382

Newborns were examined for the presence of slow-moving haemoglobin components, tentatively designated X components and previously found in a group of Hb H disease in which invariably one of the parents of each patient had the same slow-moving Hb X components also. Structural studies showed that the abnormal haemoglobin in Chinese was identical with Hb Constant Spring, an c-chain variant. Newborns with Hb Bart’s and slow-moving X components invariably had one parent with the X components also. When the child grew older Hb Bart’s disappeared while the Hb X components remained in the blood. The homozygous state for the X components was found in a Malay boy through his newborn brother who had the X components in addition to Hb Bart’s and had both parents with the X components. One other Malay baby had the X components and Hb A2 Indonesia inherited from the parents. The present study of newborns also showed that Hb Bart’s can accompany different abnormalities of haemoglobin production, involving alpha-chains, beta-chains as well as gamm-chains. Its presence in cord blood is, therefore, not specific for alpha-thalassaemia
Key Words: Haemoglobinopathies; Hb Bart’s; Slow-moving Hb X; Thalassaemia

Matched MeSH terms: Hemoglobins, Abnormal/analysis*

Abnormal haemoglobins and hereditary ovalocytosis in the Ulu Jempul District of Kuala Pilah, West Malaysia

Ganesan J, George R, Lie-Injo LE

Southeast Asian J. Trop. Med. Public Health, 1976 Sep;7(3):430-3.

PMID: 1025742

A survey of abnormal haemoglobins and hereditary ovalocytosis was carried out among 629 Malays of Minangkabau descent in the Ulu Jempul District of Kuala Pilah, in the state of Negri Sembilan in West Malaysia.. Several abnormal haemoglobins were found with the following frequencies: Hb E 5.25%, Hb CoSp 2.38%, Hb A2 indonesia 0.80%, a fast moving Hb with a Mobility between A and Bart's 0.64% and Hb Q 0.16%. Hereditary ovalocytosis was found in 13.2% of these people. None of the persons with hereditary ovalocytosis had any evidence of haemolysis.

Matched MeSH terms: Hemoglobins, Abnormal/analysis*

Phosphoglucomutase and carbonic anhydrase in West Malaysian aborigines

Welch QB, Lie-Injo Luan Eng, Bolton JM

Hum. Hered., 1972;22(1):28-37.

PMID: 4624781

Matched MeSH terms: Hemoglobins, Abnormal/analysis

Evaluation of role of HPLC (Merits & Pitfalls), in the diagnosis of various hemoglobinopathies & thalassemic syndromes

Baig MA, Swamy KB, Baksh AD, Bahashwan A, Moshrif Y, Al Sawat A, et al.

Indian J Pathol Microbiol, 2021 8 4;64(3):518-523.

PMID: 34341263 DOI: 10.4103/IJPM.IJPM_709_20

Background: : HPLC is one of the most important tools for accurate diagnosis of hemoglobinopathies and thalassemias. The advantage of the HPLC system is the excellent resolution, reproducibility &quantification of several normal and abnormal hemoglobin.

Results: BIO RAD Variant II analyzer was used. Sickle cell syndromes including double heterozygous states accounted for 56.13% of total cases. HbSS, HbS/β0-th, HbS/β+-th β-thal trait comprises 29%, 6.5%, 5.1%& 10% of total cases respectively with mean MCV (fl) = 84, 68,71,64 respectively. The Mean HbA2 for β-thal trait, HbE trait &HbE-β thal showed 5.1 ± 1.1, 19 ± 9 & 24 ± 8 respectively. HbF is increased in 8.6% case (excluding SC syndromes & β-thal disorders), of these 5.5% were infants & 12 cases of Aplastic Anemias. Peak P2 >7% (2.4% cases) was seen in uncontrolled diabetes mellitus which on quantification showed HbA1C = 8 ± 2.1 mmol/L.

Discussion: : HPLC in correlation with CBC parameters & family studies can aid in the diagnosis of majority of Hemoglobinopathies and thalassemic syndrome. The CBC & HPLC parameters of the present study are in good correlation with the research conducted by Tejinder Sing, RiouJ & Alla Joutovsky. Present study showed HPLC comprehensively characterizing HbS, A, A2, F, S, C, D from each other & was also applicable for the quantification of HbA1c for the monitoring of Diabetes Mellitus.

Conclusion: : The merits of HPLC are small quantity of sample required, economical, less TAT, accurate categorization of HbS, HbA2 & F. But one has to be aware of the limitations and problems associated with this method due to variant hemoglobin within the same retention windows. The present findings show HPLC as an excellent & powerful diagnostic tool for the direct identification of hemoglobin variants with a high degree of precision in the quantification of normal and abnormal hemoglobin fractions.

Matched MeSH terms: Hemoglobins, Abnormal/analysis*

Homozygous state for Hb Constant Spring (slow-moving Hb X components)

Lie-Injo LE, Ganesan J, Clegg JB, Weatherall DJ

Blood, 1974 Feb;43(2):251-9.

PMID: 4810076

Matched MeSH terms: Hemoglobins, Abnormal/analysis*

Haemoglobin Ypsilanti: an incidental finding in two diabetic patients

Sthaneshwar P, Shanmugam H, Arumugam S

Pathology, 2014 Apr;46(3):263-5.

PMID: 24614705 DOI: 10.1097/PAT.0000000000000090

Matched MeSH terms: Hemoglobins, Abnormal/analysis*

Inheritance of haemoglobin H disease. A new aspect

Lie-Injo LE, Lopez CG, Lopes M

Acta Haematol., 1971;46(2):106-20.

PMID: 4331171 DOI: 10.1159/000208565

A study of 23 patients with Hb H disease and their 82 relatives in 17 families showed that 2 types of this condition exist. One is associated with the presence of a small slow-moving component, which we tentatively called the X component and which was invariably present in one parent. Some siblings also had it. The other type was not associated with this component. Two patients without X component had a newborn with Bart’s haemoglobin without X component. None of the parents of 20 newborns with Hb Bart’s without the X component had the X component. It was present in only one parent of each of 2 newborns with Hb Bart’s and the X component. They are thought to represent Hb H disease in the newborn period. We suggest that at least 3 abnormal genes may lead to Hb H disease, which results when 2 of the 3 combine. Severity of clinical and haematological symptoms depends upon which abnormal gene is present and which 2 are involved in any particular combination.
Key Words: a-Thalassaemia; Haemoglobin Bart’s; Haemoglobin H disease; Haemoglobinopathies

Matched MeSH terms: Hemoglobins, Abnormal/analysis*

Alpha-thalassaemia in newborns in West Malaysia

Lopez CG, Lie-Injo Luan Eng

Hum. Hered., 1971;21(2):185-91.

PMID: 5127409

Matched MeSH terms: Hemoglobins, Abnormal/analysis*

Red cell metabolism and severe neonatal jaundice in West Malaysia

Lie-Injo LE, Virik HK, Lim PW, Lie AK, Ganesan J

Acta Haematol., 1977;58(3):152-60.

PMID: 409030 DOI: 10.1159/000207822

A study was carried out of 332 babies suffering from severe neonatal jaundice who were admitted to the General Hospital, Kuala Lumpar, Malaysia. Of the 332 neonates, 51 were premature and 281 were full-term babies, 178 (110 Chinese, 58 Malay, 9 Indian and 1 European-Pakistani) had bilirubin levels of 20 mg% or higher, requiring exchange blood transfusion. Of the Chinese neonates, 23 (20.9%) had G6PD deficiency, 9 (8.2%) had Hb Bart's and 2 (1.8%) had an abnormal haemoglobin, one Hb Q and one fetal variant. Among the Malay infants, 10 (17.2%) had G6PD deficiency, 7 (12.1%) had Hb Bart's and 10 (17.2%) had abnormal haemoglobins (four had Hb E trait, one had Hb K and Bart's in addition to Hb E, three had Hb CoSp with Hb Bart's, one had Hb Q and one Hb Tak). One of the nine Indian neonates had G6PD deficiency and one had Hb S trait. The one European-Pakistani baby was a carrier of Hb D Punjab. In addition to G6PD deficiency, abnormal haemoglobins seem to have contributed to the high incidence of severe neonatal jaundice in Malaysia. The mean activities of GP, GR and GR after stimulation with FAD were higher, while the mean activity of PK and mean level of reduced glutathione were lower than in normal cord bloods. The percent increase of GR after FAD stimulation was significantly lower; fewer in this group had increases above 20% than in normal cord blood. The possible significance of the findings is discussed.

Matched MeSH terms: Hemoglobins, Abnormal/analysis

Structural identification of haemoglobin F Kuala Lumpur: alpha2 gamma2 22(B4)Asp leads to Gly; 136 Ala

Luan Eng LI, Wiltshire BG, Lehmann H

Biochim. Biophys. Acta, 1973 Oct 18;322(2):224-30.

PMID: 4765089

Matched MeSH terms: Hemoglobins, Abnormal/analysis*

Displaying publications 1 - 20 of 22 in total