Acral melanoma has been reported to have distinctive clinical presentation and ethnic distribution compared to other histological types of malignant melanoma. Acral melanoma also exhibits distinctive focused gene amplifications, including cyclin D1 overexpression. We reviewed archived histological material of malignant melanoma in the Sarawak General Hospital from year 2004 to 2010. 43 tumours, comprising 28 acral melanoma and 15 non-acral melanoma, had sufficient material to be included in the study. The majority (36%) of acral melanoma tumours occurred in the heel. The tumours were analyzed for cyclin D1 expression by immunohistochemistry. 68% of acral melanoma were cyclin D1 positive compared to a positivity of 33% in non-acral tumours. This difference was statistically significant (p < 0.05). This finding may improve the histological diagnosis of acral melanoma and detection of positive resection margins.
BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.