Aim: The objective of this research was to investigate the acute effects of tributyltin chloride (TBTCl) on gonads in the adult stage of Artemia salina by use normal histology and immunohistochemistry (IHC) (Caspase 3 and HSP70) to see specific apoptosis markers.
Methods: After exposure of A. salina to different concentrations of TBTCl (25, 50, 100, 200, and 300 ng.l-1), 50 adult A. salina (25 male and 25 female) were selected randomly from each concentration to histologically study the gonads. The gonad tissue was sectioned (5 μm) and some slides were stained with hematoxylin and eosin and others were stained with IHC avidin-biotin complex, and were examined under a light microscope.
Results: The results showed significant differences (p < 0.05) in histological lesions between different concentrations of TBTCl. The histological lesions in the testis and ovary section were undifferentiated cells, degenerating yolk globules, and follicle cells enveloping the oocyte which was then compared with control tissue, and these effects were found to be increased in females more than in males with the highest concentration of TBTCl. Immunohistochemistry (IHC) showed that positive immunostaining was observed in the testis and ovary as brownish deposits to Caspase 3 and HSP70 antibody after exposure to TBTCl, while the testis and ovary section in control tissue had no immunoreactivity to Caspase 3 and HSP70 antibody; these effects were profoundly increased with the highest concentration of TBTCl in females more than in males. Finally, the histological lesions and IHC (Caspase 3 and HSP70) revealed that the apoptosis and immune system stress of A. salina gonad tissue damage in females were more sensitive to TBTCl toxicity as compared to white males.
Conclusion: In general, the present study aimed to observe the effects TBTCl on A. salina gonads by using histological sections and IHC (Caspase 3 and HSP70), which were evaluated for the first time and have been proven to possess an important function in apoptosis marker and immune system stress in Artemia. Finally, the specific mechanisms through which TBTCl affects A. salina Caspase 3 and HSP70 expression need further investigation.
AIM: The objective of this study was to determine the pathogenicity of Salmonella enterica subspecies enterica serovar Enteritidis (SE) phage type (PT) 1 in one-day-old specific pathogen-free (SPF) chicks.
METHODS: Seventy, one-day-old SPF chicks, were divided into SE group (30 chicks), mortality group (10 chicks), both orally inoculated (1.0 ml) with SE PT1 (1 × 108 colony-forming unit per 1.0 ml), and one control group (30 chicks). The chicks were sacrificed at 6 and 12 hours, and days 1, 2, 3, 5, 7, 10, 14, and 21 post-inoculation (pi). Samples were collected for bacterial isolation, histological examination, and ultrastructural examination.
RESULTS: Starting from day 2 pi, the body weight in the SE group significantly (p < 0.05) decreased. The SE isolation percentages from the liver, spleen, mid-intestinal content, cecal content, cecal tonsil, blood, and cloacal swab were 0.73, 0.77, 0.33, 0.33, 0.36, 0.40, and 0.30, respectively. The isolation percentage in the liver was significantly (p < 0.05) higher than the blood and cloacal swab. The villi heights and crypt depths in the SE group were significantly (p < 0.05) greater and smaller, respectively. Ultrastructurally, erosion and necrosis were observed in the microvilli of the cecal tonsil. The bacteria were engulfed by macrophages at the interepithelial clefts of the M-like M cells.
CONCLUSION: It was concluded that the inoculation of SE PT 1 in one-day-old chicks caused a systemic infection with diarrhea, a decrease in the body weight and villi height in the duodenum, jejunum, and ileum, and high bacterial loading in the liver with mild gross and histological lesions of organs, erosion, and necrosis of microvilli and low mortality. The bacteria entered the body system from the intestinal tract through the interepithelial clefts of the M-like M cells of the cecal tonsil.
AIM: The objective of this study was to develop a TaqMan probe-based qPCR method for the detection and quantification of the FAdV 8b challenge virus.
METHODS: Forty-eight broiler chickens inoculated with live attenuated or inactivated FAdV 8b strains at day 1 of age either with or without booster at day 14 post-inoculation were used. The chickens were challenged with a pathogenic strain of FAdV 8b at day 28 of age. Liver and cloacal swabs were collected on days 7 and 14 post-challenge. Primers and probes were designed, specificity confirmed, and used to carry out qPCR amplification.
RESULTS: The assay amplified the FAdV DNA challenge virus, but not that of the live attenuated virus. It could detect FAdV 8b DNA as low as 0.001 ng/µl in liver and cloacal swab samples. Copy numbers obtained indicate virus load and shedding.
CONCLUSIONS: It shows that a selective detection of FAdV 8b within serotype is possible. It can be useful for rapid detection and diagnosis of the disease, virus quantification and differentiation within species, determination of vaccination failure, and efficacy especially the virus load in the target organ and shedding.
AIM: To investigate the beneficial effects of fish oil consumption on the progression of insulin resistance and pancreatic islet dysfunction in a rat model of diabetes.
METHODS: Diabetic rats model (n = 30) were divided into five groups and received; 1) NS injection + NS oral (normal control); 2) NS injection + 3 g/kg fish oil (fish oil control); 3) streptozotocin (STZ) injection + NS oral [diabetes control (DC)]; 4) STZ injection + 1 g/kg fish oil (DFO1); and 5) STZ injection + 3 g/kg fish oil (DFO3). Fasting blood insulin was analyzed by commercial rat insulin enzyme-linked immunosorbent assay; meanwhile, the determination of insulin sensitivity was calculated by homeostatic model assessment of insulin resistance (HOMA-IR) and homeostatic model assessment of beta-cell function. A histological study was conducted on pancreas tissue using H and E staining.
RESULTS: Fish oil supplementation reduced hyperglycemia and ameliorated HOMA-IR in STZ-induced animal models indicating that fish oil supplementation improved insulin sensitivity. Furthermore, animals treated with fish oil at a dose of 3 g/kg (DFO3) showed an enhancement in pancreatic islets, which was displayed by less abnormal structures than DC animals. This could imply that the administration of fish oil, especially rich in bioactive omega-3 fatty acids effectively inhibits insulin resistance and restore islet of Langerhans alteration in rats injected with STZ.
CONCLUSION: Thus, the current study suggested that fish oil supplementation could support the treatment of diabetes but should not be considered as an alternative therapy.
AIM: We want to demonstrate that the antioxidant properties of Swietenia macrophylla ethanol extract nanoparticles can prevent kidney cell damage brought on by streptozotocin (STZ) in the current investigation.
METHODS: This study employs high-energy ball milling to produce nanoparticles from S. macrophylla extract. Additionally, dynamic light scattering (DLS) is utilized to characterize the nanoparticle sizes of the S. macrophylla ethanol extract. Five groups, each consisting of 8 rats, were formed from 40 rats. Control rats received distilled water, the diabetic rats were administered STZ injections, while S. macrophylla rats were given S. macrophylla extract nanoparticles orally and STZ injection. After the trial, blood from a rat was drawn intracardially to check the levels of blood urea nitrogen (BUN) and creatinine. The levels of superoxide dismutase (SOD), glutathione peroxidase (GPx), and malondialdehyde (MDA) were then assessed in kidney tissue samples. Histological alterations were evaluated in kidney section samples.
RESULTS: A DLS analysis estimated the size of the S. macrophylla ethanol extract nanoparticles to be about 91.50 ± 23.06 nm. BUN and creatinine levels were significantly raised after STZ treatment. STZ significantly decreased SOD and GPx levels in kidney tissue while raising MDA levels (p < 0.05). Swietenia macrophylla ethanol extract nanoparticle caused the decreased levels of BUN and creatinine in blood to normal levels (p < 0.05), indicating that S. macrophylla ethanol extract prevented the STZ-induced kidney cell damage. Additionally, S. macrophylla nanoparticles significantly raise GPx and SOD levels in kidney tissue while lowering MDA levels (p < 0.05). These actions are thought to have prevented kidney histological alterations (degeneration and necrosis) in diabetic rats.
CONCLUSION: According to these results, the anti-oxidative stress properties of S. macrophylla nanoparticles make them potentially effective nephroprotective therapies for STZ-induced kidney cell damage.
AIM: This study was carried out to attenuate the FAdV 8b isolate, propagate it in a bioreactor, molecularly characterize the passage isolates, and determine the immunogenicity, efficacy, and shedding of the virus of chickens.
METHODS: FAdV serotype 8b (UPM11142) isolate was passaged on chicken embryo liver (CEL) cells until attenuation and propagated in a bioreactor (UPM11142P20B1). Hexon and fiber genes of the isolates were sequenced and analyzed. UPM11142P20B1 was administered to 116-day-old broiler chickens divided into four groups, A (control), B (non-booster), C (booster with UPM11142P20B1), and D (booster with inactivated UPM11142P5B1). Eight chickens from each group were challenged. Body weight (BW) and liver weight (LW), liver: BW ratio (LBR), FAdV antibody titer, T lymphocyte sub-populations in the liver, spleen and thymus; and challenge virus load in the liver and shedding in cloaca were measured at weekly intervals.
RESULTS: The isolate caused typical cytopathic effects on CEL cells typical of FAdV. Novel molecular changes in the genes occurred which could be markers for FAdV 8b attenuation. BW, LW, and LBR were similar among groups throughout the trial but the uninoculated control-challenged group (UCC) had significantly higher LBR than the inoculated and challenged groups at 35 dpi. Non-booster group had higher FAdV antibodies at all time points than the uninoculated control group (UCG); and the challenged booster groups had higher titer at 35 dpi than UCC. T lymphocytes increased at different time-points in the liver of inoculated chickens, and in the spleen and thymus as well, and was higher in the organs of inoculated challenged groups than the UCC. There was a significantly higher challenge virus load in the liver and cloaca of UCC chickens than in the non-booster chickens.
CONCLUSION: UPM11142P20B1 was safe, efficacious, significantly reduced shedding, and is recommended as a candidate vaccine in the prevention and control of FAdV 8b infections in broiler chickens.
AIM: This study investigated Morus alba ethanolic leaf extract (MAE) to observe the acute toxicity in mice.
METHODS: In particular, this study utilized 12 female Institute of Cancer Research mice, 8 weeks old, divided into 2 groups: the control group and the MAE group (2,000 mg/kg single dose). Physiology, hematology, biochemistry, and histology were analyzed during the study.
RESULTS: The examination result indicated no mortality and behavioral changes throughout the testing period. However, the mice developed mild anemia and leukopenia, followed by decreased numbers of neutrophils, lymphocytes, and monocytes. In addition, the mice developed a mild hepatocellular injury, indicated by significant (p < 0.05) elevations of both alanine aminotransferase (ALT) and aspartate transaminase (AST). The histopathological findings of the liver were also consistent with the increment of ALT and AST, indicating mild hepatocellular necrosis through the eosinophilic cytoplasm and pyknosis (p > 0.05).
CONCLUSION: It was evident that a single oral administration of MAE was not lethal for mice (LD50, which was higher than 2,000 mg/kg). However, the administration of high doses of MAE must be carefully considered.
AIM: This study evaluated the anticarcinogenic effects of black soybean extract.
METHODS: The activity of flavonoid compounds in black soybean was determined in silico. Five groups of rats, four in each group, were established, consisting of a negative control, a positive control, and three treatment groups. Treatment included black soybean extract administration (i.e., T1 = 200, T2 = 400, and T3 = 800 mg of black soybean extract/kg body weight for 10 days). The observed parameters included the immunohistochemical analysis of Breast Cancer 1(BRCA1) and TNF-α.
RESULTS: Based on an in silico study, compounds from black soybeans are non-toxic. Functional annotation analysis revealed that most of the target proteins have a role in biological processes associated with cancer development. An in vivo analysis using an animal mammae cancer model indicated that black soybean extracts inhibited mammae cancer progression by attenuating TNF-α and BRCA1 expression.
CONCLUSION: The most effective dosage of black soybean extract was 200 mg/kg body weight. An increase in BRCA1 and TNF-α expression may be related to the effects of catechin, daidzein, genistein, and glycitein, which are present in black soybeans.
AIM: This study evaluates the local and systemic biocompatibility of IVD in five non-pregnant female cats.
METHODS: The IVD was successfully inserted into the vaginal lumen after estrogen administration. Radiographic imaging confirmed the IVD's position, which lasted up to two days post-insertion.
RESULTS: Systemic response, assessed through hematological examinations on days 0, 1, and 3 post-insertion, showed no significant changes in erythrogram and leukogram parameters. Local response, evaluated through vulvar inspection and vaginal cytology on days 0, 1, 3, and 7, revealed no neutrophil infiltration in 4 out of 5 cats, indicating compatibility with vaginal tissue. Furthermore, epithelial cell profile changes were observed, showing an increase in superficial cells, which is typical during the estrus phase.
CONCLUSION: These findings suggest that the IVD is biocompatible and suitable for use as a contraceptive and identity device in cats. However, further long-term studies are necessary to evaluate the device's prolonged efficacy and potential for contraception failure prevention by mating trials.
AIM: The objective of this study was to assess the impact of ethyl acetate extract of fungus comb (EAEFC) on the inflammatory reaction in the spleen of mice induced by intraperitoneal injection of lipopolysaccharide (LPS).
METHODS: An experimental study was conducted using a post-test-only control group design with male BALB/C mice (n = 24). The mice were divided randomly into four groups, each comprising six mice, and administered substances via gavage. Groups I and III were administered a solution of 5% dimethyl sulfoxide (DMSO) in distilled water, while Groups II and IV were given 500 mg/kg BW EAEFC dissolved in 5% DMSO. On the fifteenth day, Groups I and II received intraperitoneal injections of 5 ml/kg BW saline, while Groups III and IV were injected with 10 mg/kg BW LPS dissolved in saline. After three hours, the mice were euthanized and splenic immunohistology was examined under a light microscope. The results were expressed as mean ± standard deviation, while the group differences were assessed statistically.
RESULTS: The expression of interleukin (IL)-1, furin, and activated NK cell was significantly higher in the inflamed model after EAEFC supplementation, while the extract suppressed IL-10.
CONCLUSION: EAEFC was found to alter cytokine expression in the spleen in response to inflammation.
AIM: This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs.
METHODS: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples.
RESULTS: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R 2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples.
CONCLUSION: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.