MyMedR

Displaying all 10 publications

Abstract:

Sort:

Ethnic differences in normal spirometric lung function of Malaysian children

Azizi BH, Henry RL

Respir Med, 1994 May;88(5):349-56.
PMID: 8036303

Spirometric recordings of 1098 Malaysian children who were free of respiratory symptoms were examined by least square regression analysis of log-transformed lung function data. Ethnic differences were observed in FVC, FEV1, and FEF25-75 independent of father's education, exposure to passive smoking, wood stove, kerosene stove and mosquito repellents, family history of chest illness and history of allergy, after adjusting for standing height, age and sex. Exposure to kerosene stove was significantly associated with reduced FVC and FEV1 indicating that environmental factors may impair lung function in symptomless children. Prediction equations were derived for each ethnic group and sex. Comparison with data from the literature showed that Malaysian children had lower lung function values than Caucasian children. Generally, Chinese children had higher FEV1, FVC and FEF25-75 than Malay and Indian children. Indian children consistently had the lowest lung function values. Since these ethnic differences were independent of environmental and other host factors, anthropometric variations could be an explanation.
Effects of indoor air pollution on lung function of primary school children in Kuala Lumpur

Azizi BH, Henry RL

Pediatr Pulmonol, 1990;9(1):24-9.
PMID: 2388776

In a cross-sectional study of 7-12 year-old primary school children in Kuala Lumpur city, lung function was assessed by spirometric and peak expiratory flow measurements. Spirometric and peak expiratory flow measurements were successfully performed in 1,214 and 1,414 children, respectively. As expected, the main predictors of forced vital capacity (FVC), forced expiratory volume in one second (FEV1), forced expiratory flow between 25% and 75% of vital capacity (FEF25-75), and peak expiratory flow rate (PEFR) were standing height, weight, age, and sex. In addition, lung function values of Chinese and Malays were generally higher than those of Indians. In multiple regression models which included host and environmental factors, asthma was associated with significant decreases in FEV1, FEF25-75, and PEFR. However, family history of chest illness, history of allergies, low paternal education, and hospitalization during the neonatal period were not independent predictors of lung function. Children sharing rooms with adult smokers had significantly lower levels of FEF25-75. Exposures to wood or kerosene stoves were, but to mosquito repellents were not, associated with decreased lung function.
The effects of indoor environmental factors on respiratory illness in primary school children in Kuala Lumpur

Azizi BH, Henry RL

Int J Epidemiol, 1991 Mar;20(1):144-50.
PMID: 2066213 DOI: 10.1093/ije/20.1.144

The effects of indoor environmental factors on respiratory illness were studied in 15017-12 year old school children in Kuala Lumpur. Exposure to mosquito coil smoke for at least three nights a week was independently associated with asthma and persistent wheeze. Passive smoking, defined as sharing a bedroom with an adult smoker, was independently associated with a chest illness in the past year. No relationships were found between exposure to kerosene stoves, wood stoves, fumigation mat mosquito repellents or aerosol insecticides and respiratory illness. Host factors predictive of at least one respiratory outcome included family history of chest illness, history of allergy, male sex, hospitalization in the neonatal period and low paternal education. With 95% confidence, avoidance of regular exposure to mosquito coil smoke and passive smoking could reduce the prevalences of persistent wheeze, asthma and chest illness by up to 29%. Measurements of lung function confirmed the validity of questions pertaining to wheezing and asthma in the study questionnaire.
Serum C-reactive protein concentrations in Malaysian children with enteric fever

Choo KE, Davis TM, Henry RL, Chan LP

J Trop Pediatr, 2001 Aug;47(4):211-4.
PMID: 11523761

To investigate the role of serum C-reactive protein (CRP) in the diagnosis of typhoid fever, we studied 227 febrile Malaysian children hospitalized during a 12-month period. The children were: culture-positive for Salmonella typhi (Group 1; n = 108); culture-negative but with typical clinical features of typhoid fever (Group 2; n = 60); or had non-typhoidal illness (Group 3; n = 59). Group 1 children had the highest serum CRP concentrations (geometric mean [SD range]; 43 [12-150] mg/l vs. 26 [8-85] mg/l in Group 2 and 21 [4-110] mg/l in Group 3; p < 0.001). In regression analysis, age, patient group and fever duration were independently associated with serum CRP (p < 0.05) but gender was not. In Group 1 patients, there was a significant positive association between serum CRP and Widal O and H agglutinin titres. In receiver-operator characteristic (ROC) analysis of serum CRP for Groups 1 and 2 combined, compared with Group 3, the area under the curve (AUC) was 0.65. These data show that the serum CRP is highest in culture-positive children with enteric fever and reflects the immune response to the infection in this group. Nevertheless, serum CRP had relatively low sensitivity and specificity for confirmed or clinically diagnosed typhoid fever (68 and 58 per cent, respectively at 'cut-off' concentration 30.0 mg/l), and an AUC value only moderately above that associated with no predictive power (0.5). Although of limited use as a primary diagnostic test, a raised serum CRP may still have a place as one of a range of features that facilitate assessment of a febrile child in a typhoid-endemic area.
Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations

Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.

Public Health Genomics, 2015;18(1):60-4.
PMID: 25412720 DOI: 10.1159/000368342

BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
Fulltext Global agricultural intensification during climate change: a role for genomics

Abberton M, Batley J, Bentley A, Bryant J, Cai H, Cockram J, et al.

Plant Biotechnol J, 2016 Apr;14(4):1095-8.
PMID: 26360509 DOI: 10.1111/pbi.12467

Agriculture is now facing the 'perfect storm' of climate change, increasing costs of fertilizer and rising food demands from a larger and wealthier human population. These factors point to a global food deficit unless the efficiency and resilience of crop production is increased. The intensification of agriculture has focused on improving production under optimized conditions, with significant agronomic inputs. Furthermore, the intensive cultivation of a limited number of crops has drastically narrowed the number of plant species humans rely on. A new agricultural paradigm is required, reducing dependence on high inputs and increasing crop diversity, yield stability and environmental resilience. Genomics offers unprecedented opportunities to increase crop yield, quality and stability of production through advanced breeding strategies, enhancing the resilience of major crops to climate variability, and increasing the productivity and range of minor crops to diversify the food supply. Here we review the state of the art of genomic-assisted breeding for the most important staples that feed the world, and how to use and adapt such genomic tools to accelerate development of both major and minor crops with desired traits that enhance adaptation to, or mitigate the effects of climate change.
Fulltext Study design, rationale and methods of the Revitalising Informal Settlements and their Environments (RISE) study: a cluster randomised controlled trial to evaluate environmental and human health impacts of a water-sensitive intervention in informal settlements in Indonesia and Fiji

Leder K, Openshaw JJ, Allotey P, Ansariadi A, Barker SF, Burge K, et al.

BMJ Open, 2021 01 08;11(1):e042850.
PMID: 33419917 DOI: 10.1136/bmjopen-2020-042850

INTRODUCTION: Increasing urban populations have led to the growth of informal settlements, with contaminated environments linked to poor human health through a range of interlinked pathways. Here, we describe the design and methods for the Revitalising Informal Settlements and their Environments (RISE) study, a transdisciplinary randomised trial evaluating impacts of an intervention to upgrade urban informal settlements in two Asia-Pacific countries.
METHODS AND ANALYSIS: RISE is a cluster randomised controlled trial among 12 settlements in Makassar, Indonesia, and 12 in Suva, Fiji. Six settlements in each country have been randomised to receive the intervention at the outset; the remainder will serve as controls and be offered intervention delivery after trial completion. The intervention involves a water-sensitive approach, delivering site-specific, modular, decentralised infrastructure primarily aimed at improving health by decreasing exposure to environmental faecal contamination. Consenting households within each informal settlement site have been enrolled, with longitudinal assessment to involve health and well-being surveys, and human and environmental sampling. Primary outcomes will be evaluated in children under 5 years of age and include prevalence and diversity of gastrointestinal pathogens, abundance and diversity of antimicrobial resistance (AMR) genes in gastrointestinal microorganisms and markers of gastrointestinal inflammation. Diverse secondary outcomes include changes in microbial contamination; abundance and diversity of pathogens and AMR genes in environmental samples; impacts on ecological biodiversity and microclimates; mosquito vector abundance; anthropometric assessments, nutrition markers and systemic inflammation in children; caregiver-reported and self-reported health symptoms and healthcare utilisation; and measures of individual and community psychological, emotional and economic well-being. The study aims to provide proof-of-concept evidence to inform policies on upgrading of informal settlements to improve environments and human health and well-being.
ETHICS: Study protocols have been approved by ethics boards at Monash University, Fiji National University and Hasanuddin University.
TRIAL REGISTRATION NUMBER: ACTRN12618000633280; Pre-results.
Fulltext Application of genomics-assisted breeding for generation of climate resilient crops: progress and prospects

Kole C, Muthamilarasan M, Henry R, Edwards D, Sharma R, Abberton M, et al.

Front Plant Sci, 2015;6:563.
PMID: 26322050 DOI: 10.3389/fpls.2015.00563

Climate change affects agricultural productivity worldwide. Increased prices of food commodities are the initial indication of drastic edible yield loss, which is expected to increase further due to global warming. This situation has compelled plant scientists to develop climate change-resilient crops, which can withstand broad-spectrum stresses such as drought, heat, cold, salinity, flood, submergence and pests, thus helping to deliver increased productivity. Genomics appears to be a promising tool for deciphering the stress responsiveness of crop species with adaptation traits or in wild relatives toward identifying underlying genes, alleles or quantitative trait loci. Molecular breeding approaches have proven helpful in enhancing the stress adaptation of crop plants, and recent advances in high-throughput sequencing and phenotyping platforms have transformed molecular breeding to genomics-assisted breeding (GAB). In view of this, the present review elaborates the progress and prospects of GAB for improving climate change resilience in crops, which is likely to play an ever increasing role in the effort to ensure global food security.
Fulltext A planetary health model for reducing exposure to faecal contamination in urban informal settlements: Baseline findings from Makassar, Indonesia

French MA, Fiona Barker S, Taruc RR, Ansariadi A, Duffy GA, Saifuddaolah M, et al.

Environ Int, 2021 10;155:106679.
PMID: 34126296 DOI: 10.1016/j.envint.2021.106679

BACKGROUND: The intense interactions between people, animals and environmental systems in urban informal settlements compromise human and environmental health. Inadequate water and sanitation services, compounded by exposure to flooding and climate change risks, expose inhabitants to environmental contamination causing poor health and wellbeing and degrading ecosystems. However, the exact nature and full scope of risks and exposure pathways between human health and the environment in informal settlements are uncertain. Existing models are limited to microbiological linkages related to faecal-oral exposures at the individual level, and do not account for a broader range of human-environmental variables and interactions that affect population health and wellbeing.
METHODS: We undertook a 12-month health and environmental assessment in 12 flood-prone informal settlements in Makassar, Indonesia. We obtained caregiver-reported health data, anthropometric measurements, stool and blood samples from children
Fulltext Dissecting the Shared Genetic Architecture of Suicide Attempt, Psychiatric Disorders, and Known Risk Factors

Mullins N, Kang J, Campos AI, Coleman JRI, Edwards AC, Galfalvy H, et al.

Biol Psychiatry, 2022 Feb 01;91(3):313-327.
PMID: 34861974 DOI: 10.1016/j.biopsych.2021.05.029

BACKGROUND: Suicide is a leading cause of death worldwide, and nonfatal suicide attempts, which occur far more frequently, are a major source of disability and social and economic burden. Both have substantial genetic etiology, which is partially shared and partially distinct from that of related psychiatric disorders.
METHODS: We conducted a genome-wide association study (GWAS) of 29,782 suicide attempt (SA) cases and 519,961 controls in the International Suicide Genetics Consortium (ISGC). The GWAS of SA was conditioned on psychiatric disorders using GWAS summary statistics via multitrait-based conditional and joint analysis, to remove genetic effects on SA mediated by psychiatric disorders. We investigated the shared and divergent genetic architectures of SA, psychiatric disorders, and other known risk factors.
RESULTS: Two loci reached genome-wide significance for SA: the major histocompatibility complex and an intergenic locus on chromosome 7, the latter of which remained associated with SA after conditioning on psychiatric disorders and replicated in an independent cohort from the Million Veteran Program. This locus has been implicated in risk-taking behavior, smoking, and insomnia. SA showed strong genetic correlation with psychiatric disorders, particularly major depression, and also with smoking, pain, risk-taking behavior, sleep disturbances, lower educational attainment, reproductive traits, lower socioeconomic status, and poorer general health. After conditioning on psychiatric disorders, the genetic correlations between SA and psychiatric disorders decreased, whereas those with nonpsychiatric traits remained largely unchanged.
CONCLUSIONS: Our results identify a risk locus that contributes more strongly to SA than other phenotypes and suggest a shared underlying biology between SA and known risk factors that is not mediated by psychiatric disorders.