MyMedR

Displaying all 6 publications

Abstract:

Sort:

Fulltext Stable and null current hysteresis perovskite solar cells based nitrogen doped graphene oxide nanoribbons hole transport layer

Kim J, Mat Teridi MA, Mohd Yusoff AR, Jang J

Sci Rep, 2016 06 09;6:27773.
PMID: 27277388 DOI: 10.1038/srep27773

Perovskite solar cells are becoming one of the leading technologies to reduce our dependency on traditional power sources. However, the frequently used component poly(3,4-ethylenedioxythiophene) polystyrene sulfonate (
PEDOT: PSS) has several shortcomings, such as an easily corroded indium-tin-oxide (ITO) interface at elevated temperatures and induced electrical inhomogeneity. Herein, we propose solution-processed nitrogen-doped graphene oxide nanoribbons (NGONRs) as a hole transport layer (HTL) in perovskite solar cells, replacing the conducting polymer
PEDOT: PSS. The conversion efficiency of NGONR-based perovskite solar cells has outperformed a control device constructed using
PEDOT: PSS. Moreover, our proposed NGONR-based devices also demonstrate a negligible current hysteresis along with improved stability. This work provides an effective route for substituting
PEDOT: PSS as the effective HTL.
Null current hysteresis for acetylacetonate electron extraction layer in perovskite solar cells

Mohd Yusoff AR, Mat Teridi MA, Jang J

Nanoscale, 2016 Mar 17;8(12):6328-34.
PMID: 26489053 DOI: 10.1039/c5nr06234a

Solution processed zirconium acetylacetonate (Zr(acac)) is successfully employed as an electron extraction layer, replacing conventional titanium oxide, in planar CH3NH3PbI3 perovskite solar cells. The as-prepared Zr(acac) film possesses high transparency, high conductivity, a smooth morphology, high wettability, compatibility with PbI2 DMF solution, and an energy level matching that of CH3NH3PbI3 perovskite material. An average power conversion efficiency of about 11.93%, along with a high fill factor of 74.36%, an open circuit voltage of 1.03 V, and a short-circuit current density of 15.58 mA cm(-2) is achieved. The overall performance of the devices is slight better than that of cells using ruthenium acetylacetonate (Ru(acac)). The differences between solar cells with different electron extraction layers in charge recombination, charge transport and transfer and lifetime are further explored and it is demonstrate that Zr(acac) is a more effective and promising electron extraction layer. This work provides a simple, and cost effective route for the preparation of an effective hole extraction layer.
Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations

Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.

Public Health Genomics, 2015;18(1):60-4.
PMID: 25412720 DOI: 10.1159/000368342

BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
Fulltext Bandgap tuning of mixed organic cation utilizing chemical vapor deposition process

Kim J, Kim HP, Teridi MA, Yusoff AR, Jang J

Sci Rep, 2016 11 22;6:37378.
PMID: 27874026 DOI: 10.1038/srep37378

Bandgap tuning of a mixed organic cation perovskite is demonstrated via chemical vapor deposition process. The optical and electrical properties of the mixed organic cation perovskite can be manipulated by varying the growth time. A slight shift of the absorption band to shorter wavelengths is demonstrated with increasing growth time, which results in the increment of the current density. Hence, based on the optimized growth time, our device exhibits an efficiency of 15.86% with negligible current hysteresis.
Review of MR spectroscopy analysis and artificial intelligence applications for the detection of cerebral inflammation and neurotoxicity in Alzheimer's disease

Seriramulu VP, Suppiah S, Lee HH, Jang JH, Omar NF, Mohan SN, et al.

Med J Malaysia, 2024 Jan;79(1):102-110.
PMID: 38287765

INTRODUCTION: Magnetic resonance spectroscopy (MRS) has an emerging role as a neuroimaging tool for the detection of biomarkers of Alzheimer's disease (AD). To date, MRS has been established as one of the diagnostic tools for various diseases such as breast cancer and fatty liver, as well as brain tumours. However, its utility in neurodegenerative diseases is still in the experimental stages. The potential role of the modality has not been fully explored, as there is diverse information regarding the aberrations in the brain metabolites caused by normal ageing versus neurodegenerative disorders.
MATERIALS AND METHODS: A literature search was carried out to gather eligible studies from the following widely sourced electronic databases such as Scopus, PubMed and Google Scholar using the combination of the following keywords: AD, MRS, brain metabolites, deep learning (DL), machine learning (ML) and artificial intelligence (AI); having the aim of taking the readers through the advancements in the usage of MRS analysis and related AI applications for the detection of AD.
RESULTS: We elaborate on the MRS data acquisition, processing, analysis, and interpretation techniques. Recommendation is made for MRS parameters that can obtain the best quality spectrum for fingerprinting the brain metabolomics composition in AD. Furthermore, we summarise ML and DL techniques that have been utilised to estimate the uncertainty in the machine-predicted metabolite content, as well as streamline the process of displaying results of metabolites derangement that occurs as part of ageing.
CONCLUSION: MRS has a role as a non-invasive tool for the detection of brain metabolite biomarkers that indicate brain metabolic health, which can be integral in the management of AD.
Plasmon enhanced organic devices utilizing highly ordered nanoimprinted gold nanodisks and nitrogen doped graphene

Teridi MA, Sookhakian M, Basirun WJ, Zakaria R, Schneider FK, da Silva WJ, et al.

Nanoscale, 2015 Apr 28;7(16):7091-100.
PMID: 25640454 DOI: 10.1039/c4nr05874g

High performance organic devices including polymer solar cells (PSCs) and light emitting diodes (PLEDs) were successfully demonstrated with the presence of highly ordered nanoimprinted Au nanodisks (Au NDs) in their solution-processed active/emissive layers, respectively. PSCs and PLEDs were fabricated using a low bandgap polymer and acceptor, nitrogen doped multiwalled carbon nanotubes poly[4,8-bis[(2-ethylhexyl)oxy]benzo[1,2-b:4,5-b']dithiophene-2,6-diyl][3-fluoro-2-[(2-ethylhexyl)carbonyl] thieno[3,4-b]-thiophenediyl] (n-MWCNTs:PTB7), and [6,6]-phenyl C71 butyric acid methyl ester (PC71BM) and (4,4-N,N-dicarbazole) biphenyl (CBP) doped with tris(2-phenylpyridine) iridium(iii) (Ir(ppy)3) as active/emissive layers, respectively. We synthesized nitrogen doped graphene and used it as anodic buffer layer in both devices. The localized surface plasmon resonance (LSPR) effect from Au NDs clearly contributed to the increase in light absorption/emission in the active layers from electromagnetic field enhancement, which originated from the excited LSPR in PSCs and PLEDs. In addition to the high density of LSPR and strong exciton-SP coupling, the electroluminescent (EL) enhancement is ascribed to enhanced spontaneous emission rates. This is due to the plasmonic near-field effect induced by Au NDs. The PSCs and PLEDs exhibited 14.98% (8.08% to 9.29%) under one sun of simulated air mass 1.5 global (AM1.5G) illumination (100 mW cm(-2)) and 19.18% (8.24 to 9.82 lm W(-1)) enhancement in the power conversion efficiencies (PCEs) compared to the control devices without Au NDs.