Displaying publications 1 - 20 of 32 in total

Abstract:
Sort:
  1. Hawkins BR
    PMID: 4790793
    Matched MeSH terms: Hemoglobinopathies/genetics; Hemoglobinopathies/epidemiology
  2. Lie-Injo LE
    Acta Haematol., 1973;49(1):25-35.
    PMID: 4632449 DOI: 10.1159/000208382
    Newborns were examined for the presence of slow-moving haemoglobin components, tentatively designated X components and previously found in a group of Hb H disease in which invariably one of the parents of each patient had the same slow-moving Hb X components also. Structural studies showed that the abnormal haemoglobin in Chinese was identical with Hb Constant Spring, an c-chain variant. Newborns with Hb Bart’s and slow-moving X components invariably had one parent with the X components also. When the child grew older Hb Bart’s disappeared while the Hb X components remained in the blood. The homozygous state for the X components was found in a Malay boy through his newborn brother who had the X components in addition to Hb Bart’s and had both parents with the X components. One other Malay baby had the X components and Hb A2 Indonesia inherited from the parents. The present study of newborns also showed that Hb Bart’s can accompany different abnormalities of haemoglobin production, involving alpha-chains, beta-chains as well as gamm-chains. Its presence in cord blood is, therefore, not specific for alpha-thalassaemia
    Key Words: Haemoglobinopathies; Hb Bart’s; Slow-moving Hb X; Thalassaemia
    Matched MeSH terms: Hemoglobinopathies/genetics*
  3. Lie-Injo LE, Lopez CG, Lopes M
    Acta Haematol., 1971;46(2):106-20.
    PMID: 4331171 DOI: 10.1159/000208565
    A study of 23 patients with Hb H disease and their 82 relatives in 17 families showed that 2 types of this condition exist. One is associated with the presence of a small slow-moving component, which we tentatively called the X component and which was invariably present in one parent. Some siblings also had it. The other type was not associated with this component. Two patients without X component had a newborn with Bart’s haemoglobin without X component. None of the parents of 20 newborns with Hb Bart’s without the X component had the X component. It was present in only one parent of each of 2 newborns with Hb Bart’s and the X component. They are thought to represent Hb H disease in the newborn period. We suggest that at least 3 abnormal genes may lead to Hb H disease, which results when 2 of the 3 combine. Severity of clinical and haematological symptoms depends upon which abnormal gene is present and which 2 are involved in any particular combination.
    Key Words: a-Thalassaemia; Haemoglobin Bart’s; Haemoglobin H disease; Haemoglobinopathies
    Matched MeSH terms: Hemoglobinopathies/complications; Hemoglobinopathies/genetics*
  4. Ong HC
    Acta Haematol., 1974;52(4):220-2.
    PMID: 4217527 DOI: 10.1159/000208244
    Haemoglobin E complicates 22.2°/o of pregnancy in Malaysian aborigines, the prevalence of variants associated with pregnancy being, 15.8% with Hb E trait abnormality, 3.9% with Hb E homozygous disease, and 2.5% with Hb E thalassaemia disease. Minor haematological abnormalities occur with the trait and homozygous conditions, though a more unfavourable response is expected with Hb E thalassaemia. Haemolysis is not a prominent feature and it is suggested that factors other than the haemoglobinopathic state
    probably accounts for any unfavourable response in pregnancy.
    Key Words: Haemoglobin E; Haemoglobinopathies; Haemolytic anaemias; Hb E thalassaemia; Malaysia; Pregnancy
    Study site: Hospital Orang Asli, Gombak, Selangor, Malaysia
    Matched MeSH terms: Hemoglobinopathies/blood
  5. Kountouris P, Stephanou C, Archer N, Bonifazi F, Giannuzzi V, Kuo KHM, et al.
    Am J Hematol, 2021 Nov 01;96(11):E416-E420.
    PMID: 34406671 DOI: 10.1002/ajh.26323
    Matched MeSH terms: Hemoglobinopathies/genetics*
  6. Eng LI, Baer A, Lewis AN, Welch QB
    Am J Hum Genet, 1973 Jul;25(4):382-7.
    PMID: 4716657
    Matched MeSH terms: Hemoglobinopathies/genetics; Hemoglobinopathies/epidemiology*
  7. Tan AM, Ha C, Li CF, Chan GC, Lee V, Tan PL, et al.
    Ann Acad Med Singap, 2016 Mar;45(3):106-9.
    PMID: 27146463
    Matched MeSH terms: Hemoglobinopathies/therapy*
  8. Hirsch RE, Sibmooh N, Fucharoen S, Friedman JM
    Antioxid Redox Signal, 2017 05 10;26(14):794-813.
    PMID: 27650096 DOI: 10.1089/ars.2016.6806
    SIGNIFICANCE: Oxidative stress and generation of free radicals are fundamental in initiating pathophysiological mechanisms leading to an inflammatory cascade resulting in high rates of morbidity and death from many inherited point mutation-derived hemoglobinopathies. Hemoglobin (Hb)E is the most common point mutation worldwide. The βE-globin gene is found in greatest frequency in Southeast Asia, including Thailand, Malaysia, Indonesia, Vietnam, Cambodia, and Laos. With the wave of worldwide migration, it is entering the gene pool of diverse populations with greater consequences than expected.

    CRITICAL ISSUES: While HbE by itself presents as a mild anemia and a single gene for β-thalassemia is not serious, it remains unexplained why HbE/β-thalassemia (HbE/β-thal) is a grave disease with high morbidity and mortality. Patients often exhibit defective physical development, severe chronic anemia, and often die of cardiovascular disease and severe infections. Recent Advances: This article presents an overview of HbE/β-thal disease with an emphasis on new findings pointing to pathophysiological mechanisms derived from and initiated by the dysfunctional property of HbE as a reduced nitrite reductase concomitant with excess α-chains exacerbating unstable HbE, leading to a combination of nitric oxide imbalance, oxidative stress, and proinflammatory events.

    FUTURE DIRECTIONS: Additionally, we present new therapeutic strategies that are based on the emerging molecular-level understanding of the pathophysiology of this and other hemoglobinopathies. These strategies are designed to short-circuit the inflammatory cascade leading to devastating chronic morbidity and fatal consequences. Antioxid. Redox Signal. 26, 794-813.

    Matched MeSH terms: Hemoglobinopathies/drug therapy*; Hemoglobinopathies/metabolism; Hemoglobinopathies/physiopathology*
  9. Lie-Injo LE, Ganesan J, Clegg JB, Weatherall DJ
    Blood, 1974 Feb;43(2):251-9.
    PMID: 4810076
    Matched MeSH terms: Hemoglobinopathies/genetics*
  10. Shang X, Peng Z, Ye Y, Asan, Zhang X, Chen Y, et al.
    EBioMedicine, 2017 Sep;23:150-159.
    PMID: 28865746 DOI: 10.1016/j.ebiom.2017.08.015
    Hemoglobinopathies are among the most common autosomal-recessive disorders worldwide. A comprehensive next-generation sequencing (NGS) test would greatly facilitate screening and diagnosis of these disorders. An NGS panel targeting the coding regions of hemoglobin genes and four modifier genes was designed. We validated the assay by using 2522 subjects affected with hemoglobinopathies and applied it to carrier testing in a cohort of 10,111 couples who were also screened through traditional methods. In the clinical genotyping analysis of 1182 β-thalassemia subjects, we identified a group of additional variants that can be used for accurate diagnosis. In the molecular screening analysis of the 10,111 couples, we detected 4180 individuals in total who carried 4840 mutant alleles, and identified 186 couples at risk of having affected offspring. 12.1% of the pathogenic or likely pathogenic variants identified by our NGS assay, which were undetectable by traditional methods. Compared with the traditional methods, our assay identified an additional at-risk 35 couples. We describe a comprehensive NGS-based test that offers advantages over the traditional screening/molecular testing methods. To our knowledge, this is among the first large-scale population study to systematically evaluate the application of an NGS technique in carrier screening and molecular diagnosis of hemoglobinopathies.
    Matched MeSH terms: Hemoglobinopathies/diagnosis*; Hemoglobinopathies/genetics*; Hemoglobinopathies/epidemiology
  11. Loong TY, Chong DL, Jamal AR, Murad NA, Sabudin RZ, Fun LC
    EXCLI J, 2016;15:630-635.
    PMID: 28096792 DOI: 10.17179/excli2016-613
    Haemoglobin (Hb)-M Hyde Park, also known as Hb-M Akita is a rare type of hereditary Hb M due to autosomal dominant mutation of CAC>TAC on codon 92 of β globin gene resulting in the replacement of histidine by tyrosine on β globin chain. This variant Hb has a tendency to form methaemoglobin (metHb). The iron ion in metHb is oxidized to ferric (Fe3+) which is unable to carry oxygen and the patients manifest as cyanosis clinically. A 9-year-old Malay girl was incidentally found to be cyanotic when she presented to a health clinic. Laboratory investigations revealed raised methaemoglobin levels and Hb analysis findings were consistent with Hb-M Hyde Park. β gene sequencing confirmed a point mutation of CAC>TAC on codon 92 in one of the β genes. The family study done on the individuals with cyanosis showed similar findings. A diagnosis of heterozygous Hb-M Hyde Park was made. Patients with this variant Hb usually presented with cyanosis with mild haemolysis and maybe misdiagnosed as congenital heart disease. No further treatment is needed as patients are relatively asymptomatic. Although the disease is harmless in the heterozygous carriers but the offspring of the carriers may suffer severe haemolytic anaemia when the offspring also inherit other β haemoglobinopathies/thalassemia. This can happen due to high prevalence of β thalassemia carrier (3.5-4 %) found in Malaysia. At the time of writing, this is the first case of hereditary Hb-M Hyde Park diagnosed in a Malay family living in Malaysia.
    Matched MeSH terms: Hemoglobinopathies
  12. Saleem M, Yusoff NM
    Hematology, 2016 Oct;21(9):501-12.
    PMID: 26871368 DOI: 10.1080/10245332.2015.1106816
    OBJECTIVES: The new World Health Organization's (WHO) classification of haematopoietic and lymphoid tissue neoplasms incorporating the recurrent fusion genes as the defining criteria for different haematopoietic malignant phenotypes is reviewed. The recurrent fusion genes incorporated in the new WHO's classification and other chromosomal rearrangements of haematopoietic and lymphoid tissue neoplasms are reviewed.

    METHODOLOGY: Cytokines and transcription factors in haematopoiesis and leukaemic mechanisms are described. Genetic features and clinical implications due to the encoded chimeric neoproteins causing malignant haematopoietic disorders are reviewed.

    RESULTS AND DISCUSSION: Multiple translocation partner genes are well known for leukaemia such as MYC, MLL, RARA, ALK, and RUNX1. With the advent of more sophisticated diagnostic tools and bioinformatics algorithms, an exponential growth in fusion genes discoveries is likely to increase.

    CONCLUSION: Demonstration of fusion genes and their specific translocation breakpoints in malignant haematological disorders are crucial for understanding the molecular pathogenesis and clinical phenotype of cancer, determining prognostic indexes and therapeutic responses, and monitoring residual disease and relapse status.

    Matched MeSH terms: Hemoglobinopathies/genetics*
  13. Wong SC, Stoming TA, Efremov GD, Huisman TH
    Hemoglobin, 1989;13(1):1-5.
    PMID: 2703362
    DNA samples from numerous subjects of different racial and ethnic backgrounds, with or without various hemoglobinopathies (classical beta-thalassemia; silent beta-thalassemia, Hb E, sickle cell anemia), were studied for a rearrangement (+ATA; -T) at nucleotide -530 in the 5' flanking region of the beta-globin gene using amplified DNA and 32P-labeled synthetic oligonucleotide probes. The data show that this unusual sequence is a common feature among East-Asians and Blacks (particularly SS patients), and is not associated with mild thalassemic features typical for the silent form of beta-thalassemia, as has been suggested (5).
    Matched MeSH terms: Hemoglobinopathies/genetics
  14. Baig MA, Swamy KB, Baksh AD, Bahashwan A, Moshrif Y, Al Sawat A, et al.
    Indian J Pathol Microbiol, 2021 8 4;64(3):518-523.
    PMID: 34341263 DOI: 10.4103/IJPM.IJPM_709_20
    Background: : HPLC is one of the most important tools for accurate diagnosis of hemoglobinopathies and thalassemias. The advantage of the HPLC system is the excellent resolution, reproducibility &quantification of several normal and abnormal hemoglobin.

    Results: BIO RAD Variant II analyzer was used. Sickle cell syndromes including double heterozygous states accounted for 56.13% of total cases. HbSS, HbS/β0-th, HbS/β+-th β-thal trait comprises 29%, 6.5%, 5.1%& 10% of total cases respectively with mean MCV (fl) = 84, 68,71,64 respectively. The Mean HbA2 for β-thal trait, HbE trait &HbE-β thal showed 5.1 ± 1.1, 19 ± 9 & 24 ± 8 respectively. HbF is increased in 8.6% case (excluding SC syndromes & β-thal disorders), of these 5.5% were infants & 12 cases of Aplastic Anemias. Peak P2 >7% (2.4% cases) was seen in uncontrolled diabetes mellitus which on quantification showed HbA1C = 8 ± 2.1 mmol/L.

    Discussion: : HPLC in correlation with CBC parameters & family studies can aid in the diagnosis of majority of Hemoglobinopathies and thalassemic syndrome. The CBC & HPLC parameters of the present study are in good correlation with the research conducted by Tejinder Sing, RiouJ & Alla Joutovsky. Present study showed HPLC comprehensively characterizing HbS, A, A2, F, S, C, D from each other & was also applicable for the quantification of HbA1c for the monitoring of Diabetes Mellitus.

    Conclusion: : The merits of HPLC are small quantity of sample required, economical, less TAT, accurate categorization of HbS, HbA2 & F. But one has to be aware of the limitations and problems associated with this method due to variant hemoglobin within the same retention windows. The present findings show HPLC as an excellent & powerful diagnostic tool for the direct identification of hemoglobin variants with a high degree of precision in the quantification of normal and abnormal hemoglobin fractions.

    Matched MeSH terms: Hemoglobinopathies/blood; Hemoglobinopathies/diagnosis*
  15. Norlelawati, A.T., Siti Hadijah, M., Siti Nor Haiza, H., Rusmawati, I., Abdul Wahab, J., Naznin, M., et al.
    MyJurnal
    Introduction: Thalassaemia is an inherited blood disorder and is a significant public health alarm in Malaysia with many not knowing they are carriers of this haemoglobin disorders. Materials and methods: This study conducted a one off collection of blood samples from 72 Malays students of International Islamic University Malaysia (IIUM) in Kuantan. Blood samples were subjected to conventional haemoglobin analyses that include full blood count and picture, HPLC, Haemoglobin electrophoresis and H-inclusion test. All samples were also genotyped for alpha thalassaemia–1 of Southeast Asia (a-Thal1SEA). Result: There were 17(23.6%) students who were diagnosed as thalassaemia carriers. Out of this, four (5.5 %) and six (8.3 %) students were presumptive β-thalassaemia trait and Haemoglobin-E trait as determined by the HPLC assay respectively. Nine (12.5%) students were genotyped a-Thal1SEA among whom two were also β-thalassaemia carriers. All thalassaemia cases had MCH of < 27pg. Nonetheless, two out of six Haemoglobin-E trait and three out of nine a-Thal1SEA carrier had MCV value of >80fL. Two out of four (50%) presumptive β -thalassaemia trait and one out of six (17%) students of presumptive Haemoglobin-E trait had family history of thalassaemia respectively. Conclusion: The high occurrence of the three common types of thalassaemia carrier (β, Hb-E and a-Thal1SEA thalassaemia) in our small group of subjects could be due to better participation of students who had family history of thalassaemia. The study reaffirmed the importance of molecular study for detection of alpha-thalassaemia and the use of MCH value of
    Matched MeSH terms: Hemoglobinopathies
  16. Wong LP, George E, Tan JA
    J Community Genet, 2011 Jun;2(2):71-9.
    PMID: 22109791 DOI: 10.1007/s12687-011-0039-z
    Hemoglobin disorders which include thalassemias are the most common heritable disorders. Effective treatment is available, and these disorders can be avoided as identification of carriers is achievable using simple hematological tests. An in-depth understanding of the awareness, attitudes, perceptions, and screening reservations towards thalassemia is necessary, as Malaysia has a multi-ethnic population with different religious beliefs. A total of 13 focus group discussions (70 participants) with members of the general lay public were conducted between November 2008 and January 2009. Lack of knowledge and understanding about thalassemia leads to general confusions over differences between thalassemia carriers and thalassemia major, inheritance patterns, and the physical and psychologically impact of the disorder in affected individuals and their families. Although most of the participants have not been tested for thalassemia, a large majority expressed willingness to be screened. Views on prenatal diagnosis and termination of fetuses with thalassemia major received mixed opinions from participants with different religions and practices. Perceived stigma and discrimination attached to being a carrier emerged as a vital topic in some group discussions where disparity in the answers exhibited differences in levels of participants' literacy and ethnic origins. The two most common needs identified from the discussion were information and screening facilities. Participants' interest in knowing the severity of the disease and assessing their risk of getting the disorder may imply the health belief model as a possible means of predicting thalassemia public screening services. Findings provide valuable insights for the development of more effective educational, screening, and prenatal diagnostic services in the multi-ethnic Asian society.
    Matched MeSH terms: Hemoglobinopathies
  17. Irmi Elfina, R., Ezalia, E., Elizabeth, G., Wan Hayati, M.Y, Norhanim, A., Wahidah, A., et al.
    Medicine & Health, 2014;9(1):44-52.
    MyJurnal
    Thalassaemia screening programme has been conducted in Malaysia since 2004. The aim of the programme was to reduce the burden of the disease by identifying thalassaemia carriers. However, the response towards the screening activities was unsatisfactory as there was lack of public awareness against the importance of thalassaemia screening. An alternative approach is to screen blood donors. The purpose of this study was to observe the prevalence of thalassaemia carriers among healthy blood donors. Seven hundred and thirty eight healthy blood donors were screened in Hospital Tengku Ampuan Rahimah, Klang from July to September 2010 using cation-exchange high performance liquid chromatography (HPLC). Cases with haemoglobin variants were further analyzed by gel electrophoresis at alkaline pH. Result shows that the blood donors consisted of 413 Malays (56%), 162 Indians (22%), 148 Chinese (20%) and 15 others (2%). There were 19 (2.6%) individuals with haemoglobin E trait, six (0.8%) with co-inheritance of haemoglobin E and αα- thalassaemia and five (0.7%) with β-thalassaemia trait. Haemoglobin Constant Spring and haemoglobin A2 prime were observed in two (0.3%); and Haemoglobin Lepore and alpha chain variant in one (0.2%). αα-thalassaemia and normal haemoglobin A2 β-thalassaemia could not be excluded in 190 cases (26%), as they required deoxyribonucleic acid (DNA) studies for identification. Thalassaemia screening in blood donors is more feasible and effective. Therefore, a wider scale population screening including blood donors could benefit the existing thalassaemia screening programme in Malaysia.
    Matched MeSH terms: Hemoglobinopathies
  18. Delatycki MB, Alkuraya F, Archibald A, Castellani C, Cornel M, Grody WW, et al.
    Prenat Diagn, 2020 02;40(3):301-310.
    PMID: 31774570 DOI: 10.1002/pd.5611
    Reproductive carrier screening started in some countries in the 1970s for hemoglobinopathies and Tay-Sachs disease. Cystic fibrosis carrier screening became possible in the late 1980s and with technical advances, screening of an ever increasing number of genes has become possible. The goal of carrier screening is to inform people about their risk of having children with autosomal recessive and X-linked recessive disorders, to allow for informed decision making about reproductive options. The consequence may be a decrease in the birth prevalence of these conditions, which has occurred in several countries for some conditions. Different programs target different groups (high school, premarital, couples before conception, couples attending fertility clinics, and pregnant women) as does the governance structure (public health initiative and user pays). Ancestry-based offers of screening are being replaced by expanded carrier screening panels with multiple genes that is independent of ancestry. This review describes screening in Australia, Cyprus, Israel, Italy, Malaysia, the Netherlands, Saudi Arabia, the United Kingdom, and the United States. It provides an insight into the enormous variability in how reproductive carrier screening is offered across the globe. This largely relates to geographical variation in carrier frequencies of genetic conditions and local health care, financial, cultural, and religious factors.
    Matched MeSH terms: Hemoglobinopathies/genetics
  19. Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
    Matched MeSH terms: Hemoglobinopathies/genetics
  20. Lambeth JT, Burns-Cox CJ, MacLean R
    Radiology, 1970 May;95(2):413-5.
    PMID: 5439452 DOI: 10.1148/95.2.413
    Two patients with gout associated with the presence of an abnormal hemoglobin, Hb E, and hypersplenism are presented. Very large sclerotic-rimmed cystic erosions in the sacroiliac joints of both patients are unusual but characteristic of the skeletal lesions of gout. The hyperuricemia may be the result of the disordered nucleic acid metabolism associated with hemoglobin abnormality. The development of hypersplenism very likely accelerated this process and resulted in the clinical and radiographic manifestations of severe gout.
    INDEX TERMS: Blood, diseases • Blood, proteins • globin and Hemoglobin Compounds • Sacroiliac Joint trophy
    Study site: Hospital Gombak, Selangor, Malaysia
    Matched MeSH terms: Hemoglobinopathies/complications*
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links