MyMedR

Displaying publications 21 - 32 of 32 in total

Abstract:

Sort:

Haemoglobin Bart's and slow-moving haemoglobin x components in newborns. The homozygous state for the slow-moving X components in a Malay boy

Lie-Injo LE

Acta Haematol., 1973;49(1):25-35.
PMID: 4632449 DOI: 10.1159/000208382

Newborns were examined for the presence of slow-moving haemoglobin components, tentatively designated X components and previously found in a group of Hb H disease in which invariably one of the parents of each patient had the same slow-moving Hb X components also. Structural studies showed that the abnormal haemoglobin in Chinese was identical with Hb Constant Spring, an c-chain variant. Newborns with Hb Bart’s and slow-moving X components invariably had one parent with the X components also. When the child grew older Hb Bart’s disappeared while the Hb X components remained in the blood. The homozygous state for the X components was found in a Malay boy through his newborn brother who had the X components in addition to Hb Bart’s and had both parents with the X components. One other Malay baby had the X components and Hb A2 Indonesia inherited from the parents. The present study of newborns also showed that Hb Bart’s can accompany different abnormalities of haemoglobin production, involving alpha-chains, beta-chains as well as gamm-chains. Its presence in cord blood is, therefore, not specific for alpha-thalassaemia
Key Words: Haemoglobinopathies; Hb Bart’s; Slow-moving Hb X; Thalassaemia

Matched MeSH terms: Hemoglobinopathies/genetics*
Fulltext Thalassaemia and haemoglobinopathies in Brunei Darussalam

Ismail JB

Med J Malaysia, 1992 Jun;47(2):98-102.
PMID: 1494340

One thousand consecutive Brunei Darussalam patients referred with low Hb, and/or low MCV and MCH (Hb < 12.5g/dl, MCV < 76fl, MCH < 27pg) were studied in the laboratory for underlying haemoglobinopathies. 30.0% of such patients were proved to have either beta-thalassaemia trait, beta-thalassaemia major, Hb AE, Hb EE, Hb E beta-thalassaemia or Hb H disease. In some, the haemoglobin abnormality was not identified precisely. Alpha-thalassaemia was suspected in an additional 4.3% of cases but confirmation study by globin-chain synthesis was not available. Beta-thalassaemia trait which was the predominant disorder was equally distributed among the three major race groups of Brunei Darussalam. Hb E was found exclusive among the Malay population. Hb H disease appeared as more common among the Chinese or the Malays (p > 0.05). This study reveals that thalassaemia and haemoglobinopathies are prevalent in Brunei Darussalam.

Matched MeSH terms: Hemoglobinopathies/genetics; Hemoglobinopathies/epidemiology*
High frequencies of a rearrangement (+ATA; -T) at -530 to the beta-globin gene in different populations indicate the absence of a correlation with a silent beta-thalassemia determinant

Wong SC, Stoming TA, Efremov GD, Huisman TH

Hemoglobin, 1989;13(1):1-5.
PMID: 2703362

DNA samples from numerous subjects of different racial and ethnic backgrounds, with or without various hemoglobinopathies (classical beta-thalassemia; silent beta-thalassemia, Hb E, sickle cell anemia), were studied for a rearrangement (+ATA; -T) at nucleotide -530 in the 5' flanking region of the beta-globin gene using amplified DNA and 32P-labeled synthetic oligonucleotide probes. The data show that this unusual sequence is a common feature among East-Asians and Blacks (particularly SS patients), and is not associated with mild thalassemic features typical for the silent form of beta-thalassemia, as has been suggested (5).

Matched MeSH terms: Hemoglobinopathies/genetics
The distribution of blood genetic markers in immigrant Chinese populations

Hawkins BR

Acta Genet Med Gemellol (Roma), 1973;22:139-66.
PMID: 4790793
Matched MeSH terms: Hemoglobinopathies/genetics; Hemoglobinopathies/epidemiology
Genetic red cell abnormalities in Trengganu and Perlis (West Malaysia)

Eng LI, McKay DA, Govindasamy S

Southeast Asian J. Trop. Med. Public Health, 1971 Jun;2(2):133-9.
PMID: 5002823
Matched MeSH terms: Hemoglobinopathies/epidemiology
Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations

Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.

Public Health Genomics, 2015;18(1):60-4.
PMID: 25412720 DOI: 10.1159/000368342

BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.

Matched MeSH terms: Hemoglobinopathies/genetics
Fulltext First reported case of Haemoglobin-M Hyde Park in a Malay family living in Malaysia

Loong TY, Chong DL, Jamal AR, Murad NA, Sabudin RZ, Fun LC

EXCLI J, 2016;15:630-635.
PMID: 28096792 DOI: 10.17179/excli2016-613

Haemoglobin (Hb)-M Hyde Park, also known as Hb-M Akita is a rare type of hereditary Hb M due to autosomal dominant mutation of CAC>TAC on codon 92 of β globin gene resulting in the replacement of histidine by tyrosine on β globin chain. This variant Hb has a tendency to form methaemoglobin (metHb). The iron ion in metHb is oxidized to ferric (Fe3+) which is unable to carry oxygen and the patients manifest as cyanosis clinically. A 9-year-old Malay girl was incidentally found to be cyanotic when she presented to a health clinic. Laboratory investigations revealed raised methaemoglobin levels and Hb analysis findings were consistent with Hb-M Hyde Park. β gene sequencing confirmed a point mutation of CAC>TAC on codon 92 in one of the β genes. The family study done on the individuals with cyanosis showed similar findings. A diagnosis of heterozygous Hb-M Hyde Park was made. Patients with this variant Hb usually presented with cyanosis with mild haemolysis and maybe misdiagnosed as congenital heart disease. No further treatment is needed as patients are relatively asymptomatic. Although the disease is harmless in the heterozygous carriers but the offspring of the carriers may suffer severe haemolytic anaemia when the offspring also inherit other β haemoglobinopathies/thalassemia. This can happen due to high prevalence of β thalassemia carrier (3.5-4 %) found in Malaysia. At the time of writing, this is the first case of hereditary Hb-M Hyde Park diagnosed in a Malay family living in Malaysia.

Matched MeSH terms: Hemoglobinopathies
Fulltext HbE/β-Thalassemia and Oxidative Stress: The Key to Pathophysiological Mechanisms and Novel Therapeutics

Hirsch RE, Sibmooh N, Fucharoen S, Friedman JM

Antioxid Redox Signal, 2017 05 10;26(14):794-813.
PMID: 27650096 DOI: 10.1089/ars.2016.6806

SIGNIFICANCE: Oxidative stress and generation of free radicals are fundamental in initiating pathophysiological mechanisms leading to an inflammatory cascade resulting in high rates of morbidity and death from many inherited point mutation-derived hemoglobinopathies. Hemoglobin (Hb)E is the most common point mutation worldwide. The βE-globin gene is found in greatest frequency in Southeast Asia, including Thailand, Malaysia, Indonesia, Vietnam, Cambodia, and Laos. With the wave of worldwide migration, it is entering the gene pool of diverse populations with greater consequences than expected.
CRITICAL ISSUES: While HbE by itself presents as a mild anemia and a single gene for β-thalassemia is not serious, it remains unexplained why HbE/β-thalassemia (HbE/β-thal) is a grave disease with high morbidity and mortality. Patients often exhibit defective physical development, severe chronic anemia, and often die of cardiovascular disease and severe infections. Recent Advances: This article presents an overview of HbE/β-thal disease with an emphasis on new findings pointing to pathophysiological mechanisms derived from and initiated by the dysfunctional property of HbE as a reduced nitrite reductase concomitant with excess α-chains exacerbating unstable HbE, leading to a combination of nitric oxide imbalance, oxidative stress, and proinflammatory events.
FUTURE DIRECTIONS: Additionally, we present new therapeutic strategies that are based on the emerging molecular-level understanding of the pathophysiology of this and other hemoglobinopathies. These strategies are designed to short-circuit the inflammatory cascade leading to devastating chronic morbidity and fatal consequences. Antioxid. Redox Signal. 26, 794-813.

Matched MeSH terms: Hemoglobinopathies/drug therapy*; Hemoglobinopathies/metabolism; Hemoglobinopathies/physiopathology*
Viva-Asia Blood and Marrow Transplantation Groups - A Survey of Consortium Activity over a 12-year Period (2000 to 2011)

Tan AM, Ha C, Li CF, Chan GC, Lee V, Tan PL, et al.

Ann Acad Med Singap, 2016 Mar;45(3):106-9.
PMID: 27146463
Matched MeSH terms: Hemoglobinopathies/therapy*
Family with hereditary persistence of foetal haemoglobin

Boon WH

Med J Malaya, 1968 Sep;23(1):61-6.
PMID: 4237561
Matched MeSH terms: Hemoglobinopathies/genetics*
Fulltext Potential use of cord blood for Hb E hemoglobinopathy screening programme using capillary electrophoresis

Wan Mohd Saman WA, Hassan R, Mohd Yusoff S, Che Yaakob CA, Abdullah NA, Ghazali S, et al.

Malays J Pathol, 2016 Dec;38(3):235-239.
PMID: 28028293 MyJurnal

BACKGROUND: Thalassemia and hemoglobinopathies are inherited red blood cell disorders found worldwide. Hemoglobin (Hb) E disorder is one of the hemoglobinopathies known to have the high prevalence in South East Asia. Most of transfusion-dependent thalassemias were genotypically compound heterozygous Hb E/ β-thalassemia. In Malaysia, the national screening program for thalassemia was implemented for early pregnancy or secondary school girls; however many participants do not turn-up and missed the screening test. Screening for thalassemia using samples from cord blood is an alternative choice as it is a readily available source of blood and hence early detection of the disease. The purpose of this study was to determine the potential use of cord blood for the screening of HbE hemoglobinopathy by using capillary electrophoresis (CE).
METHODS: Cord blood samples were collected from 300 newborns of healthy mothers. Hematological parameters were determined and hemoglobin quantitation for all cord blood samples were performed using capillary electrophoresis system (CES) and high performance liquid chromatography (HPLC).
RESULTS: Majority of cord blood samples (63%) revealed Hb AF followed by Hb AFA2 (20%). Hb AFE was detected in 10.7% with the mean value of Hb E ranging from 2.3%-11.1%.
CONCLUSION: Hemoglobin E was detected in cord blood using capillary electrophoresis system. It can be recommended in areas where Hb E/β is prevalent. Implementation of a screening strategy using CE on cord blood sampling will identify the disease early. With regular follow-up on these patients, the status of their disease can be determined earlier and appropriate management implemented.

Matched MeSH terms: Hemoglobinopathies/diagnosis*
Evaluation of role of HPLC (Merits & Pitfalls), in the diagnosis of various hemoglobinopathies & thalassemic syndromes

Baig MA, Swamy KB, Baksh AD, Bahashwan A, Moshrif Y, Al Sawat A, et al.

Indian J Pathol Microbiol, 2021 8 4;64(3):518-523.
PMID: 34341263 DOI: 10.4103/IJPM.IJPM_709_20

Background: : HPLC is one of the most important tools for accurate diagnosis of hemoglobinopathies and thalassemias. The advantage of the HPLC system is the excellent resolution, reproducibility &quantification of several normal and abnormal hemoglobin.
Results: BIO RAD Variant II analyzer was used. Sickle cell syndromes including double heterozygous states accounted for 56.13% of total cases. HbSS, HbS/β0-th, HbS/β+-th β-thal trait comprises 29%, 6.5%, 5.1%& 10% of total cases respectively with mean MCV (fl) = 84, 68,71,64 respectively. The Mean HbA2 for β-thal trait, HbE trait &HbE-β thal showed 5.1 ± 1.1, 19 ± 9 & 24 ± 8 respectively. HbF is increased in 8.6% case (excluding SC syndromes & β-thal disorders), of these 5.5% were infants & 12 cases of Aplastic Anemias. Peak P2 >7% (2.4% cases) was seen in uncontrolled diabetes mellitus which on quantification showed HbA1C = 8 ± 2.1 mmol/L.
Discussion: : HPLC in correlation with CBC parameters & family studies can aid in the diagnosis of majority of Hemoglobinopathies and thalassemic syndrome. The CBC & HPLC parameters of the present study are in good correlation with the research conducted by Tejinder Sing, RiouJ & Alla Joutovsky. Present study showed HPLC comprehensively characterizing HbS, A, A2, F, S, C, D from each other & was also applicable for the quantification of HbA1c for the monitoring of Diabetes Mellitus.
Conclusion: : The merits of HPLC are small quantity of sample required, economical, less TAT, accurate categorization of HbS, HbA2 & F. But one has to be aware of the limitations and problems associated with this method due to variant hemoglobin within the same retention windows. The present findings show HPLC as an excellent & powerful diagnostic tool for the direct identification of hemoglobin variants with a high degree of precision in the quantification of normal and abnormal hemoglobin fractions.

Matched MeSH terms: Hemoglobinopathies/blood; Hemoglobinopathies/diagnosis*