Displaying publications 61 - 80 of 159 in total

Abstract:
Sort:
  1. Foong WC, Loh CK, Ho JJ, Lau DS
    Cochrane Database Syst Rev, 2023 Jan 13;1(1):CD013767.
    PMID: 36637054 DOI: 10.1002/14651858.CD013767.pub2
    BACKGROUND: Non-transfusion-dependent β-thalassaemia (NTDβT) is a subset of inherited haemoglobin disorders characterised by reduced production of the β-globin chain of haemoglobin leading to anaemia of varying severity. Although blood transfusion is not a necessity for survival, it may be required to prevent complications of chronic anaemia, such as impaired growth and hypercoagulability. People with NTDβT also experience iron overload due to increased iron absorption from food sources which becomes more pronounced in those requiring blood transfusion. People with a higher foetal haemoglobin (HbF) level have been found to require fewer blood transfusions, thus leading to the emergence of treatments that could increase its level. HbF inducers stimulate HbF production without altering any gene structures. Evidence for the possible benefits and harms of these inducers is important for making an informed decision on their use.

    OBJECTIVES: To compare the effectiveness and safety of the following for reducing blood transfusion for people with NTDβT: 1. HbF inducers versus usual care or placebo; 2. single HbF inducer with another HbF inducer, and single dose with another dose; and 3. combination of HbF inducers versus usual care or placebo, or single HbF inducer.

    SEARCH METHODS: We used standard, extensive Cochrane search methods. The latest search date was 21 August 2022.

    SELECTION CRITERIA: We included randomised controlled trials (RCTs) or quasi-RCTs comparing single HbF inducer with placebo or usual care, with another single HbF inducer or with a combination of HbF inducers; or comparing different doses of the same HbF inducer.

    DATA COLLECTION AND ANALYSIS: We used standard Cochrane methods. Our primary outcomes were blood transfusion and haemoglobin levels. Our secondary outcomes were HbF levels, the long-term sequelae of NTDβT, quality of life and adverse events.

    MAIN RESULTS: We included seven RCTs involving 291 people with NTDβT, aged two to 49 years, from five countries. We reported 10 comparisons using eight different HbF inducers (four pharmacological and four natural): three RCTs compared a single HbF inducer to placebo and seven to another HbF inducer. The duration of the intervention lasted from 56 days to six months. Most studies did not adequately report the randomisation procedures or whether and how blinding was achieved. HbF inducer against placebo or usual care Three HbF inducers, HQK-1001, Radix Astragali or a 3-in-1 combined natural preparation (CNP), were compared with a placebo. None of the comparisons reported the frequency of blood transfusion. We are uncertain whether Radix Astragali and CNP increase haemoglobin at three months (mean difference (MD) 1.33 g/dL, 95% confidence interval (CI) 0.54 to 2.11; 1 study, 2 interventions, 35 participants; very low-certainty evidence). We are uncertain whether Radix Astragali and CNP have any effect on HbF (MD 12%, 95% CI -0.74% to 24.75%; 1 study, 2 interventions, 35 participants; very low-certainty evidence). Only medians on haemoglobin and HbF levels were reported for HQK-1001. Adverse effects reported for HQK-1001 were nausea, vomiting, dizziness and suprapubic pain. There were no prespecified adverse effects for Radix Astragali and CNP. HbF inducer versus another HbF inducer Four studies compared a single inducer with another over three to six months. Comparisons included hydroxyurea versus resveratrol, hydroxyurea versus thalidomide, hydroxyurea versus decitabine and Radix Astragali versus CNP. No study reported our prespecified outcomes on blood transfusion. Haemoglobin and HbF were reported for the comparison Radix Astragali versus CNP, but we are uncertain whether there were any differences (1 study, 24 participants; low-certainty evidence). Different doses of the same HbF inducer Two studies compared two different types of HbF inducers at different doses over two to six months. Comparisons included hydroxyurea 20 mg/kg/day versus 10 mg/kg/day and HQK-1001 10 mg/kg/day, 20 mg/kg/day, 30 mg/kg/day and 40 mg/kg/day. Blood transfusion, as prespecified, was not reported. In one study (61 participants) we are uncertain whether the lower levels of both haemoglobin and HbF at 24 weeks were due to the higher dose of hydroxyurea (haemoglobin: MD -2.39 g/dL, 95% CI -2.80 to -1.98; very low-certainty evidence; HbF: MD -10.20%, 95% CI -16.28% to -4.12%; very low-certainty evidence). The study of the four different doses of HQK-1001 did not report results for either haemoglobin or HbF. We are not certain if major adverse effects may be more common with higher hydroxyurea doses (neutropenia: risk ratio (RR) 9.93, 95% CI 1.34 to 73.97; thrombocytopenia: RR 3.68, 95% CI 1.12 to 12.07; very low-certainty evidence). Taking HQK-1001 20 mg/kg/day may result in the fewest adverse effects. A combination of HbF inducers versus a single HbF inducer Two studies compared three combinations of two inducers with a single inducer over six months: hydroxyurea plus resveratrol versus resveratrol or hydroxyurea alone, and hydroxyurea plus l-carnitine versus hydroxyurea alone. Blood transfusion was not reported. Hydroxyurea plus resveratrol may reduce haemoglobin compared with either resveratrol or hydroxyurea alone (MD -0.74 g/dL, 95% CI -1.45 to -0.03; 1 study, 54 participants; low-certainty evidence). We are not certain whether the gastrointestinal disturbances, headache and malaise more commonly reported with hydroxyurea plus resveratrol than resveratrol alone were due to the interventions. We are uncertain whether hydroxyurea plus l-carnitine compared with hydroxyurea alone may increase mean haemoglobin, and reduce pulmonary hypertension (1 study, 60 participants; very low-certainty evidence). Adverse events were reported but not in the intervention group. None of the comparisons reported the outcome of HbF.

    AUTHORS' CONCLUSIONS: We are uncertain whether any of the eight HbF inducers in this review have a beneficial effect on people with NTDβT. For each of these HbF inducers, we found only one or at the most two small studies. There is no information on whether any of these HbF inducers have an effect on our primary outcome, blood transfusion. For the second primary outcome, haemoglobin, there may be small differences between intervention groups, but these may not be clinically meaningful and are of low- to very low-certainty evidence. Data on adverse effects and optimal doses are limited. Five studies are awaiting classification, but none are ongoing.

    Matched MeSH terms: Blood Transfusion
  2. Voon HY, Suharjono HN, Shafie AA, Bujang MA
    Taiwan J Obstet Gynecol, 2018 Jun;57(3):332-339.
    PMID: 29880160 DOI: 10.1016/j.tjog.2018.04.002
    OBJECTIVE: Postpartum hemorrhage remains the leading cause of maternal mortality in developing countries and a significant proportion of these cases are attributable to uterine atony. In contrast to the advances made in the treatment of postpartum hemorrhage, there has been few novel prophylactic agents. This study was undertaken to analyze the effectiveness of carbetocin compared to oxytocin for the prevention of postpartum hemorrhage, in the context of cesarean deliveries.

    MATERIALS AND METHODS: Major electronic databases were searched for randomized-controlled trials comparing carbetocin with oxytocin. Only trials involving cesarean deliveries were included. Non-randomized trials, non-cesarean deliveries, studies which did not directly compare carbetocin to oxytocin and studies which did not analyze the intended outcomes were excluded. Outcomes analysed were postpartum hemorrhage, additional use of uterotonic and transfusion requirement.

    RESULTS: Seven studies involving 2012 patients were included in the meta-analysis. There was a significant reduction in the rates of postpartum hemorrhage (RR 0.79; 95% CI 0.66 to 0.94; p = 0.009), use of additional uterotonics (RR 0.57; 95% CI 0.49 to 0.65; p 

    Matched MeSH terms: Blood Transfusion/statistics & numerical data
  3. Kwan MK, Chiu CK, Hasan MS, Tan SH, Loh LH, Yeo KS, et al.
    Spine (Phila Pa 1976), 2019 03 15;44(6):E348-E356.
    PMID: 30130336 DOI: 10.1097/BRS.0000000000002848
    STUDY DESIGN: Retrospective study.

    OBJECTIVE: To evaluate the perioperative outcome of dual attending surgeon strategy for severe adolescent idiopathic scoliosis (AIS) patients with Cobb angle more than or equal to 90°.

    SUMMARY OF BACKGROUND DATA: The overall complication rate for AIS remains significant and is higher in severe scoliosis. Various operative strategies had been reported for severe scoliosis. However the role of dual attending surgeon strategy in improving the perioperative outcome in severe scoliosis has not been investigated.

    METHODS: The patients were stratified into two groups, Cobb angles 90° to 100° (Group 1) and more than 100° (Group 2). Demographic, intraoperative, preoperative, and postoperative day 2 data were collected. The main outcome measures were intraoperative blood loss, use of allogeneic blood transfusion, operative time, duration of hospital stay postsurgery, and documentation of any perioperative complications.

    RESULTS: Eighty-five patients were recruited. The mean age for the whole cohort was 16.2 ± 5.2 years old. The mean age of Group 1 was 16.7 ± 5.7 and Group 2 was 15.6 ± 4.8 years old. The majority of the patients in both groups were Lenke 2 curves with the average Cobb angle of 93.9 ± 3.0° in Group 1 and 114.2 ± 10.2° in Group 2. The average operative time was 198.5 ± 47.5 minutes with an average blood loss of 1699.5 ± 939.3 mL. The allogeneic blood transfusion rate was 17.6%. The average length of stay postoperation was 71.6 ± 22.5 hours. When comparing the patients between Group 1 and Group 2, the operating time, total blood loss, allogeneic transfusion rate showed significant intergroup differences. Five complications were documented (one intraoperative seizure, one massive blood loss, one intraoperative loss of somatosensory evoked potential (SSEP) signal, and two superficial wound breakdown).

    CONCLUSION: Dual attending surgeon strategy in severe AIS more than or equal to 90° demonstrated an average operative time of 199 minutes, intraoperative blood loss of 1.7 L, postoperative hospital stay of 71.6 hours, and a complication rate of 5.9% (5/85 patients). Curves with Cobb angle more than 100° lead to longer operating time, greater blood loss, and allogeneic transfusion rate.

    LEVEL OF EVIDENCE: 4.

    Matched MeSH terms: Blood Transfusion/trends
  4. Mihara Y, Chung WH, Chiu CK, Hasan MS, Lee SY, Ch'ng PY, et al.
    Spine (Phila Pa 1976), 2020 Mar 15;45(6):381-389.
    PMID: 31574058 DOI: 10.1097/BRS.0000000000003274
    STUDY DESIGN: Retrospective study from a prospectively collected database.

    OBJECTIVE: To compare the perioperative outcome between after-hours and daytime surgery carried out by a dedicated spinal deformity team for severe Idiopathic Scoliosis (IS) patients with Cobb angle ≥ 90°.

    SUMMARY OF BACKGROUND DATA: There were concerns that after-hours corrective surgeries in severe IS have higher morbidity compared to daytime surgeries.

    METHODS: Seventy-one severe IS patients who underwent single-staged Posterior Spinal Fusion (PSF) were included. Surgeries performed between 08:00H and 16:59H were classified as "daytime" group and surgeries performed between 17:00H and 06:00H were classified as "after-hours" group. Perioperative outcome parameters were average operation start time and end time, operation duration, intraoperative blood loss, intraoperative hemodynamic parameters, preoperative and postoperative hemoglobin, blood transfusion rate, total patient-controlled anesthesia (PCA) morphine usage, length of postoperative hospitalization, and complications. Radiological variables assessed were preoperative and postoperative Cobb angle, side bending flexibility, number of fusion levels, number of screws used, Correction Rate, and Side Bending Correction Index.

    RESULTS: Thirty patients were operated during daytime and 41 patients were operated after-hours. The mean age was 16.1 ± 5.8 years old. The mean operation start time for daytime group was 11:31 ± 2:45H versus 19:10 ± 1:24H for after-hours group. There were no significant differences between both groups in the operation duration, intraoperative blood loss, intraoperative hemodynamic parameters, postoperative hemoglobin, hemoglobin drift, transfusion rate, length of postoperative hospitalization, postoperative Cobb angle, Correction Rate, and Side Bending Correction Index. There were four complications (1 SSEP loss, 1 massive blood loss, and 2 superficial wound infections) with no difference between daytime and after-hours group.

    CONCLUSION: After-hours elective spine deformity corrective surgeries in healthy ambulatory patients with severe IS performed by a dedicated spinal deformity team using dual attending surgeon strategy were as safe as those performed during daytime.

    LEVEL OF EVIDENCE: 4.

    Matched MeSH terms: Blood Transfusion/methods; Blood Transfusion/trends
  5. Chiu CK, Gani SMA, Chung WH, Mihara Y, Hasan MS, Chan CYW, et al.
    Spine (Phila Pa 1976), 2020 Aug 15;45(16):1128-1134.
    PMID: 32205708 DOI: 10.1097/BRS.0000000000003484
    STUDY DESIGN: Retrospective propensity score matching study.

    OBJECTIVE: To investigate whether menses affect intraoperative blood loss in female adolescent idiopathic scoliosis (AIS) patients undergoing posterior spinal fusion (PSF) surgeries.

    SUMMARY OF BACKGROUND DATA: There were concerns whether patients having menses will have higher intraoperative blood loss if surgery were to be done during this period.

    METHODS: This study included 372 females who were operated between May 2016 to May 2019. Fifty-five patients had menses during surgery (Group 1, G1) and 317 patients did not have menses during surgery (Group 2, G2). Propensity score matching (PSM) analysis with one-to-one, nearest neighbor matching technique and with a match tolerance of 0.001 was used. The main outcome measures were intraoperative blood loss (IBL), volume of blood salvaged, transfusion rate, preoperative hemoglobin, preoperative platelet, preoperative prothrombin time, preoperative activated partial thromboplastin time (APTT), international normalized ratio (INR), and postoperative hemoglobin. Postoperative Cobb angle and correction rate were also documented.

    RESULTS: At the end of PSM analysis, 46 patients from each group were matched and balanced. The average operation duration for G1 was 140.8 ± 43.0 minutes compared with 143.1 ± 48.3 minutes in G2 (P = 0.806). The intraoperative blood loss for G1 was 904.3 ± 496.3 mL and for G2 was 907.9 ± 482.8 mL (P = 0.972). There was no significant difference in terms of normalized blood loss (NBL), volume of blood salvaged during surgery, preoperative hemoglobin, postoperative hemoglobin, hemoglobin drift, estimated blood volume (EBV), IBL per EBV and IBL per level fused (P > 0.05). No postoperative complications were encountered in both groups. On average, the postoperative hospital stay was 3.5 ± 0.8 days for both groups (P = 0.143).

    CONCLUSION: Performing corrective surgery during the menstrual phase in female AIS patients is safe without risk of increased blood loss.

    LEVEL OF EVIDENCE: 4.

    Matched MeSH terms: Blood Transfusion
  6. Chan CYW, Lee SY, Ch'ng PY, Chung WH, Chiu CK, Hasan MS, et al.
    Spine (Phila Pa 1976), 2021 Jun 15;46(12):E663-E670.
    PMID: 33306608 DOI: 10.1097/BRS.0000000000003866
    STUDY DESIGN: Retrospective study.

    OBJECTIVE: To assess the learning curve of a dual attending surgeon strategy in severe adolescent idiopathic scoliosis patients.

    SUMMARY OF BACKGROUND DATA: The advantages of a dual attending surgeon strategy in improving the perioperative outcome in scoliosis surgery had been reported. However, the learning curve of this strategy in severe scoliosis had not been widely studied.

    METHODS: A total of 105 patients with adolescent idiopathic scoliosis with Cobb angle of 90° or greater, who underwent posterior spinal fusion using a dual attending surgeon strategy were recruited. Primary outcomes were operative time, total blood loss, allogeneic blood transfusion requirement, length of hospital stay from time of operation and perioperative complications. Cases were sorted chronologically into group 1: cases 1 to 35, group 2: cases 36 to 70, and group 3: case 71 to 105. Mean operative time (≤193.3 min), total blood loss (≤1612.2 mL), combination of both and allogeneic blood transfusion were the selected criteria for receiver operating characteristic analysis of the learning curve.

    RESULTS: The mean Cobb angle was 104.5° ± 12.3°. The operative time, total blood loss, and allogeneic blood transfusion requirement reduced significantly for group 1 (220.6 ± 54.8 min; 2011.3 ± 881.8 mL; 12 cases) versus group 2 (183.6 ± 36.7 min; 1481.6 ± 1035.5 mL; 3 cases) and group 1 versus group 3 (175.6 ± 38.4 min; 1343.7 ± 477.8 mL; 3 cases) (P blood loss) (area under the curve 0.740; P blood loss when comparing group 1 versus group 2 and group 1 versus group 3. The cut-off point for the learning curve was 57 cases when the preset criteria were fulfilled (≤193.3 min operative time and ≤1612.2 mL of total blood loss).Level of Evidence: 4.

    Matched MeSH terms: Blood Transfusion/statistics & numerical data
  7. Wong MH, Chee KH, Azman W
    Singapore Med J, 2009 Oct;50(10):e362-4.
    PMID: 19907876
    A 40-year-old Malay woman presented with increasing lethargy, palpitation and shortness of breath, 17 years after a mitral and aortic valve replacement. A Starr-Edwards prosthetic valve replaced the mitral valve, and a Bjork-Shiley prosthetic valve replaced the aortic valve. Biochemical parameters demonstrated intravascular haemolysis, as evidenced by haemoglobin 7.8 g/dL, reticulocyte count 8.4%, lactate dehydrogenase 2,057 IU/L and low haptoglobulin levels (less than 6 mg/dL). Transoesophageal echocardiography revealed a paravalvular leakage over the mitral valve. The haemoglobin levels remained persistently low despite frequent blood transfusions. She successfully underwent a second mitral valve replacement. Her anaemia resolved subsequently.
    Matched MeSH terms: Blood Transfusion
  8. Dahlui M, Hishamshah MI, Rahman AJ, Aljunid SM
    Singapore Med J, 2009 Aug;50(8):794-9.
    PMID: 19710979
    The quality of life of transfusion-dependent thalassaemia patients is affected by the disease itself and iron overload complications from repeated blood transfusion. Desferrioxamine has been used to remove the excess iron, resulting in decreased mortality and morbidity. In Malaysia, a significant proportion of the transfusion-dependent thalassaemia patients are not prescribed desferrioxamine, due to its high cost, especially as it is not subsidized by the government. The aim of this study was to measure the quality of life of thalassaemia patients on desferrioxamine treatment.
    Matched MeSH terms: Blood Transfusion
  9. Ramli N, Rahmat K, Tan GP
    Singapore Med J, 2008 Jul;49(7):e175-7.
    PMID: 18695851
    Malignant osteopetrosis is associated with petrous carotid canal and internal carotid artery stenosis in the skull base. We present a four-year-old boy with malignant osteopetrosis who developed right frontal lobe infarction as a result of bilateral internal carotid artery hypotrophy.
    Matched MeSH terms: Blood Transfusion
  10. Abdul-Wahab J, Naznin M, Suhaimi A, Amir-Hamzah AR
    Singapore Med J, 2007 Jul;48(7):e206-8.
    PMID: 17609817
    Familial myelodysplastic syndrome occurring at a young age is a very rare childhood haematological malignancy. Two siblings, aged three and 18 years, from a consanguineous marriage, presented with pancytopenia and was subsequently diagnosed to have myelodysplastic syndrome. Both remained clinically stable throughout the illness. Splenectomy appeared to have fully corrected the cytopenia in one of them.
    Matched MeSH terms: Blood Transfusion/adverse effects
  11. Noor Haslina MN, Ariffin N, Illuni Hayati I, Rosline H
    Singapore Med J, 2007 Oct;48(10):922-5.
    PMID: 17909677
    Thalassaemia is one of the major public health problems in Malaysia. Regular monthly blood transfusion remains the main treatment for severe thalassaemia patients. One of the complications of blood transfusion is the formation by the recipients of alloantibodies and autoantibodies against red blood cell (RBC) antigen. The purpose of this study was to determine the prevalence of RBC autoantibodies among multiple-transfused thalassaemic patients in our institution and factors that contribute to its development.
    Matched MeSH terms: Blood Transfusion/adverse effects*
  12. George E, Wong HB, George R, Ariffin WA
    Singapore Med J, 1994 Feb;35(1):62-4.
    PMID: 8009283
    Patients on a moderate red cell transfusion programme have iron overload where the concentrations of the serum ferritin were inappropriate to increases in the transfusion load as a result of limitations of apoferritin synthesis and conversion of ferritin into haemosiderin. This study confirms the limitations for the use of estimations of the serum ferritin to evaluate the iron status in patients with expected high overload as would be seen in patients on many years of maintenance red cell transfusions in the absence of iron chelation therapy. Poor compliance, inadequate dosage of Desferal (deferoxamine), and the late initiation of iron chelation therapy were factors that were considered in the patients with failure of response to iron chelation.
    Matched MeSH terms: Blood Transfusion*
  13. George E, Wong HB
    Singapore Med J, 1993 Dec;34(6):500-3.
    PMID: 8153710
    Patients with the Hb beta + [IVS 1-5 (G-->C)] clinically presented as beta-thalassaemia intermedia and remained asymptomatic in the absence of blood transfusions. With or without blood transfusions the patients were short and had moderate to marked thalassaemia facies. Children who received blood transfusions showed progressive iron loading with age. The serum ferritin and serum alanine transaminase levels were significantly raised in the patients who were given blood transfusions. In the presence of blood transfusions, and absence of adequate iron chelation therapy, splenectomy became an inevitable event at some stage of the disease because of increasing transfusing requirements.
    Matched MeSH terms: Blood Transfusion
  14. Tan KK, Lee WS, Liaw LC, Oh A
    Singapore Med J, 1993 Apr;34(2):109-11.
    PMID: 8266145
    Two hundred and eleven blood transfusions were administered to 26 multi-transfused thalassemic children (aged 9 months-13 years) over a 6-month period. Eighteen children were receiving buffy coat-poor packed red cells (PRC) prepared by centrifuge while 8 children received filtered blood through a leucocyte-filter (Sepacell R-500A). Transfusion reactions occurred in 8.5% (n = 18) of transfusions and in 42.3% (n = 11) of patients. 11.9% (n = 16) and 2.6% (n = 2) of reactions occurred in 50% (n = 9) and 25% (n = 2) of patients receiving buffy coat-poor PRC and filtered blood respectively. Transfusion reactions in toto were significantly reduced in the group receiving filtered blood (p < 0.05). However, febrile reaction alone was not significantly reduced (p > 0.1). The median onset and duration of reaction were 2 hours (range 10 minutes-18 hours) and 4 hours (range 1/2-24 hours) respectively. 72.2% (n = 13) of the reactions occurred occurred during transfusion. 88.8% (n = 16) of the reactions caused only one symptom. 19.2% (n = 5) of all patients had recurrent reactions, all of them receiving buffy coat-poor PRC. The commonest clinical manifestation was fever (n = 7), followed by urticaria (n = 5) and petechial rash (n = 2). The outcome was good, with no patient experiencing symptoms exceeding 24 hours. Only 0.9% (n = 2) of the transfusions were discontinued.
    Matched MeSH terms: Blood Transfusion/adverse effects*; Blood Transfusion/methods
  15. Reddy SV, Sein K
    Singapore Med J, 1991 Feb;32(1):29-30.
    PMID: 2017701
    Sixty patients who received massive blood transfusion intraoperatively and/or in the immediate post-operative period were analysed. Six patients had hypokalemia and two had hyperkalemia. The multifactorial changes leading to electrolyte disturbances especially involving potassium are discussed in relation to hypotension, hypothermia, acidosis, pH, and release of catecholamine. Potassium changes in relation to anaesthesia are discussed. The danger of routine administration of calcium during massive blood transfusion is stressed.
    Matched MeSH terms: Blood Transfusion/methods*
  16. Tan KA, Lum SH, Yahya A, Krishnan S, Jalaludin MY, Lee WS
    Singapore Med J, 2019 Jun;60(6):303-308.
    PMID: 30556093 DOI: 10.11622/smedj.2018155
    INTRODUCTION: Endocrine dysfunction due to iron overload secondary to frequent blood transfusions is a common complication in children with transfusion-dependent thalassaemia (TDT). We ascertained the prevalence of endocrine dysfunction in children with TDT seen in a hospital setting in Malaysia.

    METHODS: We reviewed all patients with TDT who had ≥ 8 blood transfusions per year. Patients who had a history of stem cell transplantation, concurrent autoimmune diseases or were newly diagnosed to have TDT were excluded. Standard diagnostic criteria were used in the diagnosis of various endocrine dysfunctions.

    RESULTS: Of the 82 patients with TDT, 65% had at least one endocrine dysfunction. Short stature was the commonest (40.2%), followed by pubertal disorders (14.6%), hypoparathyroidism (12.3%), vitamin D deficiency (10.1%), hypocortisolism (7.3%), diabetes mellitus (5.2%) and overt hypothyroidism (4.9%). Subclinical hypothyroidism and pre-diabetes mellitus were seen in 13.4% and 8.6% of the patients, respectively. For children aged < 10 years, the prevalence of both thyroid dysfunction and hypoparathyroidism was 9.1%.

    CONCLUSION: Two-thirds of children with TDT experienced at least one endocrine dysfunction. Thyroid dysfunction and hypoparathyroidism may be missed if endocrine screening is only performed in children with TDT > 10 years of age. Close monitoring for endocrine dysfunction and hormonal therapy is essential to prevent long-term adverse outcomes.

    Matched MeSH terms: Blood Transfusion*
  17. Kho SL, Chua KH, George E, Tan JA
    Sci Rep, 2015;5:13937.
    PMID: 26365497 DOI: 10.1038/srep13937
    Homozygosity for the α-thalassaemia Southeast Asian (α-SEA) and Filipino β°-thalassaemia (β-FIL) deletions can cause serious complications leading to foetal death or life-long blood transfusions. A rapid and accurate molecular detection assay is essential in populations where the deletions are common. In this study, gap-polymerase chain reaction (PCR) with high resolution melting (HRM) analysis was developed to detect both the large deletions. Melting curves at 86.9 ± 0.1 °C were generated by normal individuals without the α-SEA deletion, 84.7 ± 0.1 °C by homozygous α-SEA deletion individuals and two melting curves at 84.7 ± 0.1 °C and 86.9 ± 0.1 °C by α-SEA deletion carriers. Normal individuals without the β-FIL deletion produce amplicons with a melting temperature (Tm) at 74.6 ± 0.1 °C, homozygous β-FIL individuals produce amplicons with Tm at 73.6 ± 0.1 °C and heterozygous β-FIL individuals generate two amplicons with Tm at 73.6 ± 0.1 °C and 74.6 ± 0.1 °C. Evaluation using blinded tests on 220 DNA samples showed 100% sensitivity and specificity. The developed assays are sensitive and specific for rapid molecular and prenatal diagnosis for the α-SEA and β-FIL deletions.
    Matched MeSH terms: Blood Transfusion
  18. Norsuzilawati Abdullah, Noor Hamizah Mohd Hassan, Mohd Muhaimin Kambali
    Q Bulletin, 2019;1(28):18-25.
    MyJurnal
    The platelet concentrates (PCs) is used for the treatment and prevention of bleeding in patients with reduced platelet number or function. The prepared platelet concentrates (PCs) must meet the specified quality control (QC) test standards. PCs that do not meet QC standards will reduce the efficacy of patient care and increase the need of repeated PC transfusion. According to the standards, at least 75% PCs tested should contain more than 60 x 109 per platelet count units. Hence, the objective of this study was to increase the percentage of PCs that meet the platelet count standard to more or equal to 75%.
    A cross sectional study was conducted from May 2015 to March 2016. Data were collected and analysed through monthly PCs QC test results. A retrospective QC data review in March and April 2015 showed only 30% PCs achieved the platelet count standard for QC tests. Intervention package was implemented to tackle the identified risk factors that lead to platelet count problems that do not meet the standards.
    The post remedial results showed an increase to 90% of PCs that meet platelet count standards in January to February 2016. The study also found that the rate of platelet count increment in patients after PCs transfusion increased from 5 x 109 per ml to 9 x 109 per ml after the study. Additionally, the repeated PC transfusion rate decreased from 22% to 18%. Achievements were successfully maintained after the study which was 89% in March to April 2017. Continuous monitoring need to be carried out to ensure the achievement remains in compliance with the established standards. This quality improvement method has facilitated successful platelet transfusion to patient by improving the quality and performance of PCs. The improvement strategies of this study have the potential to be implemented at other blood collection centers in order to improve the quality of healthcare services.
    Matched MeSH terms: Blood Transfusion
  19. Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
    Matched MeSH terms: Blood Transfusion/methods*
  20. Mohd Suan MA, Said SM, Lim PY, Azman AZF, Abu Hassan MR
    PLoS One, 2019;14(10):e0224459.
    PMID: 31661525 DOI: 10.1371/journal.pone.0224459
    Hepatitis C infection is a global public health problem. This study was designed to identify the risk factors associated with hepatitis C infection among adult patients in Kedah state, Malaysia. A matched, hospital-based, case-control study was conducted at a tertiary hospital. Cases were adult (aged ≥ 18 years) patients with positive serology test results for hepatitis C virus antibody and detectable hepatitis C virus RNA from January 2015 to December 2018, and controls were age-, sex- and ethnicity-matched patients who were not infected with hepatitis C virus. Self-administered questionnaires were used to collect data on demographic characteristics and previous exposure to selected risk factors among the study participants. Associations between hepatitis C and demographic and risk factors were assessed using univariable and multivariable logistic regression analyses. A total of 255 case-control patient pairs were enrolled. The multivariable analysis indicated that having a history of blood or blood product transfusion before 1992 (adjusted odds ratio [AOR] = 6.99, 95% confidence interval [CI]: 3.73-13.81), injection drug use (AOR = 6.60, 95% CI: 3.66-12.43), imprisonment (AOR = 4.58, 95% CI: 1.62-16.40), tattooing (AOR = 3.73, 95% CI: 1.37-12.00), having more than one sexual partner (AOR = 2.06, 95% CI: 1.16-3.69), piercing (AOR = 1.71, 95% CI: 1.04-2.80), and having only secondary education (AOR = 1.92, 95% CI: 1.06-3.57) were independently associated with hepatitis C. No associations were found between health care occupation, needle-prick injury, surgical procedures, haemodialysis, acupuncture, cupping, or contact sports and hepatitis C infection. These findings demonstrate that hepatitis C risk is multifactorial. Having a history of blood or blood product transfusion before 1992, injection drug use, imprisonment, tattooing, having more than one sexual partner, piercing, and having only secondary education were associated with increased odds of hepatitis C.
    Matched MeSH terms: Blood Transfusion
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links