Displaying all 14 publications

Abstract:
Sort:
  1. Teh SH, Ong GB
    Med J Malaysia, 2007 Oct;62(4):345-6.
    PMID: 18551945 MyJurnal
    Beckwith-Wiedemann Syndrome (BWS) is associated with early development of embryonal tumours usually in the first four years of life. We describe a patient who presented with a right adrenal cyst in the first month of life and hepatoblastoma in the third month of life. A cavernous haemangioma was subsequently found in the resected tumour.
  2. Pan KL, Ong GB, Potukuchi AP
    Med J Malaysia, 2006 Dec;61 Suppl B:55-7.
    PMID: 17600994
    We report a case of an 11-year-old boy with osteosarcoma of the proximal humerus treated with wide excision and reconstruction with a cement spacer-prosthesis. After seven years of follow-up, the patient is now almost a young adult. We present his current physical and functional status, which seems to defray the initial doubts regarding long-term problems when we chose this method of reconstruction.
  3. Pan K, Chan W, Shanmugam P, Ong G, Kamaruddin F, Tan S
    Malays Orthop J, 2014 Mar;8(1):32-6.
    PMID: 25347294 MyJurnal DOI: 10.5704/MOJ.1403.015
    Patients with extensive malignancies involving the femur often require total femoral replacement when their limbs can be salvaged. Reported series are small and involve heterogeneity of tumours. We present nine patients with osteosarcomas of the femur treated at our institution between 2003 and 2010 with a mean follow-up of 27 (6 to 56) months. Their ages ranged from 9 to 17 (mean 14 years). They had large volume tumours (mean 911 cm3) and presented late with a mean of 5.5 months from the onset of symptoms to definitive treatment. All patients underwent resection and total femur replacement. Six patients have died and two are alive with good function at the time of this report. One was lost to follow-up. These patients require a high level of treatment care and have a guarded prognosis.
  4. Pan K, Chan W, Ong G, Zulqarnaen M, Norlida D
    Malays Orthop J, 2012 Mar;6(1):57-60.
    PMID: 25279046 MyJurnal DOI: 10.5704/MOJ.1203.005
    This report details the case of a 12-year-old girl with a painful, progressive swelling of the medial portion of the clavicle with no history of trauma or other constitutional symptoms. All laboratory investigations were normal except for an elevated erythrocyte sedimentation rate (ESR). Initial plain radiographs showed a destructive lesion with magnetic resonance imaging showing features of malignancy. Biopsies revealed osteomyelitis, but with negative bacterial cultures and no evidence of malignancy. Treatment with antibiotics did not result in a favourable response. Over time, the swelling increased in size with episodic exacerbations of pain. Follow-up radiographs showed sclerosis and hyperostosis. After five years, this was recognized as non-bacterial chronic recurrent osteomyelitis of the clavicle.
  5. Othman IS, Ibrahim H, Hii KC, Ong GB, Menon BS
    Med J Malaysia, 2009 Dec;64(4):325-6.
    PMID: 20954561 MyJurnal
    We describe a 5 1/2 year old boy who was diagnosed with mild autosomal recessive osteopetrosis based on the presence of bony sclerosis, extramedullary haematopoeisis, leukoerythroblastosis and visual impairment who had an allogeneic bone marrow transplant from a matched sibling donor. Conditioning regime was busulphan 16 mg/kg and cyclophosphamide 200 mg/kg. Apart from transient hypercalcaemia, there were no major post transplant complications. Four years post transplant, the extramedullary haematopoeisis has resolved completely with normal blood counts. Apart from a fracture after a trivial fall two months after transplant, he has not suffered any fracture related limb deformities.
  6. Pan KL, Chan WH, Ong GB, Premsenthil S, Zulkarnaen M, Norlida D, et al.
    World J Surg Oncol, 2012;10:105.
    PMID: 22681750 DOI: 10.1186/1477-7819-10-105
    Tumor prostheses currently give the best short- and medium-term results for limb-salvage reconstruction procedures in the treatment of bone tumors. However, in developing countries, the cost of a tumor prosthesis is beyond the reach of much of the population. We report the use of autoclaved tumor-bearing bone in 10 patients, as an affordable alternative to the use of prostheses.
  7. Ariffin H, Garcia JC, Daud SS, Ibrahim K, Aizah N, Ong GB, et al.
    Pediatr Blood Cancer, 2009 Jul;53(1):108-11.
    PMID: 19260099 DOI: 10.1002/pbc.21983
    Children with Down syndrome and acute megakaryoblastic leukemia (DS-AMKL) have been shown to have increased sensitivity to cytarabine based chemotherapy. The excellent prognosis in patients with DS-AMKL may be due to mutations in the GATA1 gene leading to reduced expression of the enzyme cytidine deaminase. This leads to a decreased ability to convert cytarabine into its inactive metabolite, resulting in high intracellular concentration of this cytotoxic agent. We report two cases of DS-AMKL with GATA1 mutations who had poor outcome. These patients had high expression levels of cytidine deaminase mRNA transcripts. We speculate that other factors can affect overall outcome in patients with DS-AMKL irrespective of the presence of GATA1 mutations.
  8. Ngo CT, Alhady M, Tan AK, Norlasiah IS, Ong GB, Chua CN
    Med J Malaysia, 2007 Mar;62(1):74-5.
    PMID: 17682579
    A 3-year-old girl with facial dysmorphic features suggestive of Cornelia de Lange syndrome was seen in the ophthalmology unit for a right leukocoria. The leukocoria was found to be caused by a large retinoblastoma and the right eye was enucleated. Chromosomal analysis revealed partial chromosome 13q deletion involving band 14 which is associated with a high risk of retinoblastoma. This case shows that patient with chromosome 13q deletion syndrome cannot be diagnosed based on dysmorphic features only. Chromosomal analysis is warranted in all infants with facial dysmorphism suggestive of Cornelia de Lange syndrome so that those with chromosome 13q deletion can be referred early for early detection of retinoblastoma.
  9. Ariffin H, Chan AS, Oh L, Abd-Ghafar S, Ong GB, Mohamed M, et al.
    Clin Genet, 2015 Nov;88(5):450-5.
    PMID: 25318593 DOI: 10.1111/cge.12525
    Type of cancer and age of onset in individuals with inherited aberrations in the tumour suppressor gene TP53 are variable, possibly influenced by genetic modifiers and different environmental exposure. Since 2009, the modified Chompret criteria (MCC) have been used to identify individuals for TP53 mutation screening. Using the TP53 mutation database maintained by the International Agency for Research on Cancer (IARC), we investigated if the MCC, mainly developed for a Caucasian population, was also applicable in Asia. We identified several differences in Asian families compared with similar Caucasian cohorts, suggesting that identification and management of Li-Fraumeni syndrome in Asia do not completely mirror that of North America and Western Europe. Early gastric cancer (<40 years) may be considered a new addition to the MCC especially for Asian families.
  10. Tang ASO, Wong QY, Tan YY, Chieng CH, Ko CT, Ong GB, et al.
    Med J Malaysia, 2021 Jan;76(1):51-55.
    PMID: 33510109
    INTRODUCTION: Sarawak has a population that is geographically and characteristically widely varied. This study aimed to determine the demographic profile of patients in Sarawak, Malaysia. Materials and Methods - A cross-sectional study was conducted in 2019 at four major haemophilia treatment centres in Kuching, Sibu, Bintulu and Miri Hospitals, Sarawak. Demographic and clinical data were collected with consents from patients.

    RESULTS AND DISCUSSION: Ninety-six haemophilia patients were identified - 79(82.3%) haemophilia A(HA) and 17(17.7%) haemophilia B(HB). Severe haemophilia patients were noted in 45.6% (36/79) of HA and 64.7% (11/17) of HB. In all 44.3% of the HA and 52.9% of the HB population had no identifiable family history of haemophilia. Two-thirds of the patients with severe HA were on prophylaxis [24/36 (66.7%)] and only onethird [4/11 (36.4%)] in severe HB. Inhibitors developed in 9/79 (11.4%) of the HA population [3/79 (3.8%) high responders]. The median inhibitor titre was not significantly different between the different treatment groups - on demand versus prophylaxis (1.0BU versus 2.0BU; z statistic -1.043, p-value 0.297, Mann-Whitney test). None of the patients developed inhibitory alloantibodies to factor IX. Four HA patients (5.1%) underwent immune tolerance induction where one case had a successful outcome. Three severe HA patients received emicizumab prophylaxis and showed remarkable reduction in bleeding events with no thromboembolic events being reported. One female moderate HA patient received PEGylated recombinant anti-haemophilic factor. Eleven patients underwent radiosynovectomy. One mild HB patient succumbed to traumatic intracranial bleeding. Our data reported a prevalence (per 100,000 males) of 5.40 cases for all severities of HA, 2.46 cases for severe HA; 1.16 cases for all severities of HB, and 0.75 cases for severe HB. The overall incidence of HA and HB was 1 in 11,500 and 1 in 46,000, respectively.

    CONCLUSION: This study outlines the Sarawakian haemophilia landscape and offers objective standards for forward planning. Shared responsibilities among all parties are of utmost importance to improve the care of our haemophilia population.

  11. Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
  12. Chong LA, Khalid F, Khoo TB, Teh SH, Kuan GL, Aina Mariana AM, et al.
    Med J Malaysia, 2017 02;72(1):32-36.
    PMID: 28255137 MyJurnal
    INTRODUCTION: Awareness for paediatric palliative care has resulted in the impetus for paediatrician-led palliative care services across Malaysia. However, there is paucity of local data on patients receiving hospital-based paediatric palliative care. We aim to review the clinical spectrum of patients referred to these services.

    METHODS: An observational study of children aged between 0-18 years receiving palliative care at 13 hospitals between 1st January and 31st December 2014 was carried out.

    RESULTS: There were 315 patients analysed, 90 (28.6%) and 46 (14.6%) were neonates and adolescents respectively. The main ICD-10 diagnostic categories for all patients were identified to be 'Congenital malformations, deformations and chromosomal abnormalities' 117 (37.1%), 'Diseases of nervous system' 76 (24.1%) and 'Neoplasms' 60 (19.0%). At referral 156 (50%) patients had holistic needs assessments. Patients with 'Diseases of nervous system' were assessed to have significantly more physical needs than the other two diagnostic categories. Majority of patients who knew of their diagnosis and prognosis were those with malignancy. Over a fifth of referrals were at their terminal admission. Of 144 who died, 111 (77.1%) had advanced care plans. There was bereavement follow-up in 98 (68.1%) patients.

    CONCLUSION: Patients referred for palliative care have varied diagnoses and needs. To ensure all paediatricians are competent to deliver quality care to all children, further education and training initiatives is imperative.

  13. Mohd Ibrahim H, Muda Z, Othman IS, Mohamed Unni MN, Teh KH, Thevarajah A, et al.
    BMJ Open, 2020 06 29;10(6):e037974.
    PMID: 32601117 DOI: 10.1136/bmjopen-2020-037974
    OBJECTIVE: Thalassaemia is the most common inherited blood disorder in Malaysia. This study aims to report the current status of thalassaemia in Malaysia and provide a comprehensive understanding of the disease through data obtained from the Malaysian Thalassaemia Registry.

    DESIGN: Data were extracted from the Malaysian Thalassaemia Registry, a web-based system accessible to enrolled users through www.mytalasemia.net.my.

    SETTING: The Malaysian Thalassaemia Registry data was recorded from reports obtained from 110 participating government and university hospitals in Malaysia.

    PARTICIPANTS: The patients were those attending the 110 participating hospitals for thalassaemia treatment.

    INTERVENTION: Data were collected from the Malaysian Thalassaemia Registry from 2007 until the fourth quarter of 2018.

    PRIMARY OUTCOME MEASURE: 7984 out of 8681 patients with thalassaemia registered in the Malaysian Thalassaemia Registry were reported alive.

    RESULTS: Majority of the patients were reported in the state of Sabah (22.72%); the largest age group affected was 5.0-24.9 years old (64.45%); the largest ethnic group involved was Malay (63.95%); and the major diagnosis was haemoglobin E/β-thalassaemia (34.37%). From the 7984 patients, 56.73% were on regular blood transfusions and 61.72% were on chelation therapy. A small fraction (14.23%) has undergone splenectomy, while the percentage of patients with severe iron overload (serum ferritin ≥5000 µg/L) reduced over time. However, cardiac complications are still the main cause of death in patients with thalassaemia.

    CONCLUSION: Data gathered into the registry can be used to understand the progression of the disorder, to monitor iron overload management and to improve the outcomes of treatment, to enhance preventive strategies, reduce healthcare burden and improve the quality of life. Sustainability of the Malaysian Thalassaemia Registry is important for surveillance of thalassaemia management in the country and help the national health authorities to develop more effective policies.

  14. Rajagopal R, Teng AJ, Jawin V, Wong OL, Mahsin H, Abd Rani NH, et al.
    Front Oncol, 2023;13:1278611.
    PMID: 37920166 DOI: 10.3389/fonc.2023.1278611
    INTRODUCTION: Advancements in genomic profiling led to the discovery of four major molecular subgroups in medulloblastoma (MB), which have now been incorporated into the World Health Organization classification of central nervous system tumors. The current study aimed to determine the prognostic significance of the MB molecular subgroups among children in Malaysia.

    METHODS: We assembled MB samples from children <18 years between January 2003 and June 2017 from four pediatric oncology centers in Malaysia. MB was sub-grouped using 850k DNA methylation testing at German Cancer Research Centre, Heidelberg, Germany.

    RESULTS: Fifty samples from patients diagnosed and treated as MB were identified. Two (4%) of the 50 patients' tumor DNA samples were insufficient for analysis. Of the remaining 48 patients, 41 (85%) samples were confirmed as MB, while for 7 (15%) patients, DNA methylation classification results were discrepant with the histopathological diagnosis of MB, with various other diagnoses. Of the 41 MB patients, 15 patients were stratified as standard-risk (SR), 16 patients as high-risk (HR), and ten as infants (age <3 years old). Molecular subgrouping of the whole cohort revealed four (14%) WNT, 11 (27%) SHH, 10 (24%) Group 3, and 16 (39%) Group 4. Treatment abandonment rates for older children and infants were 22.5% and 10%, respectively. After censoring treatment abandonment, for SR patients, the 5-year event-free survival (EFS) and overall survival (OS) were 43.1% ± 14.7% and 46.9 ± 15.6%, respectively, while in HR, 5-year EFS and OS were both 63.6% ± 14.5%. Infants had a 5-year EFS and OS of 55.6% ± 16.6% and 66.7% ± 15.7%, respectively. WNT tumors had the best 5y-OS, followed by Group 3, Group 4, and SHH in children ≥3 years old. In younger children, SHH MB patients showed favorable outcomes.

    CONCLUSION: The study highlights the importance of DNA methylation profiling for diagnostic accuracy. Most infants had SHH MB, and their EFS and OS were comparable to those reported in high-income countries. Due to the relatively small cohort and the high treatment abandonment rate, definite conclusions cannot be made regarding the prognostic significance of molecular subgroups of MB. Implementing this high-technology investigation would assist pathologists in improving the diagnosis and provide molecular subgrouping of MB, permitting subgroup-specific therapies.

Related Terms
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links