Displaying publications 1 - 20 of 32 in total

Abstract:
Sort:
  1. High frequencies of a rearrangement (+ATA; -T) at -530 to the beta-globin gene in different populations indicate the absence of a correlation with a silent beta-thalassemia determinant
    Wong SC, Stoming TA, Efremov GD, Huisman TH
    Hemoglobin, 1989;13(1):1-5.
    PMID: 2703362
    DNA samples from numerous subjects of different racial and ethnic backgrounds, with or without various hemoglobinopathies (classical beta-thalassemia; silent beta-thalassemia, Hb E, sickle cell anemia), were studied for a rearrangement (+ATA; -T) at nucleotide -530 in the 5' flanking region of the beta-globin gene using amplified DNA and 32P-labeled synthetic oligonucleotide probes. The data show that this unusual sequence is a common feature among East-Asians and Blacks (particularly SS patients), and is not associated with mild thalassemic features typical for the silent form of beta-thalassemia, as has been suggested (5).
    Matched MeSH terms: Hemoglobinopathies/genetics
  2. Fulltext A holistic approach to education programs in thalassemia for a multi-ethnic population: consideration of perspectives, attitudes, and perceived needs
    Wong LP, George E, Tan JA
    J Community Genet, 2011 Jun;2(2):71-9.
    PMID: 22109791 DOI: 10.1007/s12687-011-0039-z
    Hemoglobin disorders which include thalassemias are the most common heritable disorders. Effective treatment is available, and these disorders can be avoided as identification of carriers is achievable using simple hematological tests. An in-depth understanding of the awareness, attitudes, perceptions, and screening reservations towards thalassemia is necessary, as Malaysia has a multi-ethnic population with different religious beliefs. A total of 13 focus group discussions (70 participants) with members of the general lay public were conducted between November 2008 and January 2009. Lack of knowledge and understanding about thalassemia leads to general confusions over differences between thalassemia carriers and thalassemia major, inheritance patterns, and the physical and psychologically impact of the disorder in affected individuals and their families. Although most of the participants have not been tested for thalassemia, a large majority expressed willingness to be screened. Views on prenatal diagnosis and termination of fetuses with thalassemia major received mixed opinions from participants with different religions and practices. Perceived stigma and discrimination attached to being a carrier emerged as a vital topic in some group discussions where disparity in the answers exhibited differences in levels of participants' literacy and ethnic origins. The two most common needs identified from the discussion were information and screening facilities. Participants' interest in knowing the severity of the disease and assessing their risk of getting the disorder may imply the health belief model as a possible means of predicting thalassemia public screening services. Findings provide valuable insights for the development of more effective educational, screening, and prenatal diagnostic services in the multi-ethnic Asian society.
    Matched MeSH terms: Hemoglobinopathies
  3. Fulltext Molecular characterisation of Haemoglobin Constant Spring and Haemoglobin Quong Sze with a Combine-Amplification Refractory Mutation System
    Wee YC, Tan KL, Chua KH, George E, Tan JA
    Malays J Med Sci, 2009 Jul;16(3):21-8.
    PMID: 22589661 MyJurnal
    BACKGROUND: The interaction of the non-deletional α(+)-thalassaemia mutations Haemoglobin Constant Spring and Haemoglobin Quong Sze with the Southeast Asian double α-globin gene deletion results in non-deletional Haemoglobin H disease. Accurate detection of non-deletional Haemoglobin H disease, which is associated with severe phenotypes, is necessary as these mutations have been confirmed in the Malaysian population.
    METHODS: DNA from two families with Haemoglobin H disease was extracted from EDTA-anticoagulated whole blood and subjected to molecular analysis for α-thalassaemia. A duplex polymerase chain reaction was used to detect the Southeast Asian α-globin gene deletion. Polymerase chain reaction-restriction fragment length polymorphism analysis was then carried out to determine the presence of Haemoglobin Constant Spring and Haemoglobin Quong Sze. A combine-amplification refractory mutation system protocol was optimised and implemented for the rapid and specific molecular characterisation of Haemoglobin Constant Spring and Haemoglobin Quong Sze in a single polymerase chain reaction.
    RESULTS AND CONCLUSIONS: The combine-amplification refractory mutation system for Haemoglobin Constant Spring and Haemoglobin Quong Sze, together with the duplex polymerase chain reaction, provides accurate pre- and postnatal diagnosis of non-deletional Haemoglobin H disease and allows detailed genotype analyses using minimal quantities of DNA.
    KEYWORDS: Combine-ARMS; Hb Constant Spring; Hb Quong Sze; medical sciences
    Matched MeSH terms: Hemoglobinopathies*
  4. Fulltext Potential use of cord blood for Hb E hemoglobinopathy screening programme using capillary electrophoresis
    Wan Mohd Saman WA, Hassan R, Mohd Yusoff S, Che Yaakob CA, Abdullah NA, Ghazali S, et al.
    Malays J Pathol, 2016 Dec;38(3):235-239.
    PMID: 28028293 MyJurnal
    BACKGROUND: Thalassemia and hemoglobinopathies are inherited red blood cell disorders found worldwide. Hemoglobin (Hb) E disorder is one of the hemoglobinopathies known to have the high prevalence in South East Asia. Most of transfusion-dependent thalassemias were genotypically compound heterozygous Hb E/ β-thalassemia. In Malaysia, the national screening program for thalassemia was implemented for early pregnancy or secondary school girls; however many participants do not turn-up and missed the screening test. Screening for thalassemia using samples from cord blood is an alternative choice as it is a readily available source of blood and hence early detection of the disease. The purpose of this study was to determine the potential use of cord blood for the screening of HbE hemoglobinopathy by using capillary electrophoresis (CE).

    METHODS: Cord blood samples were collected from 300 newborns of healthy mothers. Hematological parameters were determined and hemoglobin quantitation for all cord blood samples were performed using capillary electrophoresis system (CES) and high performance liquid chromatography (HPLC).

    RESULTS: Majority of cord blood samples (63%) revealed Hb AF followed by Hb AFA2 (20%). Hb AFE was detected in 10.7% with the mean value of Hb E ranging from 2.3%-11.1%.

    CONCLUSION: Hemoglobin E was detected in cord blood using capillary electrophoresis system. It can be recommended in areas where Hb E/β is prevalent. Implementation of a screening strategy using CE on cord blood sampling will identify the disease early. With regular follow-up on these patients, the status of their disease can be determined earlier and appropriate management implemented.

    Matched MeSH terms: Hemoglobinopathies/diagnosis*
  5. Haemoglobin D trait in a Filipino family
    VELLA F
    Med J Malaya, 1958 Jun;12(4):602-4.
    PMID: 13577152
    Matched MeSH terms: Hemoglobinopathies*
  6. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations
    Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
    Matched MeSH terms: Hemoglobinopathies/genetics
  7. Viva-Asia Blood and Marrow Transplantation Groups - A Survey of Consortium Activity over a 12-year Period (2000 to 2011)
    Tan AM, Ha C, Li CF, Chan GC, Lee V, Tan PL, et al.
    Ann Acad Med Singap, 2016 Mar;45(3):106-9.
    PMID: 27146463
    Matched MeSH terms: Hemoglobinopathies/therapy*
  8. Fulltext Causes of low HbA1c in Malaysian university hospital
    Sthaneshwar P, Vethakkan SR, Wong CW
    Med J Malaysia, 2014 Aug;69(4):175-7.
    PMID: 25500845 MyJurnal
    INTRODUCTION: Glycohemoglobin (HbA1c) most accurately reflects the previous two to three months of glycaemic control. HbA1c should be measured regularly in all patients with diabetes, and values should be maintained below 7% to prevent the risk of chronic complications. Apart from the genetic variants of haemoglobins many other conditions also known to affect HbA1c measurements. In this study we evaluated the conditions that cause low HbA1c results.

    METHODS AND MATERIALS: The data was collected retrospectively HbA1c was measured in our laboratory by Biorad Variant II turbo 2.0. The method is based on chromatographic separation of HbA1c on a cation exchange cartridge. This method has been certified by National Glycohemoglobin Standardization Programme (NGSP). 58437 requests were received in a period of one year (January to December 2011). Medical records were reviewed to identify the conditions that might be associated with these low values.

    RESULTS: Among 58437 samples analysed, 53 patients had HbA1c levels < 4.0%. Fourteen patients had haemoglobinopathy. In 34 patients without Hb variants had conditions such as chronic liver disease, chronic kidney disease, haemolytic anaemia, pregnancy, and anaemia of chronic disease. Five non-pregnant individuals who were screened for diabetes mellitus had HbA1c levels < 4%.

    CONCLUSION: Our study underscores the importance of that both laboratories and the physicians should be aware of the factors that can influence the HbA1c results. The haematological status should be taken into consideration for proper interpretation of HbA1c results.
    Matched MeSH terms: Hemoglobinopathies
  9. Fulltext Rapid Targeted Next-Generation Sequencing Platform for Molecular Screening and Clinical Genotyping in Subjects with Hemoglobinopathies
    Shang X, Peng Z, Ye Y, Asan, Zhang X, Chen Y, et al.
    EBioMedicine, 2017 Sep;23:150-159.
    PMID: 28865746 DOI: 10.1016/j.ebiom.2017.08.015
    Hemoglobinopathies are among the most common autosomal-recessive disorders worldwide. A comprehensive next-generation sequencing (NGS) test would greatly facilitate screening and diagnosis of these disorders. An NGS panel targeting the coding regions of hemoglobin genes and four modifier genes was designed. We validated the assay by using 2522 subjects affected with hemoglobinopathies and applied it to carrier testing in a cohort of 10,111 couples who were also screened through traditional methods. In the clinical genotyping analysis of 1182 β-thalassemia subjects, we identified a group of additional variants that can be used for accurate diagnosis. In the molecular screening analysis of the 10,111 couples, we detected 4180 individuals in total who carried 4840 mutant alleles, and identified 186 couples at risk of having affected offspring. 12.1% of the pathogenic or likely pathogenic variants identified by our NGS assay, which were undetectable by traditional methods. Compared with the traditional methods, our assay identified an additional at-risk 35 couples. We describe a comprehensive NGS-based test that offers advantages over the traditional screening/molecular testing methods. To our knowledge, this is among the first large-scale population study to systematically evaluate the application of an NGS technique in carrier screening and molecular diagnosis of hemoglobinopathies.
    Matched MeSH terms: Hemoglobinopathies/diagnosis*; Hemoglobinopathies/genetics*; Hemoglobinopathies/epidemiology
  10. Fusion genes in malignant neoplastic disorders of haematopoietic system
    Saleem M, Yusoff NM
    Hematology, 2016 Oct;21(9):501-12.
    PMID: 26871368 DOI: 10.1080/10245332.2015.1106816
    OBJECTIVES: The new World Health Organization's (WHO) classification of haematopoietic and lymphoid tissue neoplasms incorporating the recurrent fusion genes as the defining criteria for different haematopoietic malignant phenotypes is reviewed. The recurrent fusion genes incorporated in the new WHO's classification and other chromosomal rearrangements of haematopoietic and lymphoid tissue neoplasms are reviewed.

    METHODOLOGY: Cytokines and transcription factors in haematopoiesis and leukaemic mechanisms are described. Genetic features and clinical implications due to the encoded chimeric neoproteins causing malignant haematopoietic disorders are reviewed.

    RESULTS AND DISCUSSION: Multiple translocation partner genes are well known for leukaemia such as MYC, MLL, RARA, ALK, and RUNX1. With the advent of more sophisticated diagnostic tools and bioinformatics algorithms, an exponential growth in fusion genes discoveries is likely to increase.

    CONCLUSION: Demonstration of fusion genes and their specific translocation breakpoints in malignant haematological disorders are crucial for understanding the molecular pathogenesis and clinical phenotype of cancer, determining prognostic indexes and therapeutic responses, and monitoring residual disease and relapse status.

    Matched MeSH terms: Hemoglobinopathies/genetics*
  11. Fulltext Evaluation of red blood cell indices related disorders among eligible blood donors at the Universiti Putra Malaysia (UPM)
    Riahi S, Mei IL, Idris FB, George E, Noor SM
    Southeast Asian J. Trop. Med. Public Health, 2015 Sep;46(5):911-7.
    PMID: 26863862
    Pre-donation screening declarations and hemoglobin (Hb) testing are measures used to determine the quality of donated blood. The copper sulphate (CuSo4) method used to screen for blood abnormalities can give inaccurate results if strict quality control is not applied. Blood donors who are carriers of thalassemia and those with mild iron deficiency anemia (IDA) are usually asymptomatic and frequently missed at blood donation. The aim of this study was to evaluate the red blood cell (RBC) indices related disorders among blood donors who were deemed qualified to donate blood after screening with CuSo4 method. One hundred fifty-eight volunteer blood donors at the Universiti Putra Malaysia (UPM), who had passed the CuSo4 screening method, were recruited for this study. Their bloods specimens were examined with a complete blood count. Subjects with a low mean corpuscular hemoglobin (MCH) level were examined further by checking a serum ferritin level, Hb quantification, and molecular analysis to examine for common RBC disorders. Fourteen point six percent of subjects had a low Hb level, two (1.3%) had IDA and four (2.5%) had thalassemia or some other hemoglobinopathy. Using a MCH level < 27 pg as a cut-off point, 58 subjects (36.7%) had suspected IDA, thalassemia or some other hemoglobinopathy. Eight point nine percent of subjects with a normal Hb level had thalassemia, and 3.8% had IDA. Malaysia has a high prevalence of thalassemia and other hemoglobinopathies. Pre-donation accurate screening is crucial to protect the quality of blood transfusion products. Public education regarding RBC disorders especially among blood donors is important.
    Matched MeSH terms: Hemoglobinopathies/blood; Hemoglobinopathies/etiology; Hemoglobinopathies/epidemiology*
  12. Fulltext Haemoglobin Sickle D Punjab: - a case report
    Rahimah A, Syahira Lazira O, Siti Hida HM, Faidatul Syazlin AH, Nur Aisyah A, Nik Hafidzah NM, et al.
    Med J Malaysia, 2014 Feb;69(1):42-3.
    PMID: 24814631 MyJurnal
    Haemoglobin S D-Punjab is a rare compound heterozygous haemoglobinopathy characterised by the presence of two β globin gene variants: Β6(GAG→GTG) and Β121(GAA→CAA). These patients' clinical and haematological features mimic haemoglobin S disease. We describe the first case of doubly heterozygous HbSD-Punjab from Malaysia managed with regular blood transfusion at the age of one. This case highlights the propensity for occurrence of rare phenotypes within our multi-ethnic population and emphasises the importance of accurate genotyping to avoid erroneous counselling, and to plan an effective patient management strategy before complication evolves.
    Matched MeSH terms: Hemoglobinopathies
  13. Fulltext Haemoglobin Lepore in a Malay family: a case report
    Pasangna J, George E, Nagaratnam M
    Malays J Pathol, 2005 Jun;27(1):33-7.
    PMID: 16676691
    A 2-year-old Malay boy was brought to the University Malaya Medical Centre for thalassaemia screening. Physical examination revealed thalassaemia facies, pallor, mild jaundice, hepatomegaly and splenomegaly. Laboratory investigations on the patient including studies on the parents lead to a presumptive diagnosis of homozygous Haemoglobin Lepore (Hb Lepore). The aim of this paper is to increase awareness of this rare disorder, this being the first case documented in Malaysia in a Malay. The case also demonstrates the need for this disorder to be included in the differential diagnosis of patients presenting clinically like thalassemia intermedia or thalassemia major. Accurate diagnosis would provide information necessary for prenatal diagnosis, proper clinical management and genetic counseling. The clinical, haematological and laboratory features of this disorder are discussed in this paper.
    Matched MeSH terms: Hemoglobinopathies/blood; Hemoglobinopathies/genetics*
  14. Haemoglobin E variants and pregnancy in Malaysian aborigines
    Ong HC
    Acta Haematol., 1974;52(4):220-2.
    PMID: 4217527 DOI: 10.1159/000208244
    Haemoglobin E complicates 22.2°/o of pregnancy in Malaysian aborigines, the prevalence of variants associated with pregnancy being, 15.8% with Hb E trait abnormality, 3.9% with Hb E homozygous disease, and 2.5% with Hb E thalassaemia disease. Minor haematological abnormalities occur with the trait and homozygous conditions, though a more unfavourable response is expected with Hb E thalassaemia. Haemolysis is not a prominent feature and it is suggested that factors other than the haemoglobinopathic state
    probably accounts for any unfavourable response in pregnancy.
    Key Words: Haemoglobin E; Haemoglobinopathies; Haemolytic anaemias; Hb E thalassaemia; Malaysia; Pregnancy
    Study site: Hospital Orang Asli, Gombak, Selangor, Malaysia
    Matched MeSH terms: Hemoglobinopathies/blood
  15. Fulltext Screening for thalassaemia among group of students of a higher institution – our experience
    Norlelawati, A.T., Siti Hadijah, M., Siti Nor Haiza, H., Rusmawati, I., Abdul Wahab, J., Naznin, M., et al.
    International Medical Journal Malaysia, 2011;10(1):3-6.
    MyJurnal
    Introduction: Thalassaemia is an inherited blood disorder and is a significant public health alarm in Malaysia with many not knowing they are carriers of this haemoglobin disorders. Materials and methods: This study conducted a one off collection of blood samples from 72 Malays students of International Islamic University Malaysia (IIUM) in Kuantan. Blood samples were subjected to conventional haemoglobin analyses that include full blood count and picture, HPLC, Haemoglobin electrophoresis and H-inclusion test. All samples were also genotyped for alpha thalassaemia–1 of Southeast Asia (a-Thal1SEA). Result: There were 17(23.6%) students who were diagnosed as thalassaemia carriers. Out of this, four (5.5 %) and six (8.3 %) students were presumptive β-thalassaemia trait and Haemoglobin-E trait as determined by the HPLC assay respectively. Nine (12.5%) students were genotyped a-Thal1SEA among whom two were also β-thalassaemia carriers. All thalassaemia cases had MCH of < 27pg. Nonetheless, two out of six Haemoglobin-E trait and three out of nine a-Thal1SEA carrier had MCV value of >80fL. Two out of four (50%) presumptive β -thalassaemia trait and one out of six (17%) students of presumptive Haemoglobin-E trait had family history of thalassaemia respectively. Conclusion: The high occurrence of the three common types of thalassaemia carrier (β, Hb-E and a-Thal1SEA thalassaemia) in our small group of subjects could be due to better participation of students who had family history of thalassaemia. The study reaffirmed the importance of molecular study for detection of alpha-thalassaemia and the use of MCH value of
    Matched MeSH terms: Hemoglobinopathies
  16. Fulltext First reported case of Haemoglobin-M Hyde Park in a Malay family living in Malaysia
    Loong TY, Chong DL, Jamal AR, Murad NA, Sabudin RZ, Fun LC
    EXCLI J, 2016;15:630-635.
    PMID: 28096792 DOI: 10.17179/excli2016-613
    Haemoglobin (Hb)-M Hyde Park, also known as Hb-M Akita is a rare type of hereditary Hb M due to autosomal dominant mutation of CAC>TAC on codon 92 of β globin gene resulting in the replacement of histidine by tyrosine on β globin chain. This variant Hb has a tendency to form methaemoglobin (metHb). The iron ion in metHb is oxidized to ferric (Fe3+) which is unable to carry oxygen and the patients manifest as cyanosis clinically. A 9-year-old Malay girl was incidentally found to be cyanotic when she presented to a health clinic. Laboratory investigations revealed raised methaemoglobin levels and Hb analysis findings were consistent with Hb-M Hyde Park. β gene sequencing confirmed a point mutation of CAC>TAC on codon 92 in one of the β genes. The family study done on the individuals with cyanosis showed similar findings. A diagnosis of heterozygous Hb-M Hyde Park was made. Patients with this variant Hb usually presented with cyanosis with mild haemolysis and maybe misdiagnosed as congenital heart disease. No further treatment is needed as patients are relatively asymptomatic. Although the disease is harmless in the heterozygous carriers but the offspring of the carriers may suffer severe haemolytic anaemia when the offspring also inherit other β haemoglobinopathies/thalassemia. This can happen due to high prevalence of β thalassemia carrier (3.5-4 %) found in Malaysia. At the time of writing, this is the first case of hereditary Hb-M Hyde Park diagnosed in a Malay family living in Malaysia.
    Matched MeSH terms: Hemoglobinopathies
  17. Homozygous state for Hb Constant Spring (slow-moving Hb X components)
    Lie-Injo LE, Ganesan J, Clegg JB, Weatherall DJ
    Blood, 1974 Feb;43(2):251-9.
    PMID: 4810076
    Matched MeSH terms: Hemoglobinopathies/genetics*
  18. Haemoglobin Bart's and slow-moving haemoglobin x components in newborns. The homozygous state for the slow-moving X components in a Malay boy
    Lie-Injo LE
    Acta Haematol., 1973;49(1):25-35.
    PMID: 4632449 DOI: 10.1159/000208382
    Newborns were examined for the presence of slow-moving haemoglobin components, tentatively designated X components and previously found in a group of Hb H disease in which invariably one of the parents of each patient had the same slow-moving Hb X components also. Structural studies showed that the abnormal haemoglobin in Chinese was identical with Hb Constant Spring, an c-chain variant. Newborns with Hb Bart’s and slow-moving X components invariably had one parent with the X components also. When the child grew older Hb Bart’s disappeared while the Hb X components remained in the blood. The homozygous state for the X components was found in a Malay boy through his newborn brother who had the X components in addition to Hb Bart’s and had both parents with the X components. One other Malay baby had the X components and Hb A2 Indonesia inherited from the parents. The present study of newborns also showed that Hb Bart’s can accompany different abnormalities of haemoglobin production, involving alpha-chains, beta-chains as well as gamm-chains. Its presence in cord blood is, therefore, not specific for alpha-thalassaemia
    Key Words: Haemoglobinopathies; Hb Bart’s; Slow-moving Hb X; Thalassaemia
    Matched MeSH terms: Hemoglobinopathies/genetics*
  19. Inheritance of haemoglobin H disease. A new aspect
    Lie-Injo LE, Lopez CG, Lopes M
    Acta Haematol., 1971;46(2):106-20.
    PMID: 4331171 DOI: 10.1159/000208565
    A study of 23 patients with Hb H disease and their 82 relatives in 17 families showed that 2 types of this condition exist. One is associated with the presence of a small slow-moving component, which we tentatively called the X component and which was invariably present in one parent. Some siblings also had it. The other type was not associated with this component. Two patients without X component had a newborn with Bart’s haemoglobin without X component. None of the parents of 20 newborns with Hb Bart’s without the X component had the X component. It was present in only one parent of each of 2 newborns with Hb Bart’s and the X component. They are thought to represent Hb H disease in the newborn period. We suggest that at least 3 abnormal genes may lead to Hb H disease, which results when 2 of the 3 combine. Severity of clinical and haematological symptoms depends upon which abnormal gene is present and which 2 are involved in any particular combination.
    Key Words: a-Thalassaemia; Haemoglobin Bart’s; Haemoglobin H disease; Haemoglobinopathies
    Matched MeSH terms: Hemoglobinopathies/complications; Hemoglobinopathies/genetics*
  20. Sacroiliac gout associated with hemoglobin E and hypersplenism
    Lambeth JT, Burns-Cox CJ, MacLean R
    Radiology, 1970 May;95(2):413-5.
    PMID: 5439452 DOI: 10.1148/95.2.413
    Two patients with gout associated with the presence of an abnormal hemoglobin, Hb E, and hypersplenism are presented. Very large sclerotic-rimmed cystic erosions in the sacroiliac joints of both patients are unusual but characteristic of the skeletal lesions of gout. The hyperuricemia may be the result of the disordered nucleic acid metabolism associated with hemoglobin abnormality. The development of hypersplenism very likely accelerated this process and resulted in the clinical and radiographic manifestations of severe gout.
    INDEX TERMS: Blood, diseases • Blood, proteins • globin and Hemoglobin Compounds • Sacroiliac Joint trophy
    Study site: Hospital Gombak, Selangor, Malaysia
    Matched MeSH terms: Hemoglobinopathies/complications*
Related Terms
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links