Displaying publications 1 - 20 of 32 in total

Abstract:
Sort:
  1. Baig MA, Swamy KB, Baksh AD, Bahashwan A, Moshrif Y, Al Sawat A, et al.
    Indian J Pathol Microbiol, 2021 8 4;64(3):518-523.
    PMID: 34341263 DOI: 10.4103/IJPM.IJPM_709_20
    Background: : HPLC is one of the most important tools for accurate diagnosis of hemoglobinopathies and thalassemias. The advantage of the HPLC system is the excellent resolution, reproducibility &quantification of several normal and abnormal hemoglobin.

    Results: BIO RAD Variant II analyzer was used. Sickle cell syndromes including double heterozygous states accounted for 56.13% of total cases. HbSS, HbS/β0-th, HbS/β+-th β-thal trait comprises 29%, 6.5%, 5.1%& 10% of total cases respectively with mean MCV (fl) = 84, 68,71,64 respectively. The Mean HbA2 for β-thal trait, HbE trait &HbE-β thal showed 5.1 ± 1.1, 19 ± 9 & 24 ± 8 respectively. HbF is increased in 8.6% case (excluding SC syndromes & β-thal disorders), of these 5.5% were infants & 12 cases of Aplastic Anemias. Peak P2 >7% (2.4% cases) was seen in uncontrolled diabetes mellitus which on quantification showed HbA1C = 8 ± 2.1 mmol/L.

    Discussion: : HPLC in correlation with CBC parameters & family studies can aid in the diagnosis of majority of Hemoglobinopathies and thalassemic syndrome. The CBC & HPLC parameters of the present study are in good correlation with the research conducted by Tejinder Sing, RiouJ & Alla Joutovsky. Present study showed HPLC comprehensively characterizing HbS, A, A2, F, S, C, D from each other & was also applicable for the quantification of HbA1c for the monitoring of Diabetes Mellitus.

    Conclusion: : The merits of HPLC are small quantity of sample required, economical, less TAT, accurate categorization of HbS, HbA2 & F. But one has to be aware of the limitations and problems associated with this method due to variant hemoglobin within the same retention windows. The present findings show HPLC as an excellent & powerful diagnostic tool for the direct identification of hemoglobin variants with a high degree of precision in the quantification of normal and abnormal hemoglobin fractions.

    Matched MeSH terms: Hemoglobinopathies/blood; Hemoglobinopathies/diagnosis*
  2. Wan Mohd Saman WA, Hassan R, Mohd Yusoff S, Che Yaakob CA, Abdullah NA, Ghazali S, et al.
    Malays J Pathol, 2016 Dec;38(3):235-239.
    PMID: 28028293 MyJurnal
    BACKGROUND: Thalassemia and hemoglobinopathies are inherited red blood cell disorders found worldwide. Hemoglobin (Hb) E disorder is one of the hemoglobinopathies known to have the high prevalence in South East Asia. Most of transfusion-dependent thalassemias were genotypically compound heterozygous Hb E/ β-thalassemia. In Malaysia, the national screening program for thalassemia was implemented for early pregnancy or secondary school girls; however many participants do not turn-up and missed the screening test. Screening for thalassemia using samples from cord blood is an alternative choice as it is a readily available source of blood and hence early detection of the disease. The purpose of this study was to determine the potential use of cord blood for the screening of HbE hemoglobinopathy by using capillary electrophoresis (CE).

    METHODS: Cord blood samples were collected from 300 newborns of healthy mothers. Hematological parameters were determined and hemoglobin quantitation for all cord blood samples were performed using capillary electrophoresis system (CES) and high performance liquid chromatography (HPLC).

    RESULTS: Majority of cord blood samples (63%) revealed Hb AF followed by Hb AFA2 (20%). Hb AFE was detected in 10.7% with the mean value of Hb E ranging from 2.3%-11.1%.

    CONCLUSION: Hemoglobin E was detected in cord blood using capillary electrophoresis system. It can be recommended in areas where Hb E/β is prevalent. Implementation of a screening strategy using CE on cord blood sampling will identify the disease early. With regular follow-up on these patients, the status of their disease can be determined earlier and appropriate management implemented.

    Matched MeSH terms: Hemoglobinopathies/diagnosis*
  3. Boon WH
    Med J Malaya, 1968 Sep;23(1):61-6.
    PMID: 4237561
    Matched MeSH terms: Hemoglobinopathies/genetics*
  4. Tan AM, Ha C, Li CF, Chan GC, Lee V, Tan PL, et al.
    Ann Acad Med Singap, 2016 Mar;45(3):106-9.
    PMID: 27146463
    Matched MeSH terms: Hemoglobinopathies/therapy*
  5. Hirsch RE, Sibmooh N, Fucharoen S, Friedman JM
    Antioxid Redox Signal, 2017 05 10;26(14):794-813.
    PMID: 27650096 DOI: 10.1089/ars.2016.6806
    SIGNIFICANCE: Oxidative stress and generation of free radicals are fundamental in initiating pathophysiological mechanisms leading to an inflammatory cascade resulting in high rates of morbidity and death from many inherited point mutation-derived hemoglobinopathies. Hemoglobin (Hb)E is the most common point mutation worldwide. The βE-globin gene is found in greatest frequency in Southeast Asia, including Thailand, Malaysia, Indonesia, Vietnam, Cambodia, and Laos. With the wave of worldwide migration, it is entering the gene pool of diverse populations with greater consequences than expected.

    CRITICAL ISSUES: While HbE by itself presents as a mild anemia and a single gene for β-thalassemia is not serious, it remains unexplained why HbE/β-thalassemia (HbE/β-thal) is a grave disease with high morbidity and mortality. Patients often exhibit defective physical development, severe chronic anemia, and often die of cardiovascular disease and severe infections. Recent Advances: This article presents an overview of HbE/β-thal disease with an emphasis on new findings pointing to pathophysiological mechanisms derived from and initiated by the dysfunctional property of HbE as a reduced nitrite reductase concomitant with excess α-chains exacerbating unstable HbE, leading to a combination of nitric oxide imbalance, oxidative stress, and proinflammatory events.

    FUTURE DIRECTIONS: Additionally, we present new therapeutic strategies that are based on the emerging molecular-level understanding of the pathophysiology of this and other hemoglobinopathies. These strategies are designed to short-circuit the inflammatory cascade leading to devastating chronic morbidity and fatal consequences. Antioxid. Redox Signal. 26, 794-813.

    Matched MeSH terms: Hemoglobinopathies/drug therapy*; Hemoglobinopathies/metabolism; Hemoglobinopathies/physiopathology*
  6. Loong TY, Chong DL, Jamal AR, Murad NA, Sabudin RZ, Fun LC
    EXCLI J, 2016;15:630-635.
    PMID: 28096792 DOI: 10.17179/excli2016-613
    Haemoglobin (Hb)-M Hyde Park, also known as Hb-M Akita is a rare type of hereditary Hb M due to autosomal dominant mutation of CAC>TAC on codon 92 of β globin gene resulting in the replacement of histidine by tyrosine on β globin chain. This variant Hb has a tendency to form methaemoglobin (metHb). The iron ion in metHb is oxidized to ferric (Fe3+) which is unable to carry oxygen and the patients manifest as cyanosis clinically. A 9-year-old Malay girl was incidentally found to be cyanotic when she presented to a health clinic. Laboratory investigations revealed raised methaemoglobin levels and Hb analysis findings were consistent with Hb-M Hyde Park. β gene sequencing confirmed a point mutation of CAC>TAC on codon 92 in one of the β genes. The family study done on the individuals with cyanosis showed similar findings. A diagnosis of heterozygous Hb-M Hyde Park was made. Patients with this variant Hb usually presented with cyanosis with mild haemolysis and maybe misdiagnosed as congenital heart disease. No further treatment is needed as patients are relatively asymptomatic. Although the disease is harmless in the heterozygous carriers but the offspring of the carriers may suffer severe haemolytic anaemia when the offspring also inherit other β haemoglobinopathies/thalassemia. This can happen due to high prevalence of β thalassemia carrier (3.5-4 %) found in Malaysia. At the time of writing, this is the first case of hereditary Hb-M Hyde Park diagnosed in a Malay family living in Malaysia.
    Matched MeSH terms: Hemoglobinopathies
  7. Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
    Matched MeSH terms: Hemoglobinopathies/genetics
  8. Eng LI, McKay DA, Govindasamy S
    PMID: 5002823
    Matched MeSH terms: Hemoglobinopathies/epidemiology
  9. Hawkins BR
    PMID: 4790793
    Matched MeSH terms: Hemoglobinopathies/genetics; Hemoglobinopathies/epidemiology
  10. Wong SC, Stoming TA, Efremov GD, Huisman TH
    Hemoglobin, 1989;13(1):1-5.
    PMID: 2703362
    DNA samples from numerous subjects of different racial and ethnic backgrounds, with or without various hemoglobinopathies (classical beta-thalassemia; silent beta-thalassemia, Hb E, sickle cell anemia), were studied for a rearrangement (+ATA; -T) at nucleotide -530 in the 5' flanking region of the beta-globin gene using amplified DNA and 32P-labeled synthetic oligonucleotide probes. The data show that this unusual sequence is a common feature among East-Asians and Blacks (particularly SS patients), and is not associated with mild thalassemic features typical for the silent form of beta-thalassemia, as has been suggested (5).
    Matched MeSH terms: Hemoglobinopathies/genetics
  11. Ismail JB
    Med J Malaysia, 1992 Jun;47(2):98-102.
    PMID: 1494340
    One thousand consecutive Brunei Darussalam patients referred with low Hb, and/or low MCV and MCH (Hb < 12.5g/dl, MCV < 76fl, MCH < 27pg) were studied in the laboratory for underlying haemoglobinopathies. 30.0% of such patients were proved to have either beta-thalassaemia trait, beta-thalassaemia major, Hb AE, Hb EE, Hb E beta-thalassaemia or Hb H disease. In some, the haemoglobin abnormality was not identified precisely. Alpha-thalassaemia was suspected in an additional 4.3% of cases but confirmation study by globin-chain synthesis was not available. Beta-thalassaemia trait which was the predominant disorder was equally distributed among the three major race groups of Brunei Darussalam. Hb E was found exclusive among the Malay population. Hb H disease appeared as more common among the Chinese or the Malays (p > 0.05). This study reveals that thalassaemia and haemoglobinopathies are prevalent in Brunei Darussalam.
    Matched MeSH terms: Hemoglobinopathies/genetics; Hemoglobinopathies/epidemiology*
  12. Lie-Injo LE
    Acta Haematol., 1973;49(1):25-35.
    PMID: 4632449 DOI: 10.1159/000208382
    Newborns were examined for the presence of slow-moving haemoglobin components, tentatively designated X components and previously found in a group of Hb H disease in which invariably one of the parents of each patient had the same slow-moving Hb X components also. Structural studies showed that the abnormal haemoglobin in Chinese was identical with Hb Constant Spring, an c-chain variant. Newborns with Hb Bart’s and slow-moving X components invariably had one parent with the X components also. When the child grew older Hb Bart’s disappeared while the Hb X components remained in the blood. The homozygous state for the X components was found in a Malay boy through his newborn brother who had the X components in addition to Hb Bart’s and had both parents with the X components. One other Malay baby had the X components and Hb A2 Indonesia inherited from the parents. The present study of newborns also showed that Hb Bart’s can accompany different abnormalities of haemoglobin production, involving alpha-chains, beta-chains as well as gamm-chains. Its presence in cord blood is, therefore, not specific for alpha-thalassaemia
    Key Words: Haemoglobinopathies; Hb Bart’s; Slow-moving Hb X; Thalassaemia
    Matched MeSH terms: Hemoglobinopathies/genetics*
  13. Lie-Injo LE, Lopez CG, Lopes M
    Acta Haematol., 1971;46(2):106-20.
    PMID: 4331171 DOI: 10.1159/000208565
    A study of 23 patients with Hb H disease and their 82 relatives in 17 families showed that 2 types of this condition exist. One is associated with the presence of a small slow-moving component, which we tentatively called the X component and which was invariably present in one parent. Some siblings also had it. The other type was not associated with this component. Two patients without X component had a newborn with Bart’s haemoglobin without X component. None of the parents of 20 newborns with Hb Bart’s without the X component had the X component. It was present in only one parent of each of 2 newborns with Hb Bart’s and the X component. They are thought to represent Hb H disease in the newborn period. We suggest that at least 3 abnormal genes may lead to Hb H disease, which results when 2 of the 3 combine. Severity of clinical and haematological symptoms depends upon which abnormal gene is present and which 2 are involved in any particular combination.
    Key Words: a-Thalassaemia; Haemoglobin Bart’s; Haemoglobin H disease; Haemoglobinopathies
    Matched MeSH terms: Hemoglobinopathies/complications; Hemoglobinopathies/genetics*
  14. Lambeth JT, Burns-Cox CJ, MacLean R
    Radiology, 1970 May;95(2):413-5.
    PMID: 5439452 DOI: 10.1148/95.2.413
    Two patients with gout associated with the presence of an abnormal hemoglobin, Hb E, and hypersplenism are presented. Very large sclerotic-rimmed cystic erosions in the sacroiliac joints of both patients are unusual but characteristic of the skeletal lesions of gout. The hyperuricemia may be the result of the disordered nucleic acid metabolism associated with hemoglobin abnormality. The development of hypersplenism very likely accelerated this process and resulted in the clinical and radiographic manifestations of severe gout.
    INDEX TERMS: Blood, diseases • Blood, proteins • globin and Hemoglobin Compounds • Sacroiliac Joint trophy
    Study site: Hospital Gombak, Selangor, Malaysia
    Matched MeSH terms: Hemoglobinopathies/complications*
  15. Amran HS, Aziz MA, George E, Mahmud N, Lee TY, Md Noor S
    Malays J Pathol, 2017 Dec;39(3):321-326.
    PMID: 29279598 MyJurnal
    Hb Tak is one of more than 200 high affinity haemoglobin variants reported worldwide. It results from the insertion of two nucleotides (AC) at the termination codon, between codon 146 and codon 147 of the beta-globin gene [Beta 147 (+AC)]. Polycythaemia is the main clinical feature although affected carriers are usually asymptomatic and do not require intervention. Several case studies in this region have reported the co-inheritance of Hb Tak with Hb E, delta beta and beta thalassaemia with one case of homozygous Hb Tak in a Thai boy. In this case report, a cluster of haemoglobin Tak was found in a family of Malay ethnic origin. Cascade family screening was conducted while investigating a 4-year old girl who presented with symptomatic polycythaemia. She had 2 previous Hb analysis done, at 7-month and 2-year-old with the diagnosis of possible Hb Q Thailand and Homozygous Hb D, respectively. Both diagnosis did not fit her clinical presentations. She was plethoric, had reduced exercise tolerance as well as cardiomyopathy. Her parents were consanguineously married and later diagnosed as asymptomatic carriers of Hb Tak. Consequently, re-analysis of the girl's blood sample revealed a homozygous state of Hb Tak. In conclusion, high oxygen affinity haemoglobin like Hb Tak should be considered in the investigation of polycythaemic patients with abnormal Hb analyses. In this case, DNA analysis was crucial in determining the correct diagnosis.
    Matched MeSH terms: Hemoglobinopathies/diagnosis*; Hemoglobinopathies/genetics*
  16. Pasangna J, George E, Nagaratnam M
    Malays J Pathol, 2005 Jun;27(1):33-7.
    PMID: 16676691
    A 2-year-old Malay boy was brought to the University Malaya Medical Centre for thalassaemia screening. Physical examination revealed thalassaemia facies, pallor, mild jaundice, hepatomegaly and splenomegaly. Laboratory investigations on the patient including studies on the parents lead to a presumptive diagnosis of homozygous Haemoglobin Lepore (Hb Lepore). The aim of this paper is to increase awareness of this rare disorder, this being the first case documented in Malaysia in a Malay. The case also demonstrates the need for this disorder to be included in the differential diagnosis of patients presenting clinically like thalassemia intermedia or thalassemia major. Accurate diagnosis would provide information necessary for prenatal diagnosis, proper clinical management and genetic counseling. The clinical, haematological and laboratory features of this disorder are discussed in this paper.
    Matched MeSH terms: Hemoglobinopathies/blood; Hemoglobinopathies/genetics*
  17. Riahi S, Mei IL, Idris FB, George E, Noor SM
    PMID: 26863862
    Pre-donation screening declarations and hemoglobin (Hb) testing are measures used to determine the quality of donated blood. The copper sulphate (CuSo4) method used to screen for blood abnormalities can give inaccurate results if strict quality control is not applied. Blood donors who are carriers of thalassemia and those with mild iron deficiency anemia (IDA) are usually asymptomatic and frequently missed at blood donation. The aim of this study was to evaluate the red blood cell (RBC) indices related disorders among blood donors who were deemed qualified to donate blood after screening with CuSo4 method. One hundred fifty-eight volunteer blood donors at the Universiti Putra Malaysia (UPM), who had passed the CuSo4 screening method, were recruited for this study. Their bloods specimens were examined with a complete blood count. Subjects with a low mean corpuscular hemoglobin (MCH) level were examined further by checking a serum ferritin level, Hb quantification, and molecular analysis to examine for common RBC disorders. Fourteen point six percent of subjects had a low Hb level, two (1.3%) had IDA and four (2.5%) had thalassemia or some other hemoglobinopathy. Using a MCH level < 27 pg as a cut-off point, 58 subjects (36.7%) had suspected IDA, thalassemia or some other hemoglobinopathy. Eight point nine percent of subjects with a normal Hb level had thalassemia, and 3.8% had IDA. Malaysia has a high prevalence of thalassemia and other hemoglobinopathies. Pre-donation accurate screening is crucial to protect the quality of blood transfusion products. Public education regarding RBC disorders especially among blood donors is important.
    Matched MeSH terms: Hemoglobinopathies/blood; Hemoglobinopathies/etiology; Hemoglobinopathies/epidemiology*
  18. Ong HC
    Acta Haematol., 1974;52(4):220-2.
    PMID: 4217527 DOI: 10.1159/000208244
    Haemoglobin E complicates 22.2°/o of pregnancy in Malaysian aborigines, the prevalence of variants associated with pregnancy being, 15.8% with Hb E trait abnormality, 3.9% with Hb E homozygous disease, and 2.5% with Hb E thalassaemia disease. Minor haematological abnormalities occur with the trait and homozygous conditions, though a more unfavourable response is expected with Hb E thalassaemia. Haemolysis is not a prominent feature and it is suggested that factors other than the haemoglobinopathic state
    probably accounts for any unfavourable response in pregnancy.
    Key Words: Haemoglobin E; Haemoglobinopathies; Haemolytic anaemias; Hb E thalassaemia; Malaysia; Pregnancy
    Study site: Hospital Orang Asli, Gombak, Selangor, Malaysia
    Matched MeSH terms: Hemoglobinopathies/blood
  19. Norlelawati, A.T., Siti Hadijah, M., Siti Nor Haiza, H., Rusmawati, I., Abdul Wahab, J., Naznin, M., et al.
    MyJurnal
    Introduction: Thalassaemia is an inherited blood disorder and is a significant public health alarm in Malaysia with many not knowing they are carriers of this haemoglobin disorders. Materials and methods: This study conducted a one off collection of blood samples from 72 Malays students of International Islamic University Malaysia (IIUM) in Kuantan. Blood samples were subjected to conventional haemoglobin analyses that include full blood count and picture, HPLC, Haemoglobin electrophoresis and H-inclusion test. All samples were also genotyped for alpha thalassaemia–1 of Southeast Asia (a-Thal1SEA). Result: There were 17(23.6%) students who were diagnosed as thalassaemia carriers. Out of this, four (5.5 %) and six (8.3 %) students were presumptive β-thalassaemia trait and Haemoglobin-E trait as determined by the HPLC assay respectively. Nine (12.5%) students were genotyped a-Thal1SEA among whom two were also β-thalassaemia carriers. All thalassaemia cases had MCH of < 27pg. Nonetheless, two out of six Haemoglobin-E trait and three out of nine a-Thal1SEA carrier had MCV value of >80fL. Two out of four (50%) presumptive β -thalassaemia trait and one out of six (17%) students of presumptive Haemoglobin-E trait had family history of thalassaemia respectively. Conclusion: The high occurrence of the three common types of thalassaemia carrier (β, Hb-E and a-Thal1SEA thalassaemia) in our small group of subjects could be due to better participation of students who had family history of thalassaemia. The study reaffirmed the importance of molecular study for detection of alpha-thalassaemia and the use of MCH value of
    Matched MeSH terms: Hemoglobinopathies
  20. George E, Sivagengei K
    Med J Malaysia, 1982 Jun;37(2):102-3.
    PMID: 7132828
    Matched MeSH terms: Hemoglobinopathies/blood*
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links