MyMedR

Displaying publications 1 - 20 of 32 in total

Abstract:

Sort:

Viva-Asia Blood and Marrow Transplantation Groups - A Survey of Consortium Activity over a 12-year Period (2000 to 2011)

Tan AM, Ha C, Li CF, Chan GC, Lee V, Tan PL, et al.

Ann Acad Med Singap, 2016 Mar;45(3):106-9.
PMID: 27146463
Matched MeSH terms: Hemoglobinopathies/therapy*
Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations

Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.

Public Health Genomics, 2015;18(1):60-4.
PMID: 25412720 DOI: 10.1159/000368342

BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.

Matched MeSH terms: Hemoglobinopathies/genetics
The distribution of blood genetic markers in immigrant Chinese populations

Hawkins BR

Acta Genet Med Gemellol (Roma), 1973;22:139-66.
PMID: 4790793
Matched MeSH terms: Hemoglobinopathies/genetics; Hemoglobinopathies/epidemiology
Fulltext The International Hemoglobinopathy Research Network (INHERENT): An international initiative to study the role of genetic modifiers in hemoglobinopathies

Kountouris P, Stephanou C, Archer N, Bonifazi F, Giannuzzi V, Kuo KHM, et al.

Am J Hematol, 2021 Nov 01;96(11):E416-E420.
PMID: 34406671 DOI: 10.1002/ajh.26323
Matched MeSH terms: Hemoglobinopathies/genetics*
Fulltext Thalassaemia screening among healthy blood donors in Hospital Tengku Ampuan Rahimah, Klang

Irmi Elfina, R., Ezalia, E., Elizabeth, G., Wan Hayati, M.Y, Norhanim, A., Wahidah, A., et al.

Medicine & Health, 2014;9(1):44-52.
MyJurnal

Thalassaemia screening programme has been conducted in Malaysia since 2004. The aim of the programme was to reduce the burden of the disease by identifying thalassaemia carriers. However, the response towards the screening activities was unsatisfactory as there was lack of public awareness against the importance of thalassaemia screening. An alternative approach is to screen blood donors. The purpose of this study was to observe the prevalence of thalassaemia carriers among healthy blood donors. Seven hundred and thirty eight healthy blood donors were screened in Hospital Tengku Ampuan Rahimah, Klang from July to September 2010 using cation-exchange high performance liquid chromatography (HPLC). Cases with haemoglobin variants were further analyzed by gel electrophoresis at alkaline pH. Result shows that the blood donors consisted of 413 Malays (56%), 162 Indians (22%), 148 Chinese (20%) and 15 others (2%). There were 19 (2.6%) individuals with haemoglobin E trait, six (0.8%) with co-inheritance of haemoglobin E and αα- thalassaemia and five (0.7%) with β-thalassaemia trait. Haemoglobin Constant Spring and haemoglobin A2 prime were observed in two (0.3%); and Haemoglobin Lepore and alpha chain variant in one (0.2%). αα-thalassaemia and normal haemoglobin A2 β-thalassaemia could not be excluded in 190 cases (26%), as they required deoxyribonucleic acid (DNA) studies for identification. Thalassaemia screening in blood donors is more feasible and effective. Therefore, a wider scale population screening including blood donors could benefit the existing thalassaemia screening programme in Malaysia.

Matched MeSH terms: Hemoglobinopathies
Fulltext Thalassaemia and haemoglobinopathies in Brunei Darussalam

Ismail JB

Med J Malaysia, 1992 Jun;47(2):98-102.
PMID: 1494340

One thousand consecutive Brunei Darussalam patients referred with low Hb, and/or low MCV and MCH (Hb < 12.5g/dl, MCV < 76fl, MCH < 27pg) were studied in the laboratory for underlying haemoglobinopathies. 30.0% of such patients were proved to have either beta-thalassaemia trait, beta-thalassaemia major, Hb AE, Hb EE, Hb E beta-thalassaemia or Hb H disease. In some, the haemoglobin abnormality was not identified precisely. Alpha-thalassaemia was suspected in an additional 4.3% of cases but confirmation study by globin-chain synthesis was not available. Beta-thalassaemia trait which was the predominant disorder was equally distributed among the three major race groups of Brunei Darussalam. Hb E was found exclusive among the Malay population. Hb H disease appeared as more common among the Chinese or the Malays (p > 0.05). This study reveals that thalassaemia and haemoglobinopathies are prevalent in Brunei Darussalam.

Matched MeSH terms: Hemoglobinopathies/genetics; Hemoglobinopathies/epidemiology*
Fulltext Secondary polycythaemia in a Malay girl with homozygous Hb Tak

Amran HS, Aziz MA, George E, Mahmud N, Lee TY, Md Noor S

Malays J Pathol, 2017 Dec;39(3):321-326.
PMID: 29279598 MyJurnal

Hb Tak is one of more than 200 high affinity haemoglobin variants reported worldwide. It results from the insertion of two nucleotides (AC) at the termination codon, between codon 146 and codon 147 of the beta-globin gene [Beta 147 (+AC)]. Polycythaemia is the main clinical feature although affected carriers are usually asymptomatic and do not require intervention. Several case studies in this region have reported the co-inheritance of Hb Tak with Hb E, delta beta and beta thalassaemia with one case of homozygous Hb Tak in a Thai boy. In this case report, a cluster of haemoglobin Tak was found in a family of Malay ethnic origin. Cascade family screening was conducted while investigating a 4-year old girl who presented with symptomatic polycythaemia. She had 2 previous Hb analysis done, at 7-month and 2-year-old with the diagnosis of possible Hb Q Thailand and Homozygous Hb D, respectively. Both diagnosis did not fit her clinical presentations. She was plethoric, had reduced exercise tolerance as well as cardiomyopathy. Her parents were consanguineously married and later diagnosed as asymptomatic carriers of Hb Tak. Consequently, re-analysis of the girl's blood sample revealed a homozygous state of Hb Tak. In conclusion, high oxygen affinity haemoglobin like Hb Tak should be considered in the investigation of polycythaemic patients with abnormal Hb analyses. In this case, DNA analysis was crucial in determining the correct diagnosis.

Matched MeSH terms: Hemoglobinopathies/diagnosis*; Hemoglobinopathies/genetics*
Fulltext Screening for thalassaemia among group of students of a higher institution – our experience

Norlelawati, A.T., Siti Hadijah, M., Siti Nor Haiza, H., Rusmawati, I., Abdul Wahab, J., Naznin, M., et al.

International Medical Journal Malaysia, 2011;10(1):3-6.
MyJurnal

Introduction: Thalassaemia is an inherited blood disorder and is a significant public health alarm in Malaysia with many not knowing they are carriers of this haemoglobin disorders. Materials and methods: This study conducted a one off collection of blood samples from 72 Malays students of International Islamic University Malaysia (IIUM) in Kuantan. Blood samples were subjected to conventional haemoglobin analyses that include full blood count and picture, HPLC, Haemoglobin electrophoresis and H-inclusion test. All samples were also genotyped for alpha thalassaemia–1 of Southeast Asia (a-Thal1SEA). Result: There were 17(23.6%) students who were diagnosed as thalassaemia carriers. Out of this, four (5.5 %) and six (8.3 %) students were presumptive β-thalassaemia trait and Haemoglobin-E trait as determined by the HPLC assay respectively. Nine (12.5%) students were genotyped a-Thal1SEA among whom two were also β-thalassaemia carriers. All thalassaemia cases had MCH of < 27pg. Nonetheless, two out of six Haemoglobin-E trait and three out of nine a-Thal1SEA carrier had MCV value of >80fL. Two out of four (50%) presumptive β -thalassaemia trait and one out of six (17%) students of presumptive Haemoglobin-E trait had family history of thalassaemia respectively. Conclusion: The high occurrence of the three common types of thalassaemia carrier (β, Hb-E and a-Thal1SEA thalassaemia) in our small group of subjects could be due to better participation of students who had family history of thalassaemia. The study reaffirmed the importance of molecular study for detection of alpha-thalassaemia and the use of MCH value of

Matched MeSH terms: Hemoglobinopathies
Sacroiliac gout associated with hemoglobin E and hypersplenism

Lambeth JT, Burns-Cox CJ, MacLean R

Radiology, 1970 May;95(2):413-5.
PMID: 5439452 DOI: 10.1148/95.2.413

Two patients with gout associated with the presence of an abnormal hemoglobin, Hb E, and hypersplenism are presented. Very large sclerotic-rimmed cystic erosions in the sacroiliac joints of both patients are unusual but characteristic of the skeletal lesions of gout. The hyperuricemia may be the result of the disordered nucleic acid metabolism associated with hemoglobin abnormality. The development of hypersplenism very likely accelerated this process and resulted in the clinical and radiographic manifestations of severe gout.
INDEX TERMS: Blood, diseases • Blood, proteins • globin and Hemoglobin Compounds • Sacroiliac Joint trophy
Study site: Hospital Gombak, Selangor, Malaysia

Matched MeSH terms: Hemoglobinopathies/complications*
Fulltext Rapid Targeted Next-Generation Sequencing Platform for Molecular Screening and Clinical Genotyping in Subjects with Hemoglobinopathies

Shang X, Peng Z, Ye Y, Asan, Zhang X, Chen Y, et al.

EBioMedicine, 2017 Sep;23:150-159.
PMID: 28865746 DOI: 10.1016/j.ebiom.2017.08.015

Hemoglobinopathies are among the most common autosomal-recessive disorders worldwide. A comprehensive next-generation sequencing (NGS) test would greatly facilitate screening and diagnosis of these disorders. An NGS panel targeting the coding regions of hemoglobin genes and four modifier genes was designed. We validated the assay by using 2522 subjects affected with hemoglobinopathies and applied it to carrier testing in a cohort of 10,111 couples who were also screened through traditional methods. In the clinical genotyping analysis of 1182 β-thalassemia subjects, we identified a group of additional variants that can be used for accurate diagnosis. In the molecular screening analysis of the 10,111 couples, we detected 4180 individuals in total who carried 4840 mutant alleles, and identified 186 couples at risk of having affected offspring. 12.1% of the pathogenic or likely pathogenic variants identified by our NGS assay, which were undetectable by traditional methods. Compared with the traditional methods, our assay identified an additional at-risk 35 couples. We describe a comprehensive NGS-based test that offers advantages over the traditional screening/molecular testing methods. To our knowledge, this is among the first large-scale population study to systematically evaluate the application of an NGS technique in carrier screening and molecular diagnosis of hemoglobinopathies.

Matched MeSH terms: Hemoglobinopathies/diagnosis*; Hemoglobinopathies/genetics*; Hemoglobinopathies/epidemiology
Fulltext Potential use of cord blood for Hb E hemoglobinopathy screening programme using capillary electrophoresis

Wan Mohd Saman WA, Hassan R, Mohd Yusoff S, Che Yaakob CA, Abdullah NA, Ghazali S, et al.

Malays J Pathol, 2016 Dec;38(3):235-239.
PMID: 28028293 MyJurnal

BACKGROUND: Thalassemia and hemoglobinopathies are inherited red blood cell disorders found worldwide. Hemoglobin (Hb) E disorder is one of the hemoglobinopathies known to have the high prevalence in South East Asia. Most of transfusion-dependent thalassemias were genotypically compound heterozygous Hb E/ β-thalassemia. In Malaysia, the national screening program for thalassemia was implemented for early pregnancy or secondary school girls; however many participants do not turn-up and missed the screening test. Screening for thalassemia using samples from cord blood is an alternative choice as it is a readily available source of blood and hence early detection of the disease. The purpose of this study was to determine the potential use of cord blood for the screening of HbE hemoglobinopathy by using capillary electrophoresis (CE).
METHODS: Cord blood samples were collected from 300 newborns of healthy mothers. Hematological parameters were determined and hemoglobin quantitation for all cord blood samples were performed using capillary electrophoresis system (CES) and high performance liquid chromatography (HPLC).
RESULTS: Majority of cord blood samples (63%) revealed Hb AF followed by Hb AFA2 (20%). Hb AFE was detected in 10.7% with the mean value of Hb E ranging from 2.3%-11.1%.
CONCLUSION: Hemoglobin E was detected in cord blood using capillary electrophoresis system. It can be recommended in areas where Hb E/β is prevalent. Implementation of a screening strategy using CE on cord blood sampling will identify the disease early. With regular follow-up on these patients, the status of their disease can be determined earlier and appropriate management implemented.

Matched MeSH terms: Hemoglobinopathies/diagnosis*
Fulltext Molecular characterisation of Haemoglobin Constant Spring and Haemoglobin Quong Sze with a Combine-Amplification Refractory Mutation System

Wee YC, Tan KL, Chua KH, George E, Tan JA

Malays J Med Sci, 2009 Jul;16(3):21-8.
PMID: 22589661 MyJurnal

BACKGROUND: The interaction of the non-deletional α(+)-thalassaemia mutations Haemoglobin Constant Spring and Haemoglobin Quong Sze with the Southeast Asian double α-globin gene deletion results in non-deletional Haemoglobin H disease. Accurate detection of non-deletional Haemoglobin H disease, which is associated with severe phenotypes, is necessary as these mutations have been confirmed in the Malaysian population.
METHODS: DNA from two families with Haemoglobin H disease was extracted from EDTA-anticoagulated whole blood and subjected to molecular analysis for α-thalassaemia. A duplex polymerase chain reaction was used to detect the Southeast Asian α-globin gene deletion. Polymerase chain reaction-restriction fragment length polymorphism analysis was then carried out to determine the presence of Haemoglobin Constant Spring and Haemoglobin Quong Sze. A combine-amplification refractory mutation system protocol was optimised and implemented for the rapid and specific molecular characterisation of Haemoglobin Constant Spring and Haemoglobin Quong Sze in a single polymerase chain reaction.
RESULTS AND CONCLUSIONS: The combine-amplification refractory mutation system for Haemoglobin Constant Spring and Haemoglobin Quong Sze, together with the duplex polymerase chain reaction, provides accurate pre- and postnatal diagnosis of non-deletional Haemoglobin H disease and allows detailed genotype analyses using minimal quantities of DNA.
KEYWORDS: Combine-ARMS; Hb Constant Spring; Hb Quong Sze; medical sciences

Matched MeSH terms: Hemoglobinopathies*
International perspectives on the implementation of reproductive carrier screening

Delatycki MB, Alkuraya F, Archibald A, Castellani C, Cornel M, Grody WW, et al.

Prenat Diagn, 2020 02;40(3):301-310.
PMID: 31774570 DOI: 10.1002/pd.5611

Reproductive carrier screening started in some countries in the 1970s for hemoglobinopathies and Tay-Sachs disease. Cystic fibrosis carrier screening became possible in the late 1980s and with technical advances, screening of an ever increasing number of genes has become possible. The goal of carrier screening is to inform people about their risk of having children with autosomal recessive and X-linked recessive disorders, to allow for informed decision making about reproductive options. The consequence may be a decrease in the birth prevalence of these conditions, which has occurred in several countries for some conditions. Different programs target different groups (high school, premarital, couples before conception, couples attending fertility clinics, and pregnant women) as does the governance structure (public health initiative and user pays). Ancestry-based offers of screening are being replaced by expanded carrier screening panels with multiple genes that is independent of ancestry. This review describes screening in Australia, Cyprus, Israel, Italy, Malaysia, the Netherlands, Saudi Arabia, the United Kingdom, and the United States. It provides an insight into the enormous variability in how reproductive carrier screening is offered across the globe. This largely relates to geographical variation in carrier frequencies of genetic conditions and local health care, financial, cultural, and religious factors.

Matched MeSH terms: Hemoglobinopathies/genetics
Inheritance of haemoglobin H disease. A new aspect

Lie-Injo LE, Lopez CG, Lopes M

Acta Haematol., 1971;46(2):106-20.
PMID: 4331171 DOI: 10.1159/000208565

A study of 23 patients with Hb H disease and their 82 relatives in 17 families showed that 2 types of this condition exist. One is associated with the presence of a small slow-moving component, which we tentatively called the X component and which was invariably present in one parent. Some siblings also had it. The other type was not associated with this component. Two patients without X component had a newborn with Bart’s haemoglobin without X component. None of the parents of 20 newborns with Hb Bart’s without the X component had the X component. It was present in only one parent of each of 2 newborns with Hb Bart’s and the X component. They are thought to represent Hb H disease in the newborn period. We suggest that at least 3 abnormal genes may lead to Hb H disease, which results when 2 of the 3 combine. Severity of clinical and haematological symptoms depends upon which abnormal gene is present and which 2 are involved in any particular combination.
Key Words: a-Thalassaemia; Haemoglobin Bart’s; Haemoglobin H disease; Haemoglobinopathies

Matched MeSH terms: Hemoglobinopathies/complications; Hemoglobinopathies/genetics*
Homozygous state for Hb Constant Spring (slow-moving Hb X components)

Lie-Injo LE, Ganesan J, Clegg JB, Weatherall DJ

Blood, 1974 Feb;43(2):251-9.
PMID: 4810076
Matched MeSH terms: Hemoglobinopathies/genetics*
High frequencies of a rearrangement (+ATA; -T) at -530 to the beta-globin gene in different populations indicate the absence of a correlation with a silent beta-thalassemia determinant

Wong SC, Stoming TA, Efremov GD, Huisman TH

Hemoglobin, 1989;13(1):1-5.
PMID: 2703362

DNA samples from numerous subjects of different racial and ethnic backgrounds, with or without various hemoglobinopathies (classical beta-thalassemia; silent beta-thalassemia, Hb E, sickle cell anemia), were studied for a rearrangement (+ATA; -T) at nucleotide -530 in the 5' flanking region of the beta-globin gene using amplified DNA and 32P-labeled synthetic oligonucleotide probes. The data show that this unusual sequence is a common feature among East-Asians and Blacks (particularly SS patients), and is not associated with mild thalassemic features typical for the silent form of beta-thalassemia, as has been suggested (5).

Matched MeSH terms: Hemoglobinopathies/genetics
Hemoglobin Constant Spring (slow-moving hemoglobin X components) and hemoglobin e in Malayan aborigines

Eng LI, Baer A, Lewis AN, Welch QB

Am J Hum Genet, 1973 Jul;25(4):382-7.
PMID: 4716657
Matched MeSH terms: Hemoglobinopathies/genetics; Hemoglobinopathies/epidemiology*
Fulltext HbE/β-Thalassemia and Oxidative Stress: The Key to Pathophysiological Mechanisms and Novel Therapeutics

Hirsch RE, Sibmooh N, Fucharoen S, Friedman JM

Antioxid Redox Signal, 2017 05 10;26(14):794-813.
PMID: 27650096 DOI: 10.1089/ars.2016.6806

SIGNIFICANCE: Oxidative stress and generation of free radicals are fundamental in initiating pathophysiological mechanisms leading to an inflammatory cascade resulting in high rates of morbidity and death from many inherited point mutation-derived hemoglobinopathies. Hemoglobin (Hb)E is the most common point mutation worldwide. The βE-globin gene is found in greatest frequency in Southeast Asia, including Thailand, Malaysia, Indonesia, Vietnam, Cambodia, and Laos. With the wave of worldwide migration, it is entering the gene pool of diverse populations with greater consequences than expected.
CRITICAL ISSUES: While HbE by itself presents as a mild anemia and a single gene for β-thalassemia is not serious, it remains unexplained why HbE/β-thalassemia (HbE/β-thal) is a grave disease with high morbidity and mortality. Patients often exhibit defective physical development, severe chronic anemia, and often die of cardiovascular disease and severe infections. Recent Advances: This article presents an overview of HbE/β-thal disease with an emphasis on new findings pointing to pathophysiological mechanisms derived from and initiated by the dysfunctional property of HbE as a reduced nitrite reductase concomitant with excess α-chains exacerbating unstable HbE, leading to a combination of nitric oxide imbalance, oxidative stress, and proinflammatory events.
FUTURE DIRECTIONS: Additionally, we present new therapeutic strategies that are based on the emerging molecular-level understanding of the pathophysiology of this and other hemoglobinopathies. These strategies are designed to short-circuit the inflammatory cascade leading to devastating chronic morbidity and fatal consequences. Antioxid. Redox Signal. 26, 794-813.

Matched MeSH terms: Hemoglobinopathies/drug therapy*; Hemoglobinopathies/metabolism; Hemoglobinopathies/physiopathology*
Fulltext Haemoglobin Sickle D Punjab: - a case report

Rahimah A, Syahira Lazira O, Siti Hida HM, Faidatul Syazlin AH, Nur Aisyah A, Nik Hafidzah NM, et al.

Med J Malaysia, 2014 Feb;69(1):42-3.
PMID: 24814631 MyJurnal

Haemoglobin S D-Punjab is a rare compound heterozygous haemoglobinopathy characterised by the presence of two β globin gene variants: Β6(GAG→GTG) and Β121(GAA→CAA). These patients' clinical and haematological features mimic haemoglobin S disease. We describe the first case of doubly heterozygous HbSD-Punjab from Malaysia managed with regular blood transfusion at the age of one. This case highlights the propensity for occurrence of rare phenotypes within our multi-ethnic population and emphasises the importance of accurate genotyping to avoid erroneous counselling, and to plan an effective patient management strategy before complication evolves.

Matched MeSH terms: Hemoglobinopathies
Fulltext Haemoglobin Lepore in a Malay family: a case report

Pasangna J, George E, Nagaratnam M

Malays J Pathol, 2005 Jun;27(1):33-7.
PMID: 16676691

A 2-year-old Malay boy was brought to the University Malaya Medical Centre for thalassaemia screening. Physical examination revealed thalassaemia facies, pallor, mild jaundice, hepatomegaly and splenomegaly. Laboratory investigations on the patient including studies on the parents lead to a presumptive diagnosis of homozygous Haemoglobin Lepore (Hb Lepore). The aim of this paper is to increase awareness of this rare disorder, this being the first case documented in Malaysia in a Malay. The case also demonstrates the need for this disorder to be included in the differential diagnosis of patients presenting clinically like thalassemia intermedia or thalassemia major. Accurate diagnosis would provide information necessary for prenatal diagnosis, proper clinical management and genetic counseling. The clinical, haematological and laboratory features of this disorder are discussed in this paper.

Matched MeSH terms: Hemoglobinopathies/blood; Hemoglobinopathies/genetics*

Filters

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links