Displaying publications 361 - 380 of 2034 in total

Abstract:
Sort:
  1. Fulltext Effects of sun exposure on 25(OH) vitamin D concentration in urban and rural women in Malaysia
    Nurbazlin M, Chee WS, Rokiah P, Tan AT, Chew YY, Nusaibah AR, et al.
    Asia Pac J Clin Nutr, 2013;22(3):391-9.
    PMID: 23945409 DOI: 10.6133/apjcn.2013.22.3.15
    Ultraviolet B sunlight exposure is a primary source of vitamin D. There have been reports of low vitamin D status amongst the Malaysian population despite it being a tropical country. This study was conducted to determine the influence of sun exposure on 25(OH)D concentrations in urban and rural women in Malaysia and factors predicting 25(OH)D concentrations. Women aged above 45 years were recruited from urban (n=107) and rural areas (n=293). Subjects were interviewed regarding their outdoor activities and usual outdoor attire over the previous week. 25(OH)D concentrations were analyzed using the vitamin D3 (25-OH) electrochemiluminescence immunoassay. Median (Q1-Q3) age of the participants was 57 (53-61) years old. Median (Q1-Q3) 25(OH)D concentration of rural women was significantly higher [69.5 (59.0-79.1) nmol/L] compared to urban women [31.9 (26.1- 45.5) nmol/L] (p<0.001). Rural women spent more time in the sun compared to urban women (7.83 (3.67-14.7) vs 2.92 (1.17-4.92) hours, p<0.001), although the fraction of body surface area (BSA) exposed to sunlight was significantly higher in the urban group [0.21 (0.21-0.43) vs 0.12 (0.07-0.17), p<0.001]. The calculated sun index (hours of sun exposure per week × fraction of BSA) was significantly higher in rural [0.89 (0.42-1.83)] compared to urban women [0.72 (0.26-1.28)], p=0.018. In the stepwise linear regression, rural dwelling increased the serum 25(OH)D by 31.74 nmol/L and 25(OH)D concentrations increased by 1.93 nmol/L for every unit increment in sun index. Urban women in Malaysia had significantly lower vitamin D status compared to rural women. Rural dwelling and sun index were key factors influencing vitamin D status in Malaysian women.
    Matched MeSH terms: Rural Population*; Urban Population*
  2. Fulltext The influence of factors related to public health campaigns on vaccination behavior among population of Wuxi region, China
    Ye Y, Su AT
    Front Public Health, 2024;12:1498296.
    PMID: 39866353 DOI: 10.3389/fpubh.2024.1498296
    BACKGROUND: Public health campaigns are essential for promoting vaccination behavior, but factors such as socioeconomic status, geographical location, campaign quality, and service accessibility influence vaccine uptake. In the Wuxi region of China, disparities in vaccination behavior are seen between urban and rural populations and among different socioeconomic groups. This study aims to explore the factors related to public health campaigns that affect vaccination behavior in Wuxi, contributing to better public health strategies.

    METHODS: A cross-sectional survey was conducted among 750 participants in Wuxi, focusing on their perceptions of socioeconomic status, geographical location, health campaign quality, and vaccination convenience. The questionnaire was developed based on a literature review and expert input using the Delphi method. Data were analyzed using descriptive statistics, reliability and validity tests, correlation analysis, and regression analysis, employing both SPSS and R software.

    RESULTS: Socioeconomic status, geographic location, campaign quality, and accessibility all significantly influence vaccination behavior. Higher socioeconomic backgrounds, urban residency, better campaign quality, and greater accessibility to vaccination services are positively correlated with higher vaccination uptake. Regression analysis revealed that public health campaigns and accessibility are particularly influential in promoting vaccination behavior.

    CONCLUSION: To improve vaccination rates, targeted strategies focusing on low socioeconomic groups, rural areas, and improving campaign quality and service accessibility are necessary. Public health campaigns should be clear, culturally relevant, and utilize multiple communication channels. Future research should address misinformation, explore behavioral economics, and integrate emerging technologies like AI to optimize vaccination efforts.

    Matched MeSH terms: Rural Population/statistics & numerical data; Urban Population/statistics & numerical data
  3. The persistence of naturally formed mit (Acarina: trombiculidae) foci in Malaysia
    Gentry JW, Phang OW, Manikumaran C
    Southeast Asian J Trop Med Public Health, 1977 Jun;8(2):214-6.
    PMID: 918712
    Mite foci were fenced above and below ground to prevent the entry of host animals and to prevent the migration of mites within the soil. Weekly counts were made over a period of thirty weeks with larvae being collected at the beginning and end of the study, but not during the intervening period of hot, dry weather. Post-larval forms can survive for long periods and mite foci can remain productive without being visited by the host animals. Mite foci may be missed by normal survey methods during hot, dry weather.
    Matched MeSH terms: Population Density
  4. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations
    Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
    Matched MeSH terms: Population Groups/ethnology; Population Groups/genetics
  5. Transition of water demand and treatment plant overcapacity: a case study of the Seoul Metropolitan City, Korea
    Lee S, Park H
    Water Sci Technol, 2010;61(12):3129-40.
    PMID: 20555209 DOI: 10.2166/wst.2010.454
    This study deals with the overcapacity problem of water treatment plants in Korea, and mainly discusses status, causes, and engineering options. To this end, we first statistically analyze the recent trend of demand, revealing that the demands of small- and mid-size systems are still increasing while that of large-size systems is now decreasing. Since the existing approach to plan capacity implicitly assumes that demand will increase at a regular rate, we estimate excess capacities and system utilizations of large-size systems. From these results it is found that the large-size systems are suffering from serious overcapacity, thus necessitating that engineers make very difficult decisions given that systems are still expanding the capacities of plants due to a lack of awareness of the current demand trend. For other systems where there is a better understanding of the transition of demand, planners have ceased to expand plants or have closed down relatively old plants in efforts to reduce O&M costs. To address this problem, quick recognition of the transition of demand is being highlighted by the concepts of integrated resources management and cybernetics. Therefore, we examined how quickly the new trend of the Seoul case could be precisely recognized and appropriately addressed. Using the Bayesian parameter estimation method, we found that a new trend can be recognized six years after the transition of demand.
    Matched MeSH terms: Population Density; Urban Population*
  6. Constraint analysis to improve integrated dairy production systems in developing countries: the importance of participatory rural appraisal
    Devendra C
    Trop Anim Health Prod, 2007 Dec;39(8):549-56.
    PMID: 18265864
    The paper describes the rationale and importance of the approaches and methodologies of Participatory Rural Appraisal (PRA) to enable constraint analysis, to understand the complexities of farming systems and to improve integrated dairy productivity. Implicit in this objective is Farming Systems Research (FSR), which focused on cropping systems in the 1970's, with the subsequent addition of animal components. The methodology for FSR involves the following sequential components: site selection, site description and characterization (diagnosis), planning of on-farm research, on-farm testing and validation of alternatives, diffusion of results, and impact assessment. PRA is the development of FSR, which involves the active participation of farmers to identify constraints and plan appropriate solutions. In the Coordinated Research Project (CRP), the approach was adapted to 10 different country situations and led to Economic Opportunity Surveys (EOS) and Diagnostic Surveillance Studies (DSS), allowing the planning and implantation of integrated interventions to improve dairy productivity.
    Matched MeSH terms: Population Surveillance; Rural Population*
  7. Population structure and intraspecific aggression in the invasive ant species Anoplolepis gracilipes in Malaysian Borneo
    Drescher J, Blüthgen N, Feldhaar H
    Mol Ecol, 2007 Apr;16(7):1453-65.
    PMID: 17391269
    Invasive species are one of the main sources of the ongoing global loss of biodiversity. Invasive ants are known as particularly damaging invaders and their introductions are often accompanied by population-level behavioural and genetic changes that may contribute to their success. Anoplolepis gracilipes is an invasive ant that has just recently received increased attention due to its negative impact on native ecosystems. We examined the behaviour and population structure of A. gracilipes in Sabah, Malaysia. A total of 475 individuals from 24 colonies were genotyped with eight microsatellite markers. Intracolonial relatedness was high, ranging from 0.37 to 1 (mean +/- SD: 0.82 +/- 0.04), while intercolonial relatedness was low (0.0 +/- 0.02, range -0.5-0.76). We compared five distinct sampling regions in Sabah and Brunei. A three-level hierarchical F-analysis revealed high genetic differentiation among colonies within the same region, but low genetic differentiation within colonies or across regions. Overall levels of heterozygosity were unusually high (mean H(O) = 0.95, mean H(E) = 0.71) with two loci being entirely heterozygous, indicating an unusual reproductive system in this species. Bioassays revealed a negative correlation between relatedness and aggression, suggesting kinship as one factor facilitating supercolony formation in this species. Furthermore, we genotyped one individual per nest from Sabah (22 nests), Sarawak (one nest), Brunei (three nests) and the Philippines (two nests) using two mitochondrial DNA markers. We found six haplotypes, two of which included 82.1% of all sequences. Our study shows that the sampled area in Sabah consists of a mosaic of differently interrelated nests in different stages of colony establishment. While some of the sampled colonies may belong to large supercolonies, others are more likely to represent recently introduced or dispersed propagules that are just beginning to expand.
    Matched MeSH terms: Genetics, Population*; Population Dynamics
  8. Microsatellites reveal a lack of structure in Australian populations of the diamondback moth, Plutella xylostella (L.)
    Endersby NM, McKechnie SW, Ridland PM, Weeks AR
    Mol Ecol, 2006 Jan;15(1):107-18.
    PMID: 16367834
    The diamondback moth, Plutella xylostella, is renowned for developing resistance to insecticides and causing significant economic damage to Brassica vegetable crops throughout the world. Yet despite its economic importance, little is known about the population structure and movement patterns of this pest both at local and regional scales. In Australia, the movement patterns and insecticide resistance status of P. xylostella infesting canola, vegetables, forage brassicas and weeds have fundamental implications for the management of this pest. Here we use six polymorphic microsatellite loci to investigate population structure and gene flow in Australian populations of P. xylostella. Samples of P. xylostella from New Zealand, Malaysia, Indonesia and Kenya were also scored at these loci. We found no evidence of population structure within Australia, with most populations having low inbreeding coefficients and in Hardy-Weinberg equilibrium. In addition, a sample from the North Island of New Zealand was indistinguishable from the Australian samples. However, large genetic differences were found between the Australia/New Zealand samples and samples from Kenya, Malaysia and Indonesia. There was no relationship between genetic distance and geographic distance among Australian and New Zealand samples. Two of the loci were found to have null alleles, the frequency of which was increased in the populations outside the Australia/New Zealand region. We discuss these results with reference to insecticide resistance management strategies for P. xylostella in Australia.
    Matched MeSH terms: Genetics, Population*; Population Dynamics
  9. Patterns of genetic diversity and migration in increasingly fragmented and declining orang-utan (Pongo pygmaeus) populations from Sabah, Malaysia
    Goossens B, Chikhi L, Jalil MF, Ancrenaz M, Lackman-Ancrenaz I, Mohamed M, et al.
    Mol Ecol, 2005 Feb;14(2):441-56.
    PMID: 15660936
    We investigated the genetic structure within and among Bornean orang-utans (Pongo pygmaeus) in forest fragments of the Lower Kinabatangan flood plain in Sabah, Malaysia. DNA was extracted from hair and faecal samples for 200 wild individuals collected during boat surveys on the Kinabatangan River. Fourteen microsatellite loci were used to characterize patterns of genetic diversity. We found that genetic diversity was high in the set of samples (mean H(E) = 0.74) and that genetic differentiation was significant between the samples (average F(ST) = 0.04, P < 0.001) with F(ST) values ranging from low (0.01) to moderately large (0.12) values. Pairwise F(ST) values were significantly higher across the Kinabatangan River than between samples from the same river side, thereby confirming the role of the river as a natural barrier to gene flow. The correlation between genetic and geographical distance was tested by means of a series of Mantel tests based on different measures of geographical distance. We used a Bayesian method to estimate immigration rates. The results indicate that migration is unlikely across the river but cannot be completely ruled out because of the limited F(ST) values. Assignment tests confirm the overall picture that gene flow is limited across the river. We found that migration between samples from the same side of the river had a high probability indicating that orang-utans used to move relatively freely between neighbouring areas. This strongly suggests that there is a need to maintain migration between isolated forest fragments. This could be done by restoring forest corridors alongside the river banks and between patches.
    Matched MeSH terms: Genetics, Population*; Population Dynamics
  10. Fulltext Deep whole-genome sequencing of 100 southeast Asian Malays
    Wong LP, Ong RT, Poh WT, Liu X, Chen P, Li R, et al.
    Am J Hum Genet, 2013 Jan 10;92(1):52-66.
    PMID: 23290073 DOI: 10.1016/j.ajhg.2012.12.005
    Whole-genome sequencing across multiple samples in a population provides an unprecedented opportunity for comprehensively characterizing the polymorphic variants in the population. Although the 1000 Genomes Project (1KGP) has offered brief insights into the value of population-level sequencing, the low coverage has compromised the ability to confidently detect rare and low-frequency variants. In addition, the composition of populations in the 1KGP is not complete, despite the fact that the study design has been extended to more than 2,500 samples from more than 20 population groups. The Malays are one of the Austronesian groups predominantly present in Southeast Asia and Oceania, and the Singapore Sequencing Malay Project (SSMP) aims to perform deep whole-genome sequencing of 100 healthy Malays. By sequencing at a minimum of 30× coverage, we have illustrated the higher sensitivity at detecting low-frequency and rare variants and the ability to investigate the presence of hotspots of functional mutations. Compared to the low-pass sequencing in the 1KGP, the deeper coverage allows more functional variants to be identified for each person. A comparison of the fidelity of genotype imputation of Malays indicated that a population-specific reference panel, such as the SSMP, outperforms a cosmopolitan panel with larger number of individuals for common SNPs. For lower-frequency (<5%) markers, a larger number of individuals might have to be whole-genome sequenced so that the accuracy currently afforded by the 1KGP can be achieved. The SSMP data are expected to be the benchmark for evaluating the value of deep population-level sequencing versus low-pass sequencing, especially in populations that are poorly represented in population-genetics studies.
    Matched MeSH terms: Genetics, Population; Population Groups/genetics
  11. Evolution. Did early humans go north or south?
    Forster P, Matsumura S
    Science, 2005 May 13;308(5724):965-6.
    PMID: 15890867
    Matched MeSH terms: Genetics, Population; Population Dynamics*
  12. Fulltext Gender differences in socioeconomic returns to family migration in Malaysia: the role of family decision making versus labor market stratification
    Chattopadhyay A
    Gender Issues, 2000;18(2):29-47.
    PMID: 12296212 DOI: 10.1007/s12147-000-0009-y
    In this article the author examines gender differences in the effect of family migration on socioeconomic attainment in Malaysia. The analysis discerns the relative importance of gender roles in household migration decisions, compared to gender stratification in the labor market. The Malaysian economy has undergone rapid industrialization and great structural changes which have opened up new economic opportunities, particularly for women. Despite the somewhat advantaged position of women compared to men in the Malaysian labor market, the author finds that men experience much greater socioeconomic gains than women from family migration. Hence indicating that family migration decisions in Malaysia, rather than optimizing family gains, compensate for the gender effect in the labor market. However, the gains of Malaysian men are more assured when they move alone. Data for the study come from the second round of the Malaysian Family Life Survey.
    Matched MeSH terms: Population; Population Characteristics; Population Dynamics
  13. Knocking at the door: Asian immigration to Australia
    Hugo G
    Asian Pac Migr J, 1992;1(1):100-44.
    PMID: 12317236
    "This paper assesses the level and composition of contemporary Asian immigration to Australia and explores its processes and impacts. The final reversal of the White Australia Policy in the 1970s opened the door to substantial increases in Asian immigration, particularly from Vietnam, Malaysia, the Philippines, China, India and Hong Kong." Aspects considered include migrant categories, age, sex, and social and economic adaptation to Australia.
    Matched MeSH terms: Population; Population Characteristics; Population Dynamics
  14. Chinese culture and fertility decline
    Wu C, Jia S
    Chin J Popul Sci, 1992;4(2):95-103.
    PMID: 12317926
    Matched MeSH terms: Population; Population Characteristics; Population Dynamics
  15. Chinese culture and demographic trends in Thailand and Malaysia
    Barbie J
    Chin J Popul Sci, 1992;4(2):139-48.
    PMID: 12317919
    Matched MeSH terms: Population; Population Characteristics; Population Dynamics
  16. Asian student migration to Australia
    Shu J, Hawthorne L
    Int Migr, 1996;34(1):65-95.
    PMID: 12291796
    "This paper presents an overview of Asian student migration to Australia, together with an analysis of political and educational aspects of the overseas student programme. It focuses on some significant consequences of this flow for Australia. The characteristics of key student groups are contrasted to provide some perspective of the diversity of historical and cultural backgrounds, with the source countries of Malaysia, Indonesia and PRC [China] selected as case studies. Since the issue of PRC students in Australia has attracted considerable public attention and policy consideration, particular focus is placed on their experience." (SUMMARY IN FRE AND SPA)
    Matched MeSH terms: Population; Population Characteristics; Population Dynamics
  17. [[Changes in population and households in a Malay village, 1971-1991]]
    Tsubouchi Y
    Tonan Ajia Kenkyu, 1992 Sep;30(2):192-212.
    PMID: 12157850
    "The Malay village of Galok in Kelantan was revisited [in]...1991 to investigate the changes in the population and households in the 20 years since the first intensive community study was conducted there in 1970/71. Major economic activities in 1970/71 were paddy cultivation in rain-fed fields, small scale rubber tapping, and newly introduced tobacco cultivation. The village's population increased from 690 in 1971 to 1,100 in 1991, and the number of households from 145 to 211. Despite the increase in population and households, the households cultivating paddy decreased from 71 to 36, those tapping rubber from 94 to 53, and those growing tobacco from 124 to 40, while regular employment, irregular wage labor in the surrounding areas, and temporary migratory work in Singapore increased remarkably. Many people moved out of the village and many others moved in. Though the former exceed the latter in number, the village population is still increasing owing to the high fertility...." (SUMMARY IN ENG)
    Matched MeSH terms: Population; Population Dynamics*
  18. From 'White Australia' to 'part of Asia': recent shifts in Australian immigration policy towards the region
    Jupp J
    Int Migr Rev, 1995;29(1):207-28.
    PMID: 12319613
    Matched MeSH terms: Population; Population Characteristics; Population Dynamics
  19. Brunei Darussalam
    United States. Department of State. Bureau of Public Affairs
    Backgr Notes Ser, 1985 Apr.
    PMID: 12178106
    Matched MeSH terms: Population; Population Characteristics*
  20. Demographic development in ASEAN: a comparative overview
    Herrin AN, Pardoko H, Lim LL, Hongladorom C
    Philipp Rev Econ Bus, 1981 Sep-Dec;18(3-4):132-53.
    PMID: 12178278
    Matched MeSH terms: Population; Population Dynamics*
Related Terms
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links