Displaying publications 981 - 1000 of 2693 in total

Abstract:
Sort:
  1. Fazalda A, Quraisiah A, Nur Azlina MF
    PMID: 30105063 DOI: 10.1155/2018/7515692
    Background: Peptic ulcer is a basic term for ulcers on the lower oesophagus, stomach, or jejunum. The specific term for ulcer in the stomach is gastric ulcer. The extensive use of honey around the globe helps researchers to study the usefulness of honey. Many studies had already been conducted and proved the effectiveness of honey in treating gastric ulcer.

    Methods: A systematic review of the literature was conducted to identify relevant studies on honey used as an alternative treatment of gastric ulcer cause by NSAIDs. A comprehensive search was conducted in Medline, SCOPUS, and Ebscohost. The main criteria used were articles published in English and using NSAIDs-induced gastric ulcer in rat's model and those reporting the effectiveness of honey.

    Results: Articles published between 2001 and 2014 were identified to be relevant in studies related to the inclusion criteria. The literature search found 30 potential and closely related articles in this review, but only 5 articles were taken which meet the criteria needed to be fulfilled.

    Conclusions: All studies in this review reported the efficacy of honey for gastric ulcer based on its antioxidant and cytoprotective activities. Most of the studies conducted used different types of honey at various doses on rats. Future studies should be conducted to identify the appropriate dose for humans to achieve similar gastroprotective effects.

    Matched MeSH terms: Rats
  2. Visweswara Rao P, Madhavi K, Dhananjaya Naidu M, Gan SH
    PMID: 24204387 DOI: 10.1155/2013/102901
    The present study was designed to investigate the total carbohydrate, total protein, and glycogen levels in the liver and to measure functional liver markers such as aspartate aminotransferase (AST) and alanine aminotransferase (ALT) in streptozotocin-(STZ-) induced diabetic rats after treatment with methanolic extract of Rhinacanthus nasutus (R. nasutus). The methanolic extract of R. nasutus was orally administered at 200 mg/kg/day while glibenclamide was administered at 50 mg/kg/day. All animals were treated for 30 days before being sacrificed. The amounts of carbohydrate, glycogen, proteins, and liver markers (AST and ALT) were measured in the liver tissue of the experimental animals. The levels of carbohydrate, glycogen, and proteins were significantly reduced in the diabetic rats but were augmented considerably after 30 days of R. nasutus treatment. The elevated AST and ALT levels in diabetic rats showed a significant decline after treatment with R. nasutus for 30 days. These results show that the administration of R. nasutus ameliorates the altered levels of carbohydrate, glycogen, proteins, and AST and ALT observed in diabetic rats and indicate that R. nasutus restores overall metabolism and liver function in experimental diabetic rats. In conclusion, the outcomes of the present study support the traditional belief that R. nasutus could ameliorate the diabetic state.
    Matched MeSH terms: Rats
  3. Sultan MT, Butt MS, Karim R, Zia-Ul-Haq M, Batool R, Ahmad S, et al.
    PMID: 24511321 DOI: 10.1155/2014/826380
    In the recent era, diabetes mellitus has emerged as one of the significant threats to public health and this situation demands the attention of the researchers and allied stakeholders. Dietary regimens using functional and nutraceutical foods are gaining wide range of acceptance and some traditional medicinal plants are of considerable importance. The main objective of this instant study was to explore the antidiabetic potential of Nigella sativa fixed oil (NSFO) and essential oil (NSEO). Three experimental groups of rats received diets during the entire study duration, that is, D1 (control), D2 (NSFO: 4.0%), and D3 (NSEO: 0.30%). Experimental diets (NSFO & NSEO) modulated the lipid profile, while decreasing the antioxidant damage. However, production of free radicals, that is, MDA, and conjugated dienes increased by 59.00 and 33.63%, respectively, in control. On the contrary, NSFO and NSEO reduced the MDA levels by 11.54 and 26.86% and the conjugated dienes levels by 32.53 and 38.39%, respectively. N. sativa oils improved the health and showed some promising anti-diabetic results.
    Matched MeSH terms: Rats
  4. Cheng PG, Phan CW, Sabaratnam V, Abdullah N, Abdulla MA, Kuppusamy UR
    PMID: 24348715 DOI: 10.1155/2013/671252
    Ganoderma lucidum (M.A. Curtis:Fr.) P. Karst is a popular medicinal mushroom. Scientific reports had shown that the wound healing effects of G. lucidum were partly attributed to its rich polysaccharides. However, little attention has been paid to its potential effects on wounds associated with diabetes mellitus. In this study, we evaluated the wound healing activity of the hot aqueous extract of G. lucidum in streptozotocin-induced diabetic rats. The extract of G. lucidum was standardised based on chemical contents (w/w) of total polysaccharides (25.1%), ganoderic acid A (0.45%), and adenosine (0.069%). Six groups of six rats were experimentally wounded in the posterior neck region. Intrasite gel was used as a positive control and aqueous cream as the placebo. Topical application with 10% (w/w) of mushroom extract-incorporated aqueous cream was more effective than that with Intrasite gel in terms of wound closure. The antioxidant activity in serum of rats treated with aqueous extract of G. lucidum was significantly higher; whereas the oxidative protein products and lipid damage were lower when compared to those of the controls. These findings strongly support the beneficial effects of standardised aqueous extract of G. lucidum in accelerating wound healing in streptozotocin-induced diabetic rats.
    Matched MeSH terms: Rats
  5. Giribabu N, Eswar Kumar K, Swapna Rekha S, Muniandy S, Salleh N
    PMID: 25852767 DOI: 10.1155/2015/542026
    The effect of V. vinifera seeds on carbohydrate metabolizing enzymes and other enzymes of the liver in diabetes is currently unknown. We therefore investigated changes in the activity levels of these enzymes following V. vinifera seed extract administration to diabetic rats. Methods. V. vinifera seed ethanolic extract (250 and 500 mg/kg/day) or glibenclamide (600 μg/kg/day) was administered to streptozotocin-induced male diabetic rats for 28 consecutive days. At the end of treatment, liver was harvested and activity levels of various liver enzymes were determined. Levels of thiobarbituric acid reactive substances (TBARS) were measured in liver homogenates and liver histopathological changes were observed. Results. V. vinifera seed ethanolic extract was able to prevent the decrease in ICDH, SDH, MDH, and G-6-PDH and the increase in LDH activity levels in liver homogenates. The seed extract also caused serum levels of ALT, AST, ALP, ACP, GGT, and total bilirubin to decrease while causing total proteins to increase. Additionally, the levels of ALT, AST, and TBARS in liver homogenates were decreased. Histopathological changes in the liver were reduced. Conclusion. Near normal activity levels of various enzymes and histology of the liver following V. vinifera seed ethanolic extract administration may be due to decrease in liver oxidative stress in diabetes.
    Matched MeSH terms: Rats
  6. Fan SH, Ali NA, Basri DF
    PMID: 25254062 DOI: 10.1155/2014/976764
    The present study aims to investigate the analgesic activity of the methanol extract of the galls of Quercus infectoria in rats using hot plate and tail-flick methods. The extract was administered intraperitoneally at a dose of 20 mg/kg while morphine sulfate and sodium salicylate (10 mg/kg) served as standards. The methanol extract exhibited significant analgesic activity in the tail-flick model (P < 0.05) by increasing the reaction time of the rats to 8.0 sec at 30 min after treatment in comparison to control (4.4 sec). Morphine sulfate produced a reaction time of 11.9 sec in the same test. At the peak of activity (30 min), the extract produced maximum possible analgesia (MPA) of 34.2%, whilst morphine sulfate achieved a peak MPA of 70.9%. No analgesic effects have been observed using sodium salicylate in the tail-flick model. In the same model, the extract and sodium salicylate demonstrated comparable reaction times. Tail-flick is a better method to evaluate analgesic activity as no significant results were observed for all treatments using hot plate with the exception of morphine sulfate, which showed significant results only at 45 and 60 min after treatment. In conclusion, the methanol extract of the galls of Quercus infectoria displayed analgesic activity.
    Matched MeSH terms: Rats
  7. Abukhadir SS, Mohamed N, Makpol S, Muhammad N
    PMID: 23049610 DOI: 10.1155/2012/656025
    The study determines the effects of palm vitamin E on the gene expression of bone-formation-related genes in nicotine-treated rats. Male rats were divided into three groups: normal saline olive oil (NSO), nicotine olive oil (NO), and nicotine palm vitamin E (NE). The treatment was carried out in 2 phases. During the first 2 months, the NSO group received normal saline while the NO and NE groups received nicotine 7 mg/kg, 6 days a week, intraperitoneally. The following 2 months, normal saline and nicotine administration was stopped and was replaced with oral supplementation of olive oil for the NSO and NO groups and oral supplementation of palm vitamin E (60 mg/kg) for the NE group. Both femurs were harvested to determine the gene expression of bone morphogenetic protein-2 (BMP-2), Osterix (OSX), and Runt-related transcription factor 2 (RUNX2). Nicotine significantly downregulated the gene expression. This effect was reversed by palm vitamin E treatment. In conclusion, palm vitamin E may play a role in osteoblast differentiation and can be considered as an anabolic agent to treat nicotine-induced osteoporosis.
    Matched MeSH terms: Rats
  8. Hayatullina Z, Muhammad N, Mohamed N, Soelaiman IN
    PMID: 23024690
    Oxidative stress and free radicals have been implicated in the pathogenesis of osteoporosis. Therefore, antioxidant compounds have the potential to be used in the prevention and treatment of the disease. In this study, we investigated the effects of virgin coconut oil (VCO) on bone microarchitecture in a postmenopausal osteoporosis rat model. VCO is a different form of coconut oil as it is rich with antioxidants. Three-month-old female rats were randomly grouped into baseline, sham-operated, ovariectomized control (Ovx), and ovariectomized rats fed with 8% VCO in their diet for six weeks (Ovx+VCO). Bone histomorphometry of the right femora was carried out at the end of the study. Rats supplemented with VCO had a significantly greater bone volume and trabecular number while trabecular separation was lower than the Ovx group. In conclusion, VCO was effective in maintaining bone structure and preventing bone loss in estrogen-deficient rat model.
    Matched MeSH terms: Rats
  9. Sidahmed HM, Abdelwahab SI, Mohan S, Abdulla MA, Mohamed Elhassan Taha M, Hashim NM, et al.
    PMID: 23634169 DOI: 10.1155/2013/450840
    Cratoxylum arborescens (Vahl) Blume is an Asian herbal medicine with versatile ethnobiological properties including treatment of gastric ulcer. This study evaluated the antiulcerogenic mechanism(s) of α -mangostin (AM) in a rat model of ulcer. AM is a prenylated xanthone derived through biologically guided fractionation of C. arborescens. Rats were orally pretreated with AM and subsequently exposed to acute gastric lesions induced by ethanol. Following treatment, ulcer index, gastric juice acidity, mucus content, histological and immunohistochemical analyses, glutathione (GSH), malondialdehyde (MDA), nitric oxide (NO), and nonprotein sulfhydryl groups (NP-SH) were evaluated. The anti-Helicobacter pylori, cyclooxygenase-2 (COX-2) inhibitory effect, and antioxidant activity of AM were also investigated in vitro. AM (10 and 30 mg/kg) inhibited significantly (P < 0.05) ethanol-induced gastric lesions by 66.04% and 74.39 %, respectively. The compound induces the expression of Hsp70, restores GSH levels, decreases lipid peroxidation, and inhibits COX-2 activity. The minimum inhibitory concentration (MIC) of AM showed an effective in vitro anti-H. pylori activity. The efficacy of the AM was accomplished safely without presenting any toxicological parameters. The results of the present study indicate that the antioxidant properties and the potent anti-H. pylori, in addition to activation of Hsp70 protein, may contribute to the gastroprotective activity of α -mangostin.
    Matched MeSH terms: Rats
  10. Song SL, Yong HS, Eamsobhana P
    J Helminthol, 2018 Jul;92(4):524-529.
    PMID: 28693647 DOI: 10.1017/S0022149X1700061X
    Angiostrongylus mackerrasae is a parasitic nematode of rats found in Australia. When first reported, it was referred to as A. cantonensis. Recent molecular studies, including the mitochondrial genome, indicate that it is highly similar to A. cantonensis. These studies did not include A. malaysiensis, another member of the A. cantonensis species complex, for comparison. The present study examined the genetic distance and phylogenetic relationship between the component taxa (A. cantonensis, A. mackerrasae and A. malaysiensis) of the A. cantonensis species complex, based on the 12 protein-coding genes (PCGs) of their mitochondrial genome. Both the nucleotide and amino acid sequences were analysed. Angiostrongylus mackerrasae and A. cantonensis are members of the same genetic lineage and both are genetically distinct from A. malaysiensis. The genetic distance based on concatenated nucleotide sequences of 12 mt-PCGs between A. mackerrasae and A. cantonensis from Thailand is p = 1.73%, while that between the Thai and Chinese taxa of A. cantonensis is p = 3.52%; the genetic distance between A. mackerrasae and A. cantonensis from China is p = 3.70%. The results indicate that A. mackerrasae and A. cantonensis belong to the same genetic lineage, and that A. mackerrasae may be conspecific with A. cantonensis. It remains to be resolved whether A. mackerrasae is conspecific with A. cantonensis or undergoing incipient speciation.
    Matched MeSH terms: Rats
  11. Lee FK, Chan NJ, Krishnan P, Datu Abdul Salam DS, Chee XW, Muhamad A, et al.
    J Nat Prod, 2024 Apr 26;87(4):675-691.
    PMID: 38442031 DOI: 10.1021/acs.jnatprod.3c00707
    Schwarzinicines A-D, a series of alkaloids recently discovered from Ficus schwarzii, exhibit pronounced vasorelaxant activity in rat isolated aorta. Building on this finding, a concise synthesis of schwarzinicines A and B has been reported, allowing further investigations into their biological properties. Herein, a preliminary exploration of the chemical space surrounding the structure of schwarzinicine A (1) was carried out aiming to identify structural features that are essential for vasorelaxant activity. A total of 57 analogs were synthesized and tested for vasorelaxant activity in rat isolated aorta. Both efficacy (Emax) and potency (EC50) of these analogs were compared. In addition to identifying structural features that are required for activity or associated with potency enhancement effect, four analogs showed significant potency improvements of up to 40.2-fold when compared to 1. Molecular dynamics simulation of a tetrameric 44-bound transient receptor potential canonical-6 (TRPC6) protein indicated that 44 could potentially form important interactions with the residues Glu509, Asp530, Lys748, Arg758, and Tyr521. These results may serve as a foundation for guiding further structural optimization of the schwarzinicine A scaffold, aiming to discover even more potent analogs.
    Matched MeSH terms: Rats
  12. Mustaffa F, Indurkar J, Ismail S, Mordi MN, Ramanathan S, Mansor SM
    Pharmacognosy Res, 2010 Mar;2(2):76-81.
    PMID: 21808545 DOI: 10.4103/0974-8490.62952
    Cinnomomum iners standardized leaves methanolic extract (CSLE) was subjected to analgesic, toxicity and phytochemical studies. The analgesic activity of CSLE was evaluated using formalin, hot plate and tail flick tests at doses of 100, 200 and 500 mg/kg. CSLE showed significant activity (P < 0.05) in the formalin model (late phase) on the rats at doses of 200 and 500 mg/kg. However, CSLE did not show activity in the hot plate and tail flick tests. The results obtained suggest that CSLE acts peripherally to relieve pain. For the toxicity study, CSLE was orally administered to the Swiss albino mice according to the Organization for Economic Co-Operation and Development (OECD) guideline 423. There was no lethality or toxic symptoms observed for all the tested doses throughout the 14-day period. Phytochemical screening of CSLE showed the presence of cardiac glycoside, flavonoid, polyphenol, saponin, sugar, tannin and terpenoid.
    Matched MeSH terms: Rats
  13. Rohman A, Nawwaruddin HH, Hossain MAM, Laksitorini MD, Lestari D
    Open Vet J, 2024 Sep;14(9):2484-2492.
    PMID: 39553767 DOI: 10.5455/OVJ.2024.v14.i9.37
    BACKGROUND: Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like rat meat (RM).

    AIM: This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs.

    METHODS: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples.

    RESULTS: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R 2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples.

    CONCLUSION: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.

    Matched MeSH terms: Rats
  14. Bashiri Z, Sharifi AM, Ghafari M, Hosseini SJ, Shahmahmoodi Z, Moeinzadeh A, et al.
    Int J Biol Macromol, 2024 Oct;277(Pt 4):134362.
    PMID: 39089552 DOI: 10.1016/j.ijbiomac.2024.134362
    Healing diabetic ulcers with chronic inflammation is a major challenge for researchers and professionals, necessitating new strategies. To rapidly treat diabetic wounds in rat models, we have fabricated a composite scaffold composed of alginate (Alg) and silk fibroin (SF) as a wound dressing that is laden with molecules of lithium chloride (LC). The physicochemical, bioactivity, and biocompatibility properties of Alg-SF-LC scaffolds were investigated in contrast to those of Alg, SF, and Alg-SF ones. Afterward, full-thickness wounds were ulcerated in diabetic rats in order to evaluate the capacity of LC-laden scaffolds to regenerate skin. The characterization findings demonstrated that the composite scaffolds possessed favorable antibacterial properties, cell compatibility, high swelling, controlled degradability, and good uniformity in the interconnected pore microstructure. Additionally, in terms of wound contraction, re-epithelialization, and angiogenesis improvement, LC-laden scaffolds revealed better performance in diabetic wound healing than the other groups. This research indicates that utilizing lithium chloride molecules loaded in biological materials supports the best diabetic ulcer regeneration in vivo, and produces a skin replacement with a cellular structure comparable to native skin.
    Matched MeSH terms: Rats
  15. Basheer M, Hassan Z, Gam LH
    Int J Med Sci, 2023;20(1):102-113.
    PMID: 36619231 DOI: 10.7150/ijms.78861
    Background: Mitragyna speciosa Korth or Kratom is widely used traditionally for its medicinal values. The major alkaloid content of kratom leaves is mitragynine, which binds to opioid receptors to give opioid-like effects. This study aimed to analyse the brain proteome of animals that displayed addictive behaviors. Design and Methods: Six groups (n=6-8) of rats made up of negative control, positive control using morphine (10 mg/kg), and treatment groups at low (1mg/kg) and high doses of mitragynine (30 mg/kg) for 1 and 4 days. The rats' behaviors were evaluated and subsequently the rats' brains were harvested for proteomic analysis that was performed by using 2D gel electrophoresis and LC/MS/MS. Results: The rats developed physical dependence only on day 4 following morphine and mitragynine (1 and 30mg/kg) treatments. Among the proteins that were up-regulated in treatment groups were four calcium-binding proteins, namely calretinin, F-actin, annexin A3 and beta-centractin. Conclusions: Upregulation of calretinin acted as low Ca2+ buffering upon the blockage of Ca2+ ion channel by mitragynine in the brain, which subsequently caused a reduction of GABA released and inversely increased the dopamine secretions that contributed to dependence indicators.
    Matched MeSH terms: Rats
  16. Leow SS, Khoo JS, Lee WK, Hoh CC, Fairus S, Sambanthamurthi R, et al.
    J Appl Genet, 2024 Dec;65(4):867-895.
    PMID: 38890243 DOI: 10.1007/s13353-024-00880-1
    Water-Soluble Palm Fruit Extract (WSPFE) has been shown to confer anti-diabetic effects in the Nile rat (NR) (Arvicanthis niloticus). Liquid and powder WSPFE both deterred diabetes onset in NRs fed a high-carbohydrate (hiCHO) diet, but the liquid form provided better protection. In this study, NRs were fed either a hiCHO diet or the same diet added with liquid or powder WSPFE. Following feeding of the diets for 8 weeks, random blood glucose levels were measured to categorize NRs as either diabetes-resistant or diabetes-susceptible, based on a cut-off value of 75 mg/dL. Livers were then obtained for Illumina HiSeq 4000 paired end RNA-sequencing (RNA-Seq) and the data were mapped to the reference genome. Consistent with physiological and biochemical parameters, the gene expression data obtained indicated that WSPFE was associated with protection against diabetes. Among hepatic genes upregulated by WSPFE versus controls, were genes related to insulin-like growth factor binding protein, leptin receptor, and processes of hepatic metabolism maintenance, while those downregulated were related to antigen binding, immunoglobulin receptor, inflammation- and cancer-related processes. WSPFE supplementation thus helped inhibit diabetes progression in NRs by increasing insulin sensitivity and reducing both the inflammatory effects of a hiCHO diet and the related DNA-damage compensatory mechanisms contributing to liver disease progression. In addition, the genetic permissiveness of susceptible NRs to develop diabetes was potentially associated with dysregulated compensatory mechanisms involving insulin signaling and oxidative stress over time. Further studies on other NR organs associated with diabetes and its complications are warranted.
    Matched MeSH terms: Rats
  17. Pasavei AG, Mohebbati R, Boroumand N, Ghorbani A, Hosseini A, Jamshidi ST, et al.
    Malays J Med Sci, 2020 Feb;27(1):57-69.
    PMID: 32158345 DOI: 10.21315/mjms2020.27.1.6
    Introduction: The aim of the current study is to evaluate the antihyperlipidemic and anti-oxidative effects of hydro-alcoholic extract of marjoram (HAEM) in rats fed with a high-fat diet (HFD).

    Methods: In the experimental study, the rats were randomly divided into four groups of five rats in each and fed with high-fat diet for 12 weeks as follows: One group (normal diet group) was fed with a standard diet, one group was fed with HFD, and two groups were fed with HFD and orally fed with 150 and 450 mg/kg/day HAEM. The serum samples and liver tissues were used for measuring the biochemical and oxidative parameters and histopathological studies. HFD induced hepatosteatosis in rats as evidenced by the altered liver enzymes activity, serum lipid profile and oxidative status.

    Results: Serum lipid profile (triglyceride, cholesterol and low-density lipoprotein) in rats fed with HFD + HAEM (150 and 450 mg/kg/day) was significantly decreased. Furthermore, the evaluation of oxidative stress showed a reduction of the malondialdehyde (MDA) level and an increase in ferric-reducing anti-oxidant power. Meanwhile, liver enzyme activities declined in response to HAEM.

    Conclusion: Using the HAEM could be a future therapeutic agent in treating hepatosteatosis and reducing oxidative damages of HFD in the liver.

    Matched MeSH terms: Rats
  18. Alidadi H, Khorsandi L, Shirani M
    Malays J Med Sci, 2018 Mar;25(2):72-81.
    PMID: 30918457 DOI: 10.21315/mjms2018.25.2.8
    Background: Recent studies have demonstrated that many nanoparticles have an adverse or toxic effect on the kidney.

    Objective: To investigate the nephroprotective effect of quercetin (QT) against renal injury induced by titanium dioxide nanoparticles (NTiO2) in rats.

    Methods: NTiO2-intoxicated rats received 50 mg/kg of NTiO2 for seven days. The QT + NTiO2 group was pretreated with QT for seven days before being administered NTiO2. Uric acid, creatinine, and blood urea nitrogen were considered to be biomarkers of nephrotoxicity. Catalase (CAT) and superoxide dismutase (SOD) activities and renal levels of malondialdehyde (MDA) were measured to assess the oxidative stress caused by NTiO2.

    Results: NTiO2 significantly increased the plasma level of the biomarkers. It also significantly decreased the activities of CAT (P = 0.008) and SOD (P = 0.004), and significantly increased the MDA levels (P = 0.007). NTiO2 caused proximal tubule damage, the accumulation of red blood cells, the infiltration of inflammatory cells, and reduced the glomerular diameters, as well as induced apoptosis in the proximal tubules. Pre-treatment with QT attenuated the histological changes, normalised the plasma biomarkers, suppressed oxidative stress, ameliorated the activities of CAT (P = 0.007) and SOD (P = 0.006), and reduced apoptosis (P < 0.001).

    Conclusion: QT was found to have a potent protective effect against nephrotoxicity induced by NTiO2 in rats. It also reduced apoptosis caused by NTiO2.

    Matched MeSH terms: Rats
  19. Hamid A, Lee LS, Karim SR, Jufri NF
    Malays J Med Sci, 2018 Mar;25(2):64-71.
    PMID: 30918456 MyJurnal DOI: 10.21315/mjms2018.25.2.7
    Background: Zerumbone (ZER) is a major bioactive compound of Zingiber zerumbet, a wild ginger plant that has been documented to have anti-proliferative, anti-inflammatory and anti-oxidant properties. To investigate its hepatoprotective potential, this study was designed to determine the treatment effects of ZER on acute hepatotoxicity induced by paracetamol (PCM) in rats.

    Methods: The control group was administered with phosphate buffer solution (PBS) while the other two groups received PCM alone (1000 mg/kg) and PCM + 25 mg/kg ZER, respectively, at 0 h and 4 h after PCM injection. After 24 h, the blood and liver were collected for differential white blood cell count, liver histological observation and biochemical analysis including alanine aminotransferase (ALT), aspartate aminotransferase (AST), and total protein concentration in serum and liver.

    Results: Treatment with ZER was found to significantly reduce ALT (P = 0.041), AST (P = 0.044) and total hepatic protein (P = 0.045) in comparison to PCM-induced rats. Rats treated with ZER exhibited the normal structure of hepatocytes with no vacuolisation or necrosis and showed significantly reduced neutrophil count (P = 0.037). This finding suggests its ability to suppress the inflammatory processes caused by PCM overdosage and decrease the hepatocytes tendency to go through necrotic processes.

    Conclusion: ZER possessed protective activity against PCM-induced acute hepatotoxicity in a rat model.

    Matched MeSH terms: Rats
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links