Displaying publications 1 - 20 of 306 in total

Abstract:
Sort:
  1. MILLIS J
    Med J Malaya, 1956 Dec;11(2):119-25.
    PMID: 13417935
    Matched MeSH terms: Population Groups*
  2. Duraisamy G, Amarasingham RD
    Med J Malaya, 1971 Jun;25(4):257-62.
    PMID: 4261296
    Matched MeSH terms: Continental Population Groups*
  3. Pallie W
    Med J Malaya, 1968 Sep;23(1):67-72.
    PMID: 4237562
    Matched MeSH terms: Continental Population Groups*
  4. Ahmad B, Khalid BA, Quek KF, Anuar Z, Phipps ME
    Med J Malaysia, 2013 Aug;68(4):309-14.
    PMID: 24145258 MyJurnal
    A cross-sectional study involving seven Orang Asli
    settlements located in three different states in Peninsular
    Malaysia; Johor, Selangor and Perak.
    Matched MeSH terms: Population Groups*
  5. Kari FB, Masud MM, Yahaya SR, Saifullah MK
    Environ Monit Assess, 2016 Mar;188(3):173.
    PMID: 26887312 DOI: 10.1007/s10661-016-5162-1
    "Indigenous people" have been acknowledged as among the poorest and most socio-economically and culturally marginalized all over the world. This paper explores the socio-economic status of the indigenous people and their poverty profile within watershed and environmentally protected areas in Peninsular Malaysia. The findings of the study indicate that the "indigenous community" is likely to be poor if they live in environmentally sensitive and unprotected areas as compared to families under the new resettlement scheme. Inadequate access to basic education and employment contributed significantly to their poor economic status. The findings further reveal that the indigenous community is facing difficulties in receiving access and support in terms of basic needs such as housing, education, economic livelihood, and other social infrastructure. Moreover, the regulatory structure for the management of watershed areas as well as the emphasis for commodity crops such as palm oil and natural rubber have indirectly contributed toward the poverty level of the indigenous people.
    Matched MeSH terms: Population Groups*
  6. Panis CW, Lillard LA
    Popul Stud (Camb), 1995 Nov;49(3):463-79.
    PMID: 11608959
    Infant and child mortality rates have dropped sharply for all ethnic groups in Malaysia between 1950 and 1988, but persistent ethnic differences remain. In this article we assess the contribution of several potential reasons both for the decline and the remaining differences between the Malay and Chinese sub-populations. Increased use of health inputs is found to explain a substantial part of the decline, but increased education of mothers, and income growth are also important. Longer spacing between births, and, higher average age at birth as a result of lower fertility and higher age at marriage provide only a marginal direct contribution to the fall in mortality. We find that lower mortality among the Chinese is accounted for by their higher incomes and greater propensty to purchase medical care. We also control for self-selection among users of medical care, and find that those who use health care in Malaysia tend to be subject to higher-than-average risks.
    Matched MeSH terms: Continental Population Groups/history*
  7. Bain O, Ramachandran CP, Petter F, Mak JW
    Ann Parasitol Hum Comp, 1977 7 1;52(4):471-9.
    PMID: 931324
    Onchocerca dewittei n. sp. was collected from a wild Boar at the metatarse level (tendons and subcutaneous connective tissue); it can be differentiated from other species by the female cuticle showing straight ridges which overlap in the lateral fields, and by its relatively thick microfilaria (length 228-247 mu and width 6-7 mu). This suidean Onchocerca displays some primitive characters such as straight ridges and persistency of ten pairs of caudal papillae in the male; but as a whole this species is undoubtedly more highly evolved than O. raillieti Bain, Müller and coll., 1976, a parasite of Equidae.
    Matched MeSH terms: Animal Population Groups/parasitology*
  8. Ganendran A, Ogle CW
    Singapore Med J, 1975 Dec;16(4):256-8.
    PMID: 1224217
    Surveys in a number of European and American populations have found the frequency of occurrence of the heterozygotes for the gene for the dibucaine-resistant variant of cholinesterase (E.C.3.1.1.8) to be relatively constant. Similar surveys in Oriental population have shown low incidence of the same gene. This study done on the multi-racial population consisting of 3 major groups shows an absence of the gene for the dibucaine resistant variant of cholinesterase. This is supported by the clinical experience in the use of suxamethonium as a single dose in more than 25,000 individuals.
    Matched MeSH terms: Continental Population Groups*
  9. Hor JY, Lim TT, Chia YK, Ching YM, Cheah CF, Tan K, et al.
    Mult Scler Relat Disord, 2018 Jan;19:20-24.
    PMID: 29100047 DOI: 10.1016/j.msard.2017.10.015
    BACKGROUND: Neuromyelitis optica spectrum disorder (NMOSD) occurs worldwide in all ethnicities. Recently, population-based studies have shown that NMOSD is more common among non-White populations. There is scarce data about NMOSD prevalence in South East Asian populations.

    METHODS: (1) A population-based study was undertaken to estimate NMOSD prevalence in the multi-ethnic Penang Island, Malaysia, comprising Chinese, Malays, and Indians. Medical records of NMOSD patients followed up at the Penang General Hospital (the neurology referral centre in Penang Island) were reviewed. The 2015 diagnostic criteria of the International Panel for NMO Diagnosis were used for case ascertainment. (2) A review of population-based prevalence studies of NMOSD worldwide was carried out. PubMed and conference proceedings were searched for such studies.

    RESULTS: Of the 28 NMOSD patients, 14 were residents of Penang Island on prevalence day [13 (93%) Chinese and one (7%) Malay]. All 14 patients were females and aquaporin 4 seropositive. The prevalence of NMOSD in Penang Island was 1.99/100,000 population; according to ethnicities, the prevalence in Chinese was significantly higher than in Malays (3.31/100,000 vs 0.43/100,000, respectively, p = 0.0195).

    CONCLUSION: Based on our and other population-based studies, among Asians, East Asian origin populations (Chinese and Japanese) appear to have higher NMOSD prevalence than other Asian ethnic groups. Worldwide, Blacks seem to have the highest NMOSD prevalence. More studies in different geographical regions and ethnic groups will be useful to further inform about potential factors in NMOSD pathogenesis.

    Matched MeSH terms: Continental Population Groups/ethnology*
  10. Lavelle CL, Flinn RM, Foster TD, Hamilton MC
    J Anat, 1970 Jul;107(Pt 1):182-3.
    PMID: 5473274
    Matched MeSH terms: Continental Population Groups*
  11. Rosdi RA, Mohd Yusoff N, Ismail R, Soo Choon T, Saleem M, Musa N, et al.
    Ann. Hum. Biol., 2015 Sep 24.
    PMID: 26402341
    CYP2C9 gene polymorphisms modulate inter-individual variations in the human body's responses to various endogenous and exogenous drug substrates. To date, little is known about the CYP2C9 gene polymorphisms among the aboriginal populations of the world, including those in Malaysia.
    Matched MeSH terms: Population Groups
  12. Thuraisingham C, Sinniah D
    J Fam Pract, 2016 Feb;65(2):121-4.
    PMID: 26977463
    The appearance of the skin on this woman's face, hands, and feet helped us to recognize an advanced case of an autoimmune disease.
    Matched MeSH terms: Continental Population Groups
  13. Jaffry Zakaria
    MyJurnal
    The racial riot incident on 13th of May 1969 had opened the eyes of many people to realize on how important serious efforts to be focused in managing the sensitivity and the differences in multiracial society in countries like Malaysia. Many experts believe that integration can be build through outdoor education activities. The author will try to unravel and discuss on the outdoor education activity relations and integration campus community. This discussion will cover the latest issues and a variety of previous studies and personal experiences of the author as an outdoor education activist.
    Matched MeSH terms: Continental Population Groups
  14. Ismail R, Borhanuddin B
    Jurnal Psikologi Malaysia, 2009;olume 23:11-17.
    This qualitative study reviewed the concept of Mat Rempit. This study used two methods of interviews. Firstly, individual interviews were conducted with 16 individuals who were from a school in Semenyih, Selangor and they had been involved in rempit activities. Secondly,focus group interviews were conducted involving three groups of individuals who were charged under Section 42 for driving recklessly their motorcycles in Penang, Johor Baharu and Kuala Lumpur. The main results of interviews indicate that rempit can be defined as any activity involving a motorcycle racing team of at least two people Generally, the race comprised various actions such as doing a sprint, or a lap and also stunts (such as, a wheelie or wheekang). In addition, there is ramping of engines of molorcycles and creating excessively loud sounds as well as shouting and showing hand signals. A Mat Rempit is a person involved in these activities. Other related findings and implications are also discussed.
    Matched MeSH terms: Continental Population Groups
  15. Patoz A, Lussiana T, Gindre C, Hébert-Losier K
    Sports (Basel), 2019 Jun 17;7(6).
    PMID: 31212983 DOI: 10.3390/sports7060147
    Close to 90% of recreational runners rearfoot strike in a long-distance road race. This prevalence has been obtained from North American cohorts of runners. The prevalence of rearfoot strikers has not been extensively examined in an Asian population of recreational runners. Therefore, the aim of this study was to determine the prevalence of rearfoot, midfoot, and forefoot strikers during a long-distance road race in Asian recreational runners and compare this prevalence to reported values in the scientific literature. To do so, we classified the foot strike pattern of 950 recreational runners at the 10 km mark of the Singapore marathon (77% Asian field). We observed 71.1%, 16.6%, 1.7%, and 10.6% of rearfoot, midfoot, forefoot, and asymmetric strikers, respectively. Chi-squared tests revealed significant differences between our foot strike pattern distribution and those reported from North American cohorts (P < 0.001). Our foot strike pattern distribution was similar to one reported from elite half-marathon runners racing in Japan (Fisher exact test, P = 0.168). We conclude that the prevalence of rearfoot strikers is lower in Asian than North American recreational runners. Running research should consider and report ethnicity of participants given that ethnicity can potentially explain biomechanical differences in running patterns.
    Matched MeSH terms: Continental Population Groups
  16. Parker DB, Barrett RJ
    Intern Med J, 2003 Sep-Oct;33(9-10):463-4.
    PMID: 14511200 DOI: 10.1046/j.1445-5994.2003.00460.x
    Changes in medical research ethics in the past two decades have made the communication of risk to potential participants a legal imperative. Using ethnographic data from two different cultures, we examine the hazards associated with medical research in relation to the respective societal contexts that imbue them with meaning. The Iban, a Dayak people indigenous to Borneo, perceive the hazards of participating in research in terms of danger to the collective. In Australia they are construed in terms of risk to individuals. Risk in medical research is one manifestation of a broader notion of 'risk' that is constitutive of the research enterprise itself and, we argue, fundamental to post-industrial society.
    Matched MeSH terms: Population Groups
  17. Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
    Matched MeSH terms: Population Groups/ethnology; Population Groups/genetics
  18. Chia ZJ, Lim KS, Fong SL, Sim RS, Rajahram GS, Narayanan V, et al.
    Epilepsy Behav, 2020 09;110:107158.
    PMID: 32512367 DOI: 10.1016/j.yebeh.2020.107158
    BACKGROUND: Epilepsy stigma is an important issue affecting people with epilepsy (PWE) in various social aspects of life. Most studies on stigma were among the metropolitan population but rarely on indigenous people. Hence, this study aimed to understand the attitudes toward epilepsy of the East Malaysians, comparing with the West Malaysians previously reported.

    METHOD: This study was performed among the indigenous people in Kuching and Sibu (Sarawak) and Kota Kinabalu (Sabah) using the Public Attitudes Toward Epilepsy (PATE) scale. A higher score indicates poorer attitude.

    RESULT: A total of 360 respondents (41.7% Kadazan-Dusun, 30.6% Bidayuh, and 24.7% Iban) aged 34.6 ± 12.6 years completed the questionnaire. They were predominantly females and had lower education level and income compared with the West Malaysians. The Sabah population had significantly lower mean scores (better attitudes) than those in Sarawak, in both personal and general domains (p 

    Matched MeSH terms: Population Groups/ethnology*; Population Groups/psychology
Filters
Contact Us

Please provide feedback to Administrator (tengcl@gmail.com)

External Links