Displaying publications 1 - 20 of 22 in total

Abstract:
Sort:
  1. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations
    Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
    Matched MeSH terms: Population Groups/genetics
  2. Fulltext PIK3CA gene amplification and PI3K p110α protein expression in breast carcinoma
    Firoozinia M, Zareian Jahromi M, Moghadamtousi SZ, Nikzad S, Abdul Kadir H
    Int J Med Sci, 2014;11(6):620-5.
    PMID: 24782652 DOI: 10.7150/ijms.8251
    A family of PI3Ks is the lipid kinases, which enhance intracellular pools of phosphatidyl inositol 3,4,5-tri-phosphate (PIP3) through phosphorylating its precursor. Amplifications and deletions of genes, as well as somatic missense of the PIK3CA gene have been described in many human cancer varieties, including of the brain, colon, liver, lung and stomach. Immunohistochemistry and Real-time quantitative PCR tests were used to determine the PIK3CA gene amplification (gene copy number) and to detect protein expression, respectively. The results obtained were analysed and the ratio of PIK3CA to β-actin gene copy number was calculated. Positive gene amplification of PIK3CA was appointed as a copy number of ≥4. Also, PI3K p110α protein expression was scored from 0 to 3+ and the scores of 2+ and 3+ were considered as positive for PI3K p110α protein expression. We studied 50 breast carcinoma samples for PI3K p110α protein expression and PIK3CA gene copy numbers. In general, 36 out of 50 (72%) breast carcinoma samples showed a significant increase in PIK3CA gene amplification. 12 out of 50 (24%) showed positive staining, and 38 out of 50 (76%) showed negative staining for PI3K p110α expression. We have identified no significant relationship between PIK3CA amplification, race (p= 0.630) and histological type (p=0. 731) in breast carcinoma, but correlation of PIK3CA amplification and age showed a significant relationship (p=0. 003) between them. No significant relationship has been identified in correlation of PI3K p110α protein expression compared to age (p=0. 284), race (p=0. 546) and histological type (p=0. 285). Amplification of PIK3CA was frequent in breast carcinoma and occurs in stages of breast carcinoma. Our result shows that there is a relationship between gene amplification and age in breast carcinoma. We suggest that PIK3CA is significant in breast tumorigenesis serve as a prevalent mechanism contributes to the oncogenic activation pathway of PIK3CA in breast cancer.
    Matched MeSH terms: Continental Population Groups/genetics
  3. Development of an algorithm of satellite markers for monitoring chimerism status in post-allogeneic haematopoietic stem cell transplantation patients
    Choong SS, Rosmanizam S, Ibrahim K, Gan GG, Ariffin H
    Int J Lab Hematol, 2011 Apr;33(2):182-6.
    PMID: 20868447 DOI: 10.1111/j.1751-553X.2010.01264.x
    Analysis of variable number tandem repeats (VNTRs) by polymerase chain reaction (PCR) is a common method used to predict engraftment status in post-allogeneic haematopoeitic stem cell transplantation (HSCT) patients. Different populations have different copies of repeated DNA sequence and hence, different percentage of informativeness between patient and donor.
    Matched MeSH terms: Continental Population Groups/genetics
  4. Fulltext Deep whole-genome sequencing of 100 southeast Asian Malays
    Wong LP, Ong RT, Poh WT, Liu X, Chen P, Li R, et al.
    Am J Hum Genet, 2013 Jan 10;92(1):52-66.
    PMID: 23290073 DOI: 10.1016/j.ajhg.2012.12.005
    Whole-genome sequencing across multiple samples in a population provides an unprecedented opportunity for comprehensively characterizing the polymorphic variants in the population. Although the 1000 Genomes Project (1KGP) has offered brief insights into the value of population-level sequencing, the low coverage has compromised the ability to confidently detect rare and low-frequency variants. In addition, the composition of populations in the 1KGP is not complete, despite the fact that the study design has been extended to more than 2,500 samples from more than 20 population groups. The Malays are one of the Austronesian groups predominantly present in Southeast Asia and Oceania, and the Singapore Sequencing Malay Project (SSMP) aims to perform deep whole-genome sequencing of 100 healthy Malays. By sequencing at a minimum of 30× coverage, we have illustrated the higher sensitivity at detecting low-frequency and rare variants and the ability to investigate the presence of hotspots of functional mutations. Compared to the low-pass sequencing in the 1KGP, the deeper coverage allows more functional variants to be identified for each person. A comparison of the fidelity of genotype imputation of Malays indicated that a population-specific reference panel, such as the SSMP, outperforms a cosmopolitan panel with larger number of individuals for common SNPs. For lower-frequency (<5%) markers, a larger number of individuals might have to be whole-genome sequenced so that the accuracy currently afforded by the 1KGP can be achieved. The SSMP data are expected to be the benchmark for evaluating the value of deep population-level sequencing versus low-pass sequencing, especially in populations that are poorly represented in population-genetics studies.
    Matched MeSH terms: Population Groups/genetics
  5. Gc subtyping in Malaysians and in Indonesians from north Sumatra
    Tan SG, Gan YY, Asuan K, Abdullah F
    Hum Genet, 1981;59(1):75-6.
    PMID: 10819027
    Malays, Chinese and Indians from peninsular Malaysia; Ibans and Bidayuh from Sarawak state, Northern Borneo; and Bataks, Minangkabau and Javanese from North Sumatra, Indonesia, were subtyped for Gc (group-specific component) by polyacrylamide gel isoelectric focusing. All eight populations investigated were found to be polymorphic for three common alleles, Gc1F, Gc1S and Gc2.
    Matched MeSH terms: Continental Population Groups/genetics*
  6. Characterization of genetic sequence variation of 58 STR loci in four major population groups
    Novroski NMM, King JL, Churchill JD, Seah LH, Budowle B
    Forensic Sci Int Genet, 2016 11;25:214-226.
    PMID: 27697609 DOI: 10.1016/j.fsigen.2016.09.007
    Massively parallel sequencing (MPS) can identify sequence variation within short tandem repeat (STR) alleles as well as their nominal allele lengths that traditionally have been obtained by capillary electrophoresis. Using the MiSeq FGx Forensic Genomics System (Illumina), STRait Razor, and in-house excel workbooks, genetic variation was characterized within STR repeat and flanking regions of 27 autosomal, 7 X-chromosome and 24 Y-chromosome STR markers in 777 unrelated individuals from four population groups. Seven hundred and forty six autosomal, 227 X-chromosome, and 324 Y-chromosome STR alleles were identified by sequence compared with 357 autosomal, 107 X-chromosome, and 189 Y-chromosome STR alleles that were identified by length. Within the observed sequence variation, 227 autosomal, 156 X-chromosome, and 112 Y-chromosome novel alleles were identified and described. One hundred and seventy six autosomal, 123 X-chromosome, and 93 Y-chromosome sequence variants resided within STR repeat regions, and 86 autosomal, 39 X-chromosome, and 20 Y-chromosome variants were located in STR flanking regions. Three markers, D18S51, DXS10135, and DYS385a-b had 1, 4, and 1 alleles, respectively, which contained both a novel repeat region variant and a flanking sequence variant in the same nucleotide sequence. There were 50 markers that demonstrated a relative increase in diversity with the variant sequence alleles compared with those of traditional nominal length alleles. These population data illustrate the genetic variation that exists in the commonly used STR markers in the selected population samples and provide allele frequencies for statistical calculations related to STR profiling with MPS data.
    Matched MeSH terms: Continental Population Groups/genetics*
  7. Fulltext Racial/ancestral diversity in 174 toxicity-related radiogenomic studies: A systematic review
    Zuber SH, Yahya N
    J Cancer Res Ther, 2021 6 15;17(2):477-483.
    PMID: 34121695 DOI: 10.4103/jcrt.JCRT_896_18
    Purpose: This study systematically reviews the distribution of racial/ancestral features and their inclusion as covariates in genetic-toxicity association studies following radiation therapy.

    Materials and Methods: Original research studies associating genetic features and normal tissue complications following radiation therapy were identified from PubMed. The distribution of radiogenomic studies was determined by mining the statement of country of origin and racial/ancestrial distribution and the inclusion in analyses. Descriptive analyses were performed to determine the distribution of studies across races/ancestries, countries, and continents and the inclusion in analyses.

    Results: Among 174 studies, only 23 with a population of more one race/ancestry which were predominantly conducted in the United States. Across the continents, most studies were performed in Europe (77 studies averaging at 30.6 patients/million population [pt/mil]), North America (46 studies, 20.8 pt/mil), Asia (46 studies, 2.4 pt/mil), South America (3 studies, 0.4 pt/mil), Oceania (2 studies, 2.1 pt/mil), and none from Africa. All 23 studies with more than one race/ancestry considered race/ancestry as a covariate, and three studies showed race/ancestry to be significantly associated with endpoints.

    Conclusion: Most toxicity-related radiogenomic studies involved a single race/ancestry. Individual Participant Data meta-analyses or multinational studies need to be encouraged.

    Matched MeSH terms: Continental Population Groups/genetics
  8. Population and performance analyses of four major populations with Illumina's FGx Forensic Genomics System
    Churchill JD, Novroski NMM, King JL, Seah LH, Budowle B
    Forensic Sci Int Genet, 2017 09;30:81-92.
    PMID: 28651097 DOI: 10.1016/j.fsigen.2017.06.004
    The MiSeq FGx Forensic Genomics System (Illumina) enables amplification and massively parallel sequencing of 59 STRs, 94 identity informative SNPs, 54 ancestry informative SNPs, and 24 phenotypic informative SNPs. Allele frequency and population statistics data were generated for the 172 SNP loci included in this panel on four major population groups (Chinese, African Americans, US Caucasians, and Southwest Hispanics). Single-locus and combined random match probability values were generated for the identity informative SNPs. The average combined STR and identity informative SNP random match probabilities (assuming independence) across all four populations were 1.75E-67 and 2.30E-71 with length-based and sequence-based STR alleles, respectively. Ancestry and phenotype predictions were obtained using the ForenSeq™ Universal Analysis System (UAS; Illumina) based on the ancestry informative and phenotype informative SNP profiles generated for each sample. Additionally, performance metrics, including profile completeness, read depth, relative locus performance, and allele coverage ratios, were evaluated and detailed for the 725 samples included in this study. While some genetic markers included in this panel performed notably better than others, performance across populations was generally consistent. The performance and population data included in this study support that accurate and reliable profiles were generated and provide valuable background information for laboratories considering internal validation studies and implementation.
    Matched MeSH terms: Continental Population Groups/genetics*
  9. Fulltext Trans-ancestry genome-wide association meta-analysis of prostate cancer identifies new susceptibility loci and informs genetic risk prediction
    Conti DV, Darst BF, Moss LC, Saunders EJ, Sheng X, Chou A, et al.
    Nat Genet, 2021 Jan;53(1):65-75.
    PMID: 33398198 DOI: 10.1038/s41588-020-00748-0
    Prostate cancer is a highly heritable disease with large disparities in incidence rates across ancestry populations. We conducted a multiancestry meta-analysis of prostate cancer genome-wide association studies (107,247 cases and 127,006 controls) and identified 86 new genetic risk variants independently associated with prostate cancer risk, bringing the total to 269 known risk variants. The top genetic risk score (GRS) decile was associated with odds ratios that ranged from 5.06 (95% confidence interval (CI), 4.84-5.29) for men of European ancestry to 3.74 (95% CI, 3.36-4.17) for men of African ancestry. Men of African ancestry were estimated to have a mean GRS that was 2.18-times higher (95% CI, 2.14-2.22), and men of East Asian ancestry 0.73-times lower (95% CI, 0.71-0.76), than men of European ancestry. These findings support the role of germline variation contributing to population differences in prostate cancer risk, with the GRS offering an approach for personalized risk prediction.
    Matched MeSH terms: Continental Population Groups/genetics*
  10. Fulltext Insights into human genetic variation and population history from 929 diverse genomes
    Bergström A, McCarthy SA, Hui R, Almarri MA, Ayub Q, Danecek P, et al.
    Science, 2020 Mar 20;367(6484).
    PMID: 32193295 DOI: 10.1126/science.aay5012
    Genome sequences from diverse human groups are needed to understand the structure of genetic variation in our species and the history of, and relationships between, different populations. We present 929 high-coverage genome sequences from 54 diverse human populations, 26 of which are physically phased using linked-read sequencing. Analyses of these genomes reveal an excess of previously undocumented common genetic variation private to southern Africa, central Africa, Oceania, and the Americas, but an absence of such variants fixed between major geographical regions. We also find deep and gradual population separations within Africa, contrasting population size histories between hunter-gatherer and agriculturalist groups in the past 10,000 years, and a contrast between single Neanderthal but multiple Denisovan source populations contributing to present-day human populations.
    Matched MeSH terms: Continental Population Groups/genetics
  11. Significant genotype difference in the CYP2E1 PstI polymorphism of indigenous groups in Sabah, Malaysia with Asian and non-Asian populations
    Goh LP, Chong ET, Chua KH, Chuah JA, Lee PC
    Asian Pac J Cancer Prev, 2014;15(17):7377-81.
    PMID: 25227845
    CYP2E1 PstI polymorphism G-1259C (rs3813867) genotype distributions vary significantly among different populations and are associated with both diseases, like cancer, and adverse drug effects. To date, there have been limited genotype distributions and allele frequencies of this polymorphism reported in the three major indigenous ethnic groups (KadazanDusun, Bajau, and Rungus) in Sabah, also known as North Borneo. The aim of this study was to investigate the genotype distributions and allele frequencies of the CYP2E1 PstI polymorphism G-1259C in these three major indigenous peoples in Sabah. A total of 640 healthy individuals from the three dominant indigenous groups were recruited for this study. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) at G-1259C polymorphic site of CYP2E1 gene was performed using the Pst I restriction enzyme. Fragments were analyzed using agarose gel electrophoresis and confirmed by direct sequencing. Overall, the allele frequencies were 90.3% for c1 allele and 9.7% for c2 allele. The genotype frequencies for c1/c1, c1/c2 and c2/c2 were observed as 80.9%, 18.8%, and 0.3%, respectively. A highly statistical significant difference (p<0.001) was observed in the genotype distributions between indigenous groups in Sabah with all Asian and non-Asian populations. However, among these three indigenous groups, there was no statistical significant difference (p>0.001) in their genotype distributions. The three major indigenous ethnic groups in Sabah show unique genotype distributions when compared with other populations. This finding indicates the importance of establishing the genotype distributions of CYP2E1 PstI polymorphism in the indigenous populations.
    Matched MeSH terms: Population Groups/genetics
  12. HLA polymorphism in three indigenous populations of Sabah and Sarawak
    Dhaliwal JS, Shahnaz M, Azrena A, Irda YA, Salawati M, Too CL, et al.
    Tissue Antigens, 2010 Feb;75(2):166-9.
    PMID: 20196825 DOI: 10.1111/j.1399-0039.2009.01410.x
    One hundred and fifty-eight Kadazan, Iban and Bidayuh individuals registered with the Malaysian Marrow Donor Registry were typed for human leukocyte antigen (HLA)-A, HLA-B and HLA-DR. Six, seven and eight HLA-A alleles as well as 13, 15 and 16 HLA-B alleles were detected in the Kadazan, Bidayuh and Iban, respectively. The most common HLA-A allele in all three groups was HLA-A*24 with a frequency of 0.456, 0.490 and 0.422 in the Kadazan, Bidayuh and Iban, respectively. The most common HLA-B allele detected in the Kadazan was HLA-B*40 with a frequency of 0.333; for the Bidayuh and the Iban it was HLA-B*15 with a frequency of 0.460 and 0.275, respectively. The HLA-DR allele with the highest frequency in the Kadazan was HLA-DR*1502 with a frequency of 0.500. In the Iban and the Bidayuh, HLA-DRB1*1202 was the most common DR allele with frequencies of 0.235 and 0.310, respectively. The two most common haplotypes for the Kadazan are A*34-B*38-DR*1502 and A*24-B*40-DR*0405, whereas for the Bidayuh they are A*24-B*15-DR*1602 and A*24-B*35-DR*1202 and for the Iban they are A*34-*B15-DR*1502 and A*24-B*15-DR*1202.
    Matched MeSH terms: Population Groups/genetics*
  13. The population genomic landscape of human genetic structure, admixture history and local adaptation in Peninsular Malaysia
    Deng L, Hoh BP, Lu D, Fu R, Phipps ME, Li S, et al.
    Hum Genet, 2014 Sep;133(9):1169-85.
    PMID: 24916469 DOI: 10.1007/s00439-014-1459-8
    Peninsular Malaysia is a strategic region which might have played an important role in the initial peopling and subsequent human migrations in Asia. However, the genetic diversity and history of human populations--especially indigenous populations--inhabiting this area remain poorly understood. Here, we conducted a genome-wide study using over 900,000 single nucleotide polymorphisms (SNPs) in four major Malaysian ethnic groups (MEGs; Malay, Proto-Malay, Senoi and Negrito), and made comparisons of 17 world-wide populations. Our data revealed that Peninsular Malaysia has greater genetic diversity corresponding to its role as a contact zone of both early and recent human migrations in Asia. However, each single Orang Asli (indigenous) group was less diverse with a smaller effective population size (N(e)) than a European or an East Asian population, indicating a substantial isolation of some duration for these groups. All four MEGs were genetically more similar to Asian populations than to other continental groups, and the divergence time between MEGs and East Asian populations (12,000--6,000 years ago) was also much shorter than that between East Asians and Europeans. Thus, Malaysian Orang Asli groups, despite their significantly different features, may share a common origin with the other Asian groups. Nevertheless, we identified traces of recent gene flow from non-Asians to MEGs. Finally, natural selection signatures were detected in a batch of genes associated with immune response, human height, skin pigmentation, hair and facial morphology and blood pressure in MEGs. Notable examples include SYN3 which is associated with human height in all Orang Asli groups, a height-related gene (PNPT1) and two blood pressure-related genes (CDH13 and PAX5) in Negritos. We conclude that a long isolation period, subsequent gene flow and local adaptations have jointly shaped the genetic architectures of MEGs, and this study provides insight into the peopling and human migration history in Southeast Asia.
    Matched MeSH terms: Population Groups/genetics*
  14. Effects of the apolipoprotein(a) size polymorphism on the lipoprotein(a) concentration in 7 ethnic groups
    Sandholzer C, Hallman DM, Saha N, Sigurdsson G, Lackner C, Császár A, et al.
    Hum Genet, 1991 Apr;86(6):607-14.
    PMID: 2026424
    Apolipoprotein(a) [apo(a)] exhibits a genetic size polymorphism explaining about 40% of the variability in lipoprotein(a) [Lp(a)] concentration in Tyroleans. Lp(a) concentrations and apo(a) phenotypes were determined in 7 ethnic groups (Tyrolean, Icelandic, Hungarian, Malay, Chinese, Indian, Black Sudanese) and the effects of the apo(a) size polymorphism on Lp(a) levels were estimated in each group. Average Lp(a) concentrations were highly significantly different among these populations, with the Chinese (7.0 mg/dl) having the lowest and the Sudanese (46 mg/dl) the highest levels. Apo(a) phenotype and derived apo(a) allele frequencies were also significantly different among the populations. Apo(a) isoform effects on Lp(a) levels were not significantly different among populations. Lp(a) levels were however roughly twice as high in the same phenotypes in the Indians, and several times as high in the Sudanese, compared with Caucasians. The size variation of apo(a) explains from 0.77 (Malays) to only 0.19 (Sudanese) of the total variability in Lp(a) levels. Together these data show (I) that there is considerable heterogeneity of the Lp(a) polymorphism among populations, (II) that differences in apo(a) allele frequencies alone do not explain the differences in Lp(a) levels among populations and (III) that in some populations, e.g. Sudanese Blacks, Lp(a) levels are mainly determined by factors that are different from the apo(a) size polymorphism.
    Matched MeSH terms: Continental Population Groups/genetics*
  15. A genomic history of Aboriginal Australia
    Malaspinas AS, Westaway MC, Muller C, Sousa VC, Lao O, Alves I, et al.
    Nature, 2016 Oct 13;538(7624):207-214.
    PMID: 27654914 DOI: 10.1038/nature18299
    The population history of Aboriginal Australians remains largely uncharacterized. Here we generate high-coverage genomes for 83 Aboriginal Australians (speakers of Pama-Nyungan languages) and 25 Papuans from the New Guinea Highlands. We find that Papuan and Aboriginal Australian ancestors diversified 25-40 thousand years ago (kya), suggesting pre-Holocene population structure in the ancient continent of Sahul (Australia, New Guinea and Tasmania). However, all of the studied Aboriginal Australians descend from a single founding population that differentiated ~10-32 kya. We infer a population expansion in northeast Australia during the Holocene epoch (past 10,000 years) associated with limited gene flow from this region to the rest of Australia, consistent with the spread of the Pama-Nyungan languages. We estimate that Aboriginal Australians and Papuans diverged from Eurasians 51-72 kya, following a single out-of-Africa dispersal, and subsequently admixed with archaic populations. Finally, we report evidence of selection in Aboriginal Australians potentially associated with living in the desert.
    Matched MeSH terms: Continental Population Groups/genetics*
  16. Increasing the discrimination power of ancestry- and identity-informative SNP loci within the ForenSeq™ DNA Signature Prep Kit
    King JL, Churchill JD, Novroski NMM, Zeng X, Warshauer DH, Seah LH, et al.
    Forensic Sci Int Genet, 2018 09;36:60-76.
    PMID: 29935396 DOI: 10.1016/j.fsigen.2018.06.005
    The use of single nucleotide polymorphisms (SNPs) in forensic genetics has been limited to challenged samples with low template and/or degraded DNA. The recent introduction of massively parallel sequencing (MPS) technologies has expanded the potential applications of these markers and increased the discrimination power of well-established loci by considering variation in the flanking regions of target loci. The ForenSeq Signature Preparation Kit contains 165 SNP amplicons for ancestry- (aiSNPs), identity- (iiSNPs), and phenotype-inference (piSNPs). In this study, 714 individuals from four major populations (African American, AFA; East Asian, ASN; US Caucasian, CAU; and Southwest US Hispanic, HIS) previously reported by Churchill et al. [Forensic Sci Int Genet. 30 (2017) 81-92; DOI: https://doi.org/10.1016/j.fsigen.2017.06.004] were assessed using STRait Razor v2s to determine the level of diversity in the flanking regions of these amplicons. The results show that nearly 70% of loci showed some level of flanking region variation with 22 iiSNPs and 8 aiSNPs categorized as microhaplotypes in this study. The heterozygosities of these microhaplotypes approached, and in one instance surpassed, those of some core STR loci. Also, the impact of the flanking region on other forensic parameters (e.g., power of exclusion and power of discrimination) was examined. Sixteen of the 94 iiSNPs had an effective allele number greater than 2.00 across the four populations. To assess what effect the flanking region information had on the ancestry inference, genotype probabilities and likelihood ratios were determined. Additionally, concordance with the ForenSeq UAS and Nextera Rapid Capture was evaluated, and patterns of heterozygote imbalance were identified. Pairwise comparison of the iiSNP diplotypes determined the probability of detecting a mixture (i.e., observing ≥ 3 haplotypes) using these loci alone was 0.9952. The improvement in random match probabilities for the full regions over the target iiSNPs was found to be significant. When combining the iiSNPs with the autosomal STRs, the combined match probabilities ranged from 6.40 × 10-73 (ASN) to 1.02 × 10-79 (AFA).
    Matched MeSH terms: Continental Population Groups/genetics*
  17. Fc gamma receptor IIIB-NA gene frequencies in patients with systemic lupus erythematosus and healthy individuals of Malay and Chinese ethnicity
    Yap SN, Phipps ME, Manivasagar M, Bosco JJ
    Immunol Lett, 1999 Jun 01;68(2-3):295-300.
    PMID: 10424435
    The neutrophil antigen (NA)1 and 2 is coded by two recognized allelic forms of Fc gamma receptor IIIB (FcgammaRIIIB). FcgammaRIIIb is a low affinity receptor and preferentially removes immune complexes from the circulation. Systemic lupus erythematosus (SLE) is an autoimmune and polygenic disorder characterized by accumulation of autoimmune complexes. The majority of SLE patients in our medical center are of Chinese ethnicity, followed by Malay and Indian. Recently, studies have focussed on the Fc receptors in different ethnic groups and their relation to SLE. We chose to study the gene distribution of this receptor in the Chinese and Malays population in Malaysia. We designed a polymerase chain reaction allele specific primers (PCR-ASP) method to distinguish the two allelic forms. Genomic DNA was isolated from the peripheral blood of 183 Chinese and 55 Malays SLE patients as well as 100 Chinese and 50 Malays healthy controls. Genotyping of Chinese SLE patients revealed that the gene frequencies for FcgammaRIIIB-NA1 and FcgammaRIIIB-NA2 were 0.648 and 0.347, while in the ethnically matched healthy controls they were 0.68 and 0.32, respectively. One out of the 183 Chinese SLE patients was identified as a NA-null due to the absence of PCR product for both alleles. The FcgammaRIIIB-NA1 and FcgammaRIIIB-NA2 allele frequencies for both the Malays SLE and healthy controls were 0.62 and 0.38.
    Matched MeSH terms: Continental Population Groups/genetics*
  18. Molecular analysis of HLA Class I and Class II genes in four indigenous Malaysian populations
    Jinam TA, Saitou N, Edo J, Mahmood A, Phipps ME
    Tissue Antigens, 2010 Feb;75(2):151-8.
    PMID: 20003135 DOI: 10.1111/j.1399-0039.2009.01417.x
    This is the first report of high-resolution human leukocyte antigen (HLA) typing in four indigenous groups in Malaysia. A total of 99 normal, healthy participants representing the Negrito (Jehai and Kensiu), Proto-Malay (Temuan) and a native group of Borneo (Bidayuh) were typed for HLA-A, -B, -DRB1 and -DQB1 genes using sequence-based typing. Eleven HLA-A, 26 HLA-B, 16 HLA-DRB1 and 14 HLA-DQB1 alleles were detected, including a new allele, HLA-B*3589 in the Jehai. Highly frequent alleles were A*2407, B*1513, B*1801, DRB1*0901, DRB1*1202, DRB1*1502, DQB1*0303 and DQB1*0502. Principal component analysis based on high-resolution HLA-A, -B and -DRB1 allele frequencies showed close affinities among all four groups, including the Negritos, with other Southeast Asian populations. These results showed the scope of HLA diversity in these indigenous minority groups and may prove beneficial for future disease association, anthropological and forensic studies.
    Matched MeSH terms: Population Groups/genetics*
  19. Down syndrome in diverse populations
    Kruszka P, Porras AR, Sobering AK, Ikolo FA, La Qua S, Shotelersuk V, et al.
    Am J Med Genet A, 2017 Jan;173(1):42-53.
    PMID: 27991738 DOI: 10.1002/ajmg.a.38043
    Down syndrome is the most common cause of cognitive impairment and presents clinically with universally recognizable signs and symptoms. In this study, we focus on exam findings and digital facial analysis technology in individuals with Down syndrome in diverse populations. Photos and clinical information were collected on 65 individuals from 13 countries, 56.9% were male and the average age was 6.6 years (range 1 month to 26 years; SD = 6.6 years). Subjective findings showed that clinical features were different across ethnicities (Africans, Asians, and Latin Americans), including brachycephaly, ear anomalies, clinodactyly, sandal gap, and abundant neck skin, which were all significantly less frequent in Africans (P 
    Matched MeSH terms: Population Groups/genetics
  20. Differential positive selection of malaria resistance genes in three indigenous populations of Peninsular Malaysia
    Liu X, Yunus Y, Lu D, Aghakhanian F, Saw WY, Deng L, et al.
    Hum Genet, 2015 Apr;134(4):375-92.
    PMID: 25634076 DOI: 10.1007/s00439-014-1525-2
    The indigenous populations from Peninsular Malaysia, locally known as Orang Asli, continue to adopt an agro-subsistence nomadic lifestyle, residing primarily within natural jungle habitats. Leading a hunter-gatherer lifestyle in a tropical jungle environment, the Orang Asli are routinely exposed to malaria. Here we surveyed the genetic architecture of individuals from four Orang Asli tribes with high-density genotyping across more than 2.5 million polymorphisms. These tribes reside in different geographical locations in Peninsular Malaysia and belong to three main ethno-linguistic groups, where there is minimal interaction between the tribes. We first dissect the genetic diversity and admixture between the tribes and with neighboring urban populations. Later, by implementing five metrics, we investigated the genome-wide signatures for positive natural selection of these Orang Asli, respectively. Finally, we searched for evidence of genomic adaptation to the pressure of malaria infection. We observed that different evolutionary responses might have emerged in the different Orang Asli communities to mitigate malaria infection.
    Matched MeSH terms: Population Groups/genetics*
Related Terms
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links