Displaying publications 1 - 20 of 70 in total

Abstract:
Sort:
  1. Fulltext XPC Lys939Gln polymorphism, smoking and risk of sporadic colorectal cancer among Malaysians
    Ahmad Aizat AA, Siti Nurfatimah MS, Aminudin MM, Ankathil R
    World J Gastroenterol, 2013 Jun 21;19(23):3623-8.
    PMID: 23801864 DOI: 10.3748/wjg.v19.i23.3623
    To investigate the risk association of xeroderma pigmentosum group C (XPC) Lys939Gln polymorphism alone and in combination with cigarette smoking on colorectal cancer (CRC) predisposition.
    Matched MeSH terms: Homozygote
  2. Whole exome sequencing is an efficient, sensitive and specific method for determining the genetic cause of short-rib thoracic dystrophies
    McInerney-Leo AM, Harris JE, Leo PJ, Marshall MS, Gardiner B, Kinning E, et al.
    Clin Genet, 2015 Dec;88(6):550-7.
    PMID: 25492405 DOI: 10.1111/cge.12550
    Short-rib thoracic dystrophies (SRTDs) are congenital disorders due to defects in primary cilium function. SRTDs are recessively inherited with mutations identified in 14 genes to date (comprising 398 exons). Conventional mutation detection (usually by iterative Sanger sequencing) is inefficient and expensive, and often not undertaken. Whole exome massive parallel sequencing has been used to identify new genes for SRTD (WDR34, WDR60 and IFT172); however, the clinical utility of whole exome sequencing (WES) has not been established. WES was performed in 11 individuals with SRTDs. Compound heterozygous or homozygous mutations were identified in six confirmed SRTD genes in 10 individuals (IFT172, DYNC2H1, TTC21B, WDR60, WDR34 and NEK1), giving overall sensitivity of 90.9%. WES data from 993 unaffected individuals sequenced using similar technology showed two individuals with rare (minor allele frequency <0.005) compound heterozygous variants of unknown significance in SRTD genes (specificity >99%). Costs for consumables, laboratory processing and bioinformatic analysis were
    Matched MeSH terms: Homozygote
  3. Variable clinical phenotypes in a family with homozygous c.1159G>A mutation in the thyroid peroxidase gene
    Lee CC, Harun F, Jalaludin MY, Heh CH, Othman R, Kang IN, et al.
    Horm Res Paediatr, 2014;81(5):356-60.
    PMID: 24717978 DOI: 10.1159/000359922
    Defects in the thyroid peroxidase (TPO) gene have been associated with goitrous congenital hypothyroidism (CH).
    Matched MeSH terms: Homozygote*
  4. Fulltext Unravelling the genetic history of Negritos and indigenous populations of Southeast Asia
    Aghakhanian F, Yunus Y, Naidu R, Jinam T, Manica A, Hoh BP, et al.
    Genome Biol Evol, 2015 May;7(5):1206-15.
    PMID: 25877615 DOI: 10.1093/gbe/evv065
    Indigenous populations of Malaysia known as Orang Asli (OA) show huge morphological, anthropological, and linguistic diversity. However, the genetic history of these populations remained obscure. We performed a high-density array genotyping using over 2 million single nucleotide polymorphisms in three major groups of Negrito, Senoi, and Proto-Malay. Structural analyses indicated that although all OA groups are genetically closest to East Asian (EA) populations, they are substantially distinct. We identified a genetic affinity between Andamanese and Malaysian Negritos which may suggest an ancient link between these two groups. We also showed that Senoi and Proto-Malay may be admixtures between Negrito and EA populations. Formal admixture tests provided evidence of gene flow between Austro-Asiatic-speaking OAs and populations from Southeast Asia (SEA) and South China which suggest a widespread presence of these people in SEA before Austronesian expansion. Elevated linkage disequilibrium (LD) and enriched homozygosity found in OAs reflect isolation and bottlenecks experienced. Estimates based on Ne and LD indicated that these populations diverged from East Asians during the late Pleistocene (14.5 to 8 KYA). The continuum in divergence time from Negritos to Senoi and Proto-Malay in combination with ancestral markers provides evidences of multiple waves of migration into SEA starting with the first Out-of-Africa dispersals followed by Early Train and subsequent Austronesian expansions.
    Matched MeSH terms: Homozygote
  5. Fulltext Tropical distal renal tubular acidosis: clinical and epidemiological studies in 78 patients
    Khositseth S, Bruce LJ, Walsh SB, Bawazir WM, Ogle GD, Unwin RJ, et al.
    QJM, 2012 Sep;105(9):861-77.
    PMID: 22919024 DOI: 10.1093/qjmed/hcs139
    Distal renal tubular acidosis (dRTA) caused by mutations of the SLC4A1 gene encoding the erythroid and kidney isoforms of anion exchanger 1 (AE1 or band 3) has a high prevalence in some tropical countries, particularly Thailand, Malaysia, the Philippines and Papua New Guinea (PNG). Here the disease is almost invariably recessive and can result from either homozygous or compound heterozygous SLC4A1 mutations.
    Matched MeSH terms: Homozygote
  6. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations
    Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
    Matched MeSH terms: Homozygote
  7. Fulltext The oil palm SHELL gene controls oil yield and encodes a homologue of SEEDSTICK
    Singh R, Low ET, Ooi LC, Ong-Abdullah M, Ting NC, Nagappan J, et al.
    Nature, 2013 Aug 15;500(7462):340-4.
    PMID: 23883930 DOI: 10.1038/nature12356
    A key event in the domestication and breeding of the oil palm Elaeis guineensis was loss of the thick coconut-like shell surrounding the kernel. Modern E. guineensis has three fruit forms, dura (thick-shelled), pisifera (shell-less) and tenera (thin-shelled), a hybrid between dura and pisifera. The pisifera palm is usually female-sterile. The tenera palm yields far more oil than dura, and is the basis for commercial palm oil production in all of southeast Asia. Here we describe the mapping and identification of the SHELL gene responsible for the different fruit forms. Using homozygosity mapping by sequencing, we found two independent mutations in the DNA-binding domain of a homologue of the MADS-box gene SEEDSTICK (STK, also known as AGAMOUS-LIKE 11), which controls ovule identity and seed development in Arabidopsis. The SHELL gene is responsible for the tenera phenotype in both cultivated and wild palms from sub-Saharan Africa, and our findings provide a genetic explanation for the single gene hybrid vigour (or heterosis) attributed to SHELL, via heterodimerization. This gene mutation explains the single most important economic trait in oil palm, and has implications for the competing interests of global edible oil production, biofuels and rainforest conservation.
    Matched MeSH terms: Homozygote
  8. Fulltext The efficacy of molecular markers analysis with integration of sensory methods in detection of aroma in rice
    Yeap HY, Faruq G, Zakaria HP, Harikrishna JA
    ScientificWorldJournal, 2013;2013:569268.
    PMID: 24222741 DOI: 10.1155/2013/569268
    Allele Specific Amplification with four primers (External Antisense Primer, External Sense Primer, Internal Nonfragrant Sense Primer, and Internal Fragrant Antisense Primer) and sensory evaluation with leaves and grains were executed to identify aromatic rice genotypes and their F1 individuals derived from different crosses of 2 Malaysian varieties with 4 popular land races and 3 advance lines. Homozygous aromatic (fgr/fgr) F1 individuals demonstrated better aroma scores compared to both heterozygous nonaromatic (FGR/fgr) and homozygous nonaromatic (FGR/FGR) individuals, while, some F1 individuals expressed aroma in both leaf and grain aromatic tests without possessing the fgr allele. Genotypic analysis of F1 individuals for the fgr gene represented homozygous aromatic, heterozygous nonaromatic and homozygous nonaromatic genotypes in the ratio 20:19:3. Genotypic and phenotypic analysis revealed that aroma in F1 individuals was successfully inherited from the parents, but either molecular analysis or sensory evaluation alone could not determine aromatic condition completely. The integration of molecular analysis with sensory methods was observed as rapid and reliable for the screening of aromatic genotypes because molecular analysis could distinguish aromatic homozygous, nonaromatic homozygous and nonaromatic heterozygous individuals, whilst the sensory method facilitated the evaluation of aroma emitted from leaf and grain during flowering to maturity stages.
    Matched MeSH terms: Homozygote
  9. TP53 Gene 72 Arg/Pro (rs1042522) Single Nucleotide Polymorphism Contribute to Increase the Risk of B-Chronic Lymphocytic Leukemia in the Sudanese Population
    Mohammed Basabaeen AA, Abdelgader EA, Babekir EA, Abdelrahim SO, Eltayeb NH, Altayeb OA, et al.
    Asian Pac J Cancer Prev, 2019 May 25;20(5):1579-1585.
    PMID: 31128065
    Objective: This study aimed at exploring the association of TP53 72Arg/Pro polymorphism and Risk of Chronic
    Lymphocytic Leukemia and to assess the correlation between TP53 72Arg/Pro polymorphism and clinical parameter,
    hematological profile and some biological prognostic markers among Sudanese patients with chronic lymphocytic
    leukemia. Methods: A case-control study was conducted in Khartoum state, Sudan, during the period from April 2017 to
    April 2018, involved 110 B-CLL patients and 80 healthy volunteers as a control group. Physical examination, Complete
    Blood Count and Immunophenotype were performed in all patients to confirm the diagnosis. Clinical staging such as
    Rai and Binet were studied. CD38 and ZAP70 were performed by Flow Cytometry. Blood samples were collected from
    all participants; DNA was extracted by using ANALYTIKJENA Blood DNA Extraction Kit (Germany) and analyzed
    TP53 codon 72Arg/Pro Polymorphism by using AS-PCR. The statistical analysis was performed using SPSS version
    23.0 software (Chicago, IL, USA). Results: the Arg/Pro was the most frequent genotype in B-CLL patients(50%),
    followed by Arg/Arg (25.5%) and Pro/Pro (24.5%), whereas in healthy control group Arg/Pro was the most frequent
    (47.5%), followed by Arg/Arg (45%) and Pro/Pro (7.5%). Our data indicate a higher frequency of homozygous Pro/
    Pro in the B-CLL patients as compared to controls with an OR of 4.01 for the Pro/Pro genotype and lower frequency
    of Arg/Arg genotype in CLL patients as compared to controls with an OR of .42 for the Arg/Arg genotype. Also, the
    Pro allele showed higher risk than Arg allele (P value=0.000, OR 2.23, 95% CI=1.45-3.41). No significant association
    between gender, clinical staging systems (Rai, Binet), biological prognostic markers (CD38 expression or ZAP70
    expression), and TP53 codon 72Arg/Pro polymorphisms, except Arg/Arg genotype tended to be associated with younger
    age (P =0.04). Conclusion: Our data suggested that Pro/Pro genotype contribute to increased susceptibility to B-Chronic
    Lymphocytic Leukemia risk in our population tenfold higher than those had Arg/Arg genotype.
    Matched MeSH terms: Homozygote
  10. Sickle cell anemia associated with alpha-thalassemia in Malaysian Indians
    Lie-Injo LE, Hassan K, Joishy SK, Lim ML
    Am J Hematol, 1986 Jul;22(3):265-74.
    PMID: 2424302
    The Indian rubber estate workers in Negri Sembilan, Malaysia, who originated from Orissa in India were found to have a high frequency of Hb S (Joishy SK, Hassan K: Clin Res 28:280, 1980). Unlike the usually severe clinical picture of sickle cell anemia seen in African and American blacks, the clinical picture of the disease in this population was mild and many have reached old age. We studied the leukocyte DNA of 12 patients with sickle cell anemia, ranging in age from 4 to 61 years and 30 sickle cell trait carriers, ranging in age from 7 to 63 years, for the presence of alpha-globin gene deletions by gene mapping according to Southern (Southern EM: J Mol Biol 98:503, 1975), using alpha- and zeta-globin gene probes obtained by nick translation of the alpha- and zeta-globin genes cloned into plasmid. All 12 sickle cell anemia patients were found to have alpha-thalassemia2 (alpha-thal2), either in the homozygous or heterozygous condition. Of the Hb S trait carriers, six did not have alpha-thal2 or alpha-thal1 and 24 had alpha-thal2 (15 heterozygous, 9 homozygous). Seven of these Hb S trait carriers with alpha-thal2 had an additional gene abnormality. Five of them had a fast-moving Eco RI fragment 5.6 kb long that hybridized with zeta-specific probe but not with alpha-specific probe. An unusual DNA pattern of a different type was further found in the other two. Bgl II restriction analysis showed that the alpha-thal2 was mostly of the rightward deletion alpha-thal1 genotype. None of the sickle cell anemia patients and Hb S trait carriers had deletion type alpha-thal1. The sickle cell anemia patients had very high levels of Hb F and low levels of Hb A2. The Hb S trait carriers with alpha-thal2 had relatively low levels of Hb S.
    Matched MeSH terms: Homozygote
  11. Fulltext Serum ferritin concentrations in transfusion dependent beta-thalassaemia
    George E, Wong HB, George R, Ariffin WA
    Singapore Med J, 1994 Feb;35(1):62-4.
    PMID: 8009283
    Patients on a moderate red cell transfusion programme have iron overload where the concentrations of the serum ferritin were inappropriate to increases in the transfusion load as a result of limitations of apoferritin synthesis and conversion of ferritin into haemosiderin. This study confirms the limitations for the use of estimations of the serum ferritin to evaluate the iron status in patients with expected high overload as would be seen in patients on many years of maintenance red cell transfusions in the absence of iron chelation therapy. Poor compliance, inadequate dosage of Desferal (deferoxamine), and the late initiation of iron chelation therapy were factors that were considered in the patients with failure of response to iron chelation.
    Matched MeSH terms: Homozygote
  12. Fulltext Secondary polycythaemia in a Malay girl with homozygous Hb Tak
    Amran HS, Aziz MA, George E, Mahmud N, Lee TY, Md Noor S
    Malays J Pathol, 2017 Dec;39(3):321-326.
    PMID: 29279598 MyJurnal
    Hb Tak is one of more than 200 high affinity haemoglobin variants reported worldwide. It results from the insertion of two nucleotides (AC) at the termination codon, between codon 146 and codon 147 of the beta-globin gene [Beta 147 (+AC)]. Polycythaemia is the main clinical feature although affected carriers are usually asymptomatic and do not require intervention. Several case studies in this region have reported the co-inheritance of Hb Tak with Hb E, delta beta and beta thalassaemia with one case of homozygous Hb Tak in a Thai boy. In this case report, a cluster of haemoglobin Tak was found in a family of Malay ethnic origin. Cascade family screening was conducted while investigating a 4-year old girl who presented with symptomatic polycythaemia. She had 2 previous Hb analysis done, at 7-month and 2-year-old with the diagnosis of possible Hb Q Thailand and Homozygous Hb D, respectively. Both diagnosis did not fit her clinical presentations. She was plethoric, had reduced exercise tolerance as well as cardiomyopathy. Her parents were consanguineously married and later diagnosed as asymptomatic carriers of Hb Tak. Consequently, re-analysis of the girl's blood sample revealed a homozygous state of Hb Tak. In conclusion, high oxygen affinity haemoglobin like Hb Tak should be considered in the investigation of polycythaemic patients with abnormal Hb analyses. In this case, DNA analysis was crucial in determining the correct diagnosis.
    Matched MeSH terms: Homozygote
  13. Role of UGT1A1*6 in irinogenetics in Asians
    Kim TW, Innocenti F
    Per Med, 2007 Nov;4(4):431-434.
    PMID: 29793274 DOI: 10.2217/17410541.4.4.431
    Evaluation of: Jada SR, Lim R, Wong CI et al.: Role ofUGT1A1*6, UGT1A1*28 and ABCG2 c.421C>A polymorphisms in irinotecan-induced neutropenia in Asian cancer patients. Cancer Sci. 98(9), 1461-1467 (2007). The pharmacokinetics and toxicity of irinotecan vary widely among patients. This review focuses primarily on a study of the role of UGT1A1*6, UGT1A1*28, and ABCG2 421C>A in three Asian cancer patient populations treated with a 3-weekly regimen of irinotecan. In that study, a statistically significantly higher level of SN-38 and a relatively lower degree of glucuronidation occurred in patients with the UGT1A1*6 homozygote genotype than in patients with the reference genotype. The UGT1A1*6 allele was associated with an increased risk of severe neutropenia. In addition, the study of gene allele frequencies in three healthy Asian populations indicated that the allelic frequency of UGT1A1*6 was higher in the healthy Chinese subjects than in the Malaysian or Indian subjects. UGT1A1*28 and ABCG2 421C>A were not associated with the pharmacokinetics of SN-38 or the severity of neutropenia. In this evaluation, we put this study into the context of similar studies of irinogenetics (irinotecan pharmacogenetics) in Asians and discuss the application of UGT1A1 testing in Asian cancer patients treated with irinotecan-containing regimens.
    Matched MeSH terms: Homozygote
  14. Reduction of Delayed Homologous Recombination by Induction of Radioadaptive Response in RaDR-GFP Mice (Yonezawa Effect): An Old Player With a New Role
    Liu C, Hirakawa H, Tanaka K, Mohd Saaya F, Nenoi M, Fujimori A, et al.
    Dose Response, 2019 03 04;17(1):1559325819833840.
    PMID: 30858771 DOI: 10.1177/1559325819833840
    Radiotherapy (RT) treats cancer effectively with high doses of ionizing radiation (IR) to killing cancer cells and shrinking tumors while bearing the risk of developing different side effects, including secondary cancer, which is most concerning for long-term health consequences. Genomic instability (GI) is a characteristic of most cancer cells, and IR-induced GI can manifest as delayed homologous recombination (HR). Radioadaptive response (RAR) is capable of reducing genotoxicity, cell transformation, mutation, and carcinogenesis, but the rational evidence describing its contributions to the reduction of radiation risk, in particular, carcinogenesis, remains fragmented. In this work, to investigate the impact of RAR on high-dose, IR-induced GI measured as delayed HR, the frequency of recombinant cells was comparatively studied under RAR-inducible and -uninducible conditions in the nucleated cells in hematopoietic tissues (bone marrow and spleen) using the Rosa26 Direct Repeat-green fluorescent protein (RaDR-GFP) homozygote mice. Results demonstrated that the frequency of recombinant cells was significantly lower in hematopoietic tissues under RAR-inducible condition. These findings suggest that reduction in delayed HR may be at least a part of the mechanisms underlying decreased carcinogenesis by RAR, and application of RAR would contribute to a more rigorous and scientifically grounded system of radiation protection in RT.
    Matched MeSH terms: Homozygote
  15. P27 V109G Polymorphism is associated with lymph node metastases but not with increased risk of breast cancer
    Naidu R, Har YC, Taib NA
    J Exp Clin Cancer Res, 2007 Mar;26(1):133-40.
    PMID: 17550142
    The p27 V109G polymorphism was investigated using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method in a hospital-based Malaysian population. Peripheral blood samples were collected from 230 breast cancer patients and 200 normal and healthy women who had no history of breast disease or breast cancer. We evaluated the association between the p27 polymorphism and breast cancer risk, and clinico-pathological parameters in the population. The distribution of genotype and allele frequencies of p27 V109G polymorphism were not significantly different between the breast cancer cases and normal subjects (P=0.376). Women who were homozygous (OR=1.73; 95% CI, 0.62-4.92) or heterozygous (OR=1.26; 95% CI, 0.75-2.12) for G allele, or carriers of G allele genotype (OR=1.34; 95%, 0.83-2.16) or G allele (OR=1.36; 95% CI, 0.90-2.05) were not associated with breast cancer risk. No significant correlation was noted between G allele genotype and breast cancer risk among patients under 50 (OR=1.28; 95% CI, 0.62-2.66) or 50 years and older (OR=1.38; 95% CI, 0.71-2.66) at diagnosis. The G allele genotype was significantly associated with lymph node metastases but independent of ER status and histological grade. In conclusion, the polymorphic variant at codon 109 of p27 gene may not be a marker for determining patients' risk of developing breast cancer but it may be a potential genetic marker for poor prognosis, thereby a marker for tumor prognosis.
    Matched MeSH terms: Homozygote
  16. Fulltext Novel defect in phosphatidylinositol 4-kinase type 2-alpha (PI4K2A) at the membrane-enzyme interface is associated with metabolic cutis laxa
    Mohamed M, Gardeitchik T, Balasubramaniam S, Guerrero-Castillo S, Dalloyaux D, van Kraaij S, et al.
    J Inherit Metab Dis, 2020 11;43(6):1382-1391.
    PMID: 32418222 DOI: 10.1002/jimd.12255
    Inherited cutis laxa, or inelastic, sagging skin is a genetic condition of premature and generalised connective tissue ageing, affecting various elastic components of the extracellular matrix. Several cutis laxa syndromes are inborn errors of metabolism and lead to severe neurological symptoms. In a patient with cutis laxa, a choreoathetoid movement disorder, dysmorphic features and intellectual disability we performed exome sequencing to elucidate the underlying genetic defect. We identified the amino acid substitution R275W in phosphatidylinositol 4-kinase type IIα, caused by a homozygous missense mutation in the PI4K2A gene. We used lipidomics, complexome profiling and functional studies to measure phosphatidylinositol 4-phosphate synthesis in the patient and evaluated PI4K2A deficient mice to define a novel metabolic disorder. The R275W residue, located on the surface of the protein, is involved in forming electrostatic interactions with the membrane. The catalytic activity of PI4K2A in patient fibroblasts was severely reduced and lipid mass spectrometry showed that particular acyl-chain pools of PI4P and PI(4,5)P2 were decreased. Phosphoinositide lipids play a major role in intracellular signalling and trafficking and regulate the balance between proliferation and apoptosis. Phosphatidylinositol 4-kinases such as PI4K2A mediate the first step in the main metabolic pathway that generates PI4P, PI(4,5)P2 and PI(3,4,5)P3 . Although neurologic involvement is common, cutis laxa has not been reported previously in metabolic defects affecting signalling. Here we describe a patient with a complex neurological phenotype, premature ageing and a mutation in PI4K2A, illustrating the importance of this enzyme in the generation of inositol lipids with particular acylation characteristics.
    Matched MeSH terms: Homozygote
  17. Fulltext Non-invasive prenatal diagnosis using fetal DNA in maternal plasma: a preliminary study for identification of paternally-inherited alleles using single nucleotide polymorphisms
    Chen JJ, Tan JA, Chua KH, Tan PC, George E
    BMJ Open, 2015 Jul 22;5(7):e007648.
    PMID: 26201722 DOI: 10.1136/bmjopen-2015-007648
    OBJECTIVES: Single nucleotide polymorphism (SNP) with a mutation can be used to identify the presence of the paternally-inherited wild-type or mutant allele as result of the inheritance of either allele in the fetus and allows the prediction of the fetal genotype. This study aims to identify paternal SNPs located at the flanking regions upstream or downstream from the β-globin gene mutations at CD41/42 (HBB:c.127_130delCTTT), IVS1-5 (HBB:c.92+5G>C) and IVS2-654 (HBB:c.316-197C>T) using free-circulating fetal DNA.

    SETTING: Haematology Lab, Department of Biomedical Science, University of Malaya.

    PARTICIPANTS: Eight couples characterised as β-thalassaemia carriers where both partners posed the same β-globin gene mutations at CD41/42, IVS1-5 and IVS2-654, were recruited in this study.

    OUTCOME MEASURES: Genotyping was performed by allele specific-PCR and the locations of SNPs were identified after sequencing alignment.

    RESULTS: Genotype analysis revealed that at least one paternal SNP was present for each of the couples. Amplification on free-circulating DNA revealed that the paternal mutant allele of SNP was present in three fcDNA. Thus, the fetuses may be β-thalassaemia carriers or β-thalassaemia major. Paternal wild-type alleles of SNP were present in the remaining five fcDNA samples, thus indicating that the fetal genotypes would not be homozygous mutants.

    CONCLUSIONS: This preliminary research demonstrates that paternal allele of SNP can be used as a non-invasive prenatal diagnosis approach for at-risk couples to determine the β-thalassaemia status of the fetus.

    Matched MeSH terms: Homozygote
  18. Mutations in mitochondrial complex I assembly factor NDUFAF3 cause Leigh syndrome
    Baertling F, Sánchez-Caballero L, Timal S, van den Brand MA, Ngu LH, Distelmaier F, et al.
    Mol Genet Metab, 2017 03;120(3):243-246.
    PMID: 27986404 DOI: 10.1016/j.ymgme.2016.12.005
    NDUFAF3 is an assembly factor of mitochondrial respiratory chain complex I. Variants in NDUFAF3 have been identified as a cause of severe multisystem mitochondrial disease. In a patient presenting with Leigh syndrome, which has hitherto not been described as a clinical feature of NDUFAF3 deficiency, we identified a novel homozygous variant and confirmed its pathogenicity in patient fibroblasts studies. Furthermore, we present an analysis of complex I assembly routes representative of each functional module and, thereby, link NDUFAF3 to a specific step in complex I assembly. Therefore, our report expands the phenotype of NDUFAF3 deficiency and further characterizes the role of NDUFAF3 in complex I biogenesis.
    Matched MeSH terms: Homozygote
  19. Mutations in bone morphogenetic protein 15 and growth differentiation factor 9 genes are associated with increased litter size in fat-tailed sheep breeds
    Javanmard A, Azadzadeh N, Esmailizadeh AK
    Vet Res Commun, 2011 Mar;35(3):157-67.
    PMID: 21327517 DOI: 10.1007/s11259-011-9467-9
    The objective of this study was to investigate association between GDF9 and BMP15 gene polymorphism and litter size in fat-tailed sheep, a total of 97 mature ewes from four breeds (Afshari=19; Baluchi=18; Makui=30 and Mehraban=30) were genotyped for the BMP15 HinfI and GDF9 HhaI polymorphisms by PCR-RFLP technique. The highest and lowest mutant allele frequencies were found in Makui (0.27) and Afshari (0.10) sheep for the BMP15 gene and in Afshari (0.24) and Mehraban (0.18) sheep for the GDF9 gene, respectively. Litter size was significantly influenced by genotype of the ewe for two genes (P < 0.01). Heterozygous genotypes for both loci showed higher litter size than homozygous genotypes (P < 0.01). None of the individuals carried homozygous genotype for both of the GDF9 and BMP15 variants in these breeds. The individuals carrying the mutant allele for one of the investigated candidate gene still showed fertile phenotype. Thus, existence of homozygosity at one of the BMP15 and GDF9 variant is not probably able to block normal hormonal pathway of reproduction in fat-tailed sheep.
    Matched MeSH terms: Homozygote
  20. Mutational analysis of CYP2C8 in hypertensive patients using denaturing high performance liquid chromatography
    Teh LK, Zahri MK, Zakaria ZA, Ismail R, Salleh MZ
    J Clin Pharm Ther, 2010 Dec;35(6):723-8.
    PMID: 21054465 DOI: 10.1111/j.1365-2710.2009.01146.x
    CYP2C8 is involved in the cytochrome P450 (CYP) epoxygenase pathway. Arachidonic acid metabolites such as epoxyeicosatrienenoic acids and hydroxyeicosatetrenoic acids, produced may have a role in hypertension. We aimed to develop a medium through-put method for screening samples of known and new mutations of CYP2C8 using denaturing high performance liquid chromatography (DHPLC).
    Matched MeSH terms: Homozygote
Related Terms
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links