Displaying publications 21 - 40 of 852 in total

Abstract:
Sort:
  1. Variants of Coconut cadang-cadang viroid isolated from an African oil palm (Elaies guineensis Jacq.) in Malaysia
    Vadamalai G, Hanold D, Rezaian MA, Randles JW
    Arch Virol, 2006 Jul;151(7):1447-56.
    PMID: 16470341
    Variants of Coconut cadang-cadang viroid have been identified in a plantation oil palm growing in Malaysia. Three size classes are described, comprising 297, 293, and 270 nt. Compared with the 296-nt form of coconut cadang-cadang viroid (CCCVd), all variants substituted C31 --> U in the pathogenicity domain and A175 --> C in the right-hand terminus. Other mutations and deletions accounted for the different sizes. These are the first sequences reported for variants of Coconut cadang-cadang viroid in a species other than coconut palm, and this is the first evidence that variants closely related to CCCVd occur outside the Philippines.
    Matched MeSH terms: Base Sequence
  2. VP1 residues around the five-fold axis of enterovirus A71 mediate heparan sulfate interaction
    Tan CW, Sam IC, Lee VS, Wong HV, Chan YF
    Virology, 2017 01 15;501:79-87.
    PMID: 27875780 DOI: 10.1016/j.virol.2016.11.009
    Enterovirus A71 (EV-A71) is a neurotropic enterovirus that uses heparan sulfate as an attachment receptor. The molecular determinants of EV-A71-heparan sulfate interaction are unknown. With In silico heparin docking and mutagenesis of all possible lysine residues in VP1, we identified that K162, K242 and K244 are responsible for heparin interaction and inhibition. EV-A71 mutants with K242A and K244A rapidly acquired compensatory mutations, T100K or E98A, and Q145R-T237N respectively, which restored the heparin-binding phenotype. Both VP1-98 and VP1-145 modulates heparin binding. Heparin-binding phenotype was completely abolished with VP1-E98-E145, but was restored by an E98K or E145Q substitution. During cell culture adaptation, EV-A71 rapidly acquired K98 or Q/G145 to restore the heparin-binding phenotype. Together with next-generation sequencing analysis, our results implied that EV-A71 has high genetic plasticity by modulating positively-charged residues at the five-fold axis during in vitro heparin adaptation. Our finding has impact on EV-A71 vaccine production, evolutionary studies and pathogenesis.
    Matched MeSH terms: Base Sequence
  3. Fulltext Utilization of molecular markers for the conservation of blood cockles, Anadara granosa (Arcidae)
    Chee SY, Azizah MN, Devakie MN
    Genet. Mol. Res., 2011;10(2):1245-61.
    PMID: 21732289 DOI: 10.4238/vol10-2gmr1103
    We examined genetic variation in blood cockles in an effort to obtain information useful for the sustainability, management, and the stability of this species as a major commodity in the fisheries sector. Ten populations of cockles were sampled from the north to the south of the west coast of peninsular Malaysia. The cockles were collected in collaboration with the Fisheries Research Institute, Penang. The population genetic analysis of the cockles were studied via RAPD-PCR and mtDNA sequencing. Three hundred individuals were analyzed with RAPD-PCR experiments. High gene diversity over all loci was observed (Shannon index = 0.549 ± 0.056 and Nei's gene diversity = 0.4852 ± 0.0430 among 35 loci). The second method, mtDNA sequencing, was employed to complement the information obtained from RAPD-PCR. The gene selected for mtDNA sequencing was cytochrome c oxidase I (COI). One hundred and fifty individuals were sequenced, yielding a partial gene of 585 bp. Statistical analysis showed homogeneity in general but did reveal some degree of variability between the populations in Johor and the rest of the populations. The Mantel test showed a positive but nonsignificant correlation between geographic and genetic distances (r = 0.2710, P = 0.622), as in the RAPD analysis. We propose that the homogeneity between distant populations is caused by two factors: 1) the translocation of the spats; 2) larvae are carried by current movement from the north of the peninsula to the south. The different genetic composition found in Johor could be due to pollution, mutagenic substances or physical factors such as the depth of the water column. This population genetic study is the first for this species in peninsular Malaysia. The data from this study have important implications for fishery management, conservation of blood cockles and translocation policies for aquaculture and stock enhancement programs.
    Matched MeSH terms: Base Sequence
  4. Fulltext Use of the denaturing gradient gel electrophoresis (DGGE) method for mutational screening of patients with familial hypercholesterolaemia (FH) and Familial defective apolipoprotein B100 (FDB)
    Azian M, Hapizah MN, Khalid BA, Khalid Y, Rosli A, Jamal R
    Malays J Pathol, 2006 Jun;28(1):7-15.
    PMID: 17694954 MyJurnal
    Familial hypercholesterolaemia (FH) and Familial defective apolipoprotein B100 (FDB) are autosomal dominant inherited diseases of lipid metabolism caused by mutations in the low density lipoprotein (LDL) receptor and apolipoprotein B 100 genes. FH is clinically characterised by elevated concentrations of total cholesterol (TC) and low density lipoprotein cholesterol (LDL-C), presence of xanthomata and premature atherosclerosis. Both conditions are associated with coronary artery disease but may be clinically indistinguishable. Seventy-two (72) FH patients were diagnosed based on the Simon Broome's criteria. Mutational screening was performed by polymerase chain reaction (PCR)-denaturing gradient gel electrophoresis (DGGE). Positive mutations were subjected to DNA sequencing for confirmation of the mutation. We successfully amplified all exons in the LDL receptor and apo B100 genes. DGGE was performed in all exons of the LDL receptor (except for exons 4-3', 18 and promoter region) and apo B100 genes. We have identified four different mutations in the LDL receptor gene but no mutation was detected in the apo B 100 gene. The apo B100 gene mutation was not detected on DGGE screening as sequencing was not performed for negative cases on DGGE technique. To our knowledge, the C234S mutation (exon 5) is a novel mutation worldwide. The D69N mutation (exon 3) has been reported locally while the R385W (exon 9) and R716G (exon 15) mutations have not been reported locally. However, only 4 mutations have been identified among 14/72 patients (19.4%) in 39 FH families. Specificity (1-false positive) of this technique was 44.7% based on the fact that 42/76 (55.3%) samples with band shifts showed normal DNA sequencing results. A more sensitive method needs to be addressed in future studies in order to fully characterise the LDLR and apo B100 genes such as denaturing high performance liquid chromatography. In conclusion, we have developed the DNA analysis for FH patients using PCR-DGGE technique. DNA analysis plays an important role to characterise the type of mutations and forms an adjunct to clinical diagnosis.
    Matched MeSH terms: Base Sequence
  5. Use of Megaprimer and Overlapping Extension PCR (OE-PCR) to Mutagenize and Enhance Cyclodextrin Glucosyltransferase (CGTase) Function
    Goh KM, Liew KJ, Chai KP, Illias RM
    Methods Mol Biol, 2017;1498:385-396.
    PMID: 27709591
    Protein engineering is a very useful tool for probing structure-function relationships in proteins. Specifically, site-directed mutagenized proteins can provide useful insights into structural, binding and catalytic mechanisms of a protein, particularly when coupled with crystallization. In this chapter, we describe two protocols for performing site-directed mutagenesis of any protein-coding sequence, namely, megaprimer PCR and overlapping extension PCR (OE-PCR). We use as an example how these two SDM methods enhanced the function of a cyclodextrin glucosyltransferase (CGTase) from Bacillus lehensis strain G1.
    Matched MeSH terms: Base Sequence
  6. Use of COI, CytB and ND5 genes for intra- and inter-specific differentiation of Haematobia irritans and Haematobia exigua
    Low VL, Tan TK, Lim PE, Domingues LN, Tay ST, Lim YA, et al.
    Vet Parasitol, 2014 Aug 29;204(3-4):439-42.
    PMID: 24912955 DOI: 10.1016/j.vetpar.2014.05.036
    A multilocus sequence analysis using mitochondria-encoded cytochrome c oxidase subunit I (COI), cytochrome B (CytB), NADH dehydrogenase subunit 5 (ND5); nuclear encoded 18S ribosomal RNA (18S) and 28S ribosomal RNA (28S) genes was performed to determine the levels of genetic variation between the closely related species Haematobia irritans Linnaeus and Haematobia exigua de Meijere. Among these five genes, ND5 and CytB genes were found to be more variable and informative in resolving the interspecific relationships of both species. In contrast, the COI gene was more valuable in inferring the intraspecific relationships. The ribosomal 18S and 28S sequences of H. irritans and H. exigua were highly conserved with limited intra- and inter-specific variation. Molecular evidence presented in this study demonstrated that both flies are genetically distinct and could be differentiated based on sequence analysis of mitochondrial genes.
    Matched MeSH terms: Base Sequence
  7. Fulltext Updates on k13 mutant alleles for artemisinin resistance in Plasmodium falciparum
    Zaw MT, Emran NA, Lin Z
    J Microbiol Immunol Infect, 2018 Apr;51(2):159-165.
    PMID: 28711439 DOI: 10.1016/j.jmii.2017.06.009
    BACKGROUND: In the fight against malaria caused by Plasmodium falciparum, the successes achieved by artemisinin were endangered by resistance of the parasites to the drug. Whole genome sequencing approach on artemisinin resistant parasite line discovered k13 gene associated with drug resistance. In vitro and in vivo studies indicated mutations in the k13 gene were linked to the artemisinin resistance.

    METHODOLOGY: The literatures published after April, 2015 up to December, 2016 on k13 mutant alleles for artemisinin resistance in Plasmodium falciparum and relevant literatures were comprehensively reviewed.

    RESULTS: To date, 13 non-synonymous mutations of k13 gene have been observed to have slow parasite clearance. Worldwide mapping of k13 mutant alleles have shown mutants associated with artemisinin resistance were confined to southeast Asia and China and did not invade to African countries. Although in vitro ring stage survival assay of 0-3 h was a recently developed assay, it was useful for rapid detection of artemisinin resistance associated k13 allelic marker in the parasite. Recently, dissemination of k13 mutant alleles was recommended to be investigated by identity of haplotypes. Significant characteristics of well described alleles in the reports were mentioned in this review for the benefit of future studies.

    CONCLUSION: According to the updates in the review, it can be concluded artemisinin resistance does not disseminate to India and African countries within short period whereas regular tracking of these mutants is necessary.

    Matched MeSH terms: Base Sequence
  8. Fulltext Unusual long-chain N-acyl homoserine lactone production by and presence of quorum quenching activity in bacterial isolates from diseased tilapia fish
    Chang CY, Koh CL, Sam CK, Chan XY, Yin WF, Chan KG
    PLoS One, 2012;7(8):e44034.
    PMID: 22952864 DOI: 10.1371/journal.pone.0044034
    Growth-dependent cell-cell communication termed quorum sensing is a key regulatory system in bacteria for controlling gene expression including virulence factors. In this study five potential bacterial pathogens including Bacillus sp. W2.2, Klebsiella sp. W4.2, Pseudomonas sp. W3 and W3.1 and Serratia sp. W2.3 were isolated from diseased Tilapia fish in Malaysia, supplied by the leading global fish supplier. Proteolytic activity assays confirmed that with the exception of Klebsiella sp. W4.2, all isolates showed distinct proteolytic activity. Furthermore Bacillus sp. W2.2 and Pseudomonas sp. strains W3 and W3.1 also displayed haemolytic activity. By using high resolution liquid chromatography mass spectrometry, we revealed the presence of unusually long-chain N-(3-oxohexadecanoyl)-homoserine lactone (3-oxo-C16-HSL) from Pseudomonas sp. W3.1 and N-dodecanoyl-homoserine lactone (C12-HSL) from Serratia sp. W2.3, respectively. Interestingly, Pseudomonas sp. W3.1 also produced a wide range of Pseudomonas quinolone signalling (PQS) molecules. Pseudomonas sp. W3 did not show any quorum sensing properties but possessed quorum quenching activity that inactivated AHLs. This study is the first documentation that shows unusual long-chain AHLs production in Serratia sp. and Pseudomonas sp. isolated from diseased fish and the latter also produce a wide range of PQS molecules.
    Matched MeSH terms: Base Sequence
  9. Type-3 dengue viruses responsible for the dengue epidemic in Malaysia during 1993-1994
    Kobayashi N, Thayan R, Sugimoto C, Oda K, Saat Z, Vijayamalar B, et al.
    Am J Trop Med Hyg, 1999 Jun;60(6):904-9.
    PMID: 10403318
    To characterize the dengue epidemic that recently occurred in Malaysia, we sequenced cDNAs from nine 1993-1994 dengue virus type-3 (DEN-3) isolates in Malaysia (DEN-3 was the most common type in Malaysia during this period). Nucleic acid sequences (720 nucleotides in length) from the nine isolates, encompassing the precursor of membrane protein (preM) and membrane (M) protein genes and part of the envelope (E) protein gene were aligned with various reference DEN-3 sequences to generate a neighbor-joining phylogenetic tree. According to the constructed tree, the nine Malaysian isolates were grouped into subtype II, which comprises Thai isolates from 1962 to 1987. Five earlier DEN-3 virus Malaysian isolates from 1974 to 1981 belonged to subtype I. The present data indicate that the recent dengue epidemic in Malaysia was due to the introduction of DEN-3 viruses previously endemic to Thailand.
    Matched MeSH terms: Base Sequence
  10. Two types of triplicated alpha-globin loci in humans
    Lie-Injo LE, Herrera AR, Kan YW
    Nucleic Acids Res, 1981 Aug 11;9(15):3707-17.
    PMID: 6269090
    DNA from healthy Malaysian newborns was studied on gene maps after digestion with different restriction endonucleases. Of 65 newborns, two were found to be carriers of two different variants of triplicated alpha-globin loci. In variant no. 1, found in an Malay, the three alpha-globin genes are in an elongated DNA fragment on digestion with Eco RI and Bam HI. The third alpha-globin gene was found in a additional 3.7-kb fragment on digestion with Hpa I, Bgl II and Hind III. In variant no. 2, a new type of triplicated alpha-globin loci, found in a Chinese, the three alpha-globin genes reside in an elongated DNA fragment longer than that of variant no. 1 on digestion with Eco RI and Bam HI. The third alpha-globin gene was found in an additional 4.2-kb fragment on digestion with Hpa I and Hind III. Digestion of this variant DNA with Bg1 II produced an abnormal 16.7-kb fragment in addition to the normal 7.0-kb Bgl-II fragment. The locations of the restriction sites in the two types of triplicated alpha-globin loci are compatible with a mechanism of unequal crossing over following two different modes of misalignment.
    Matched MeSH terms: Base Sequence
  11. Two species of Southeast Asian cats in the genus Catopuma with diverging histories: an island endemic forest specialist and a widespread habitat generalist
    Patel RP, Förster DW, Kitchener AC, Rayan MD, Mohamed SW, Werner L, et al.
    R Soc Open Sci, 2016 Oct;3(10):160350.
    PMID: 27853549
    Background. The bay cat Catopuma badia is endemic to Borneo, whereas its sister species the Asian golden cat Catopuma temminckii is distributed from the Himalayas and southern China through Indochina, Peninsular Malaysia and Sumatra. Based on morphological data, up to five subspecies of the Asian golden cat have been recognized, but a taxonomic assessment, including molecular data and morphological characters, is still lacking. Results. We combined molecular data (whole mitochondrial genomes), morphological data (pelage) and species distribution projections (up to the Late Pleistocene) to infer how environmental changes may have influenced the distribution of these sister species over the past 120 000 years. The molecular analysis was based on sequenced mitogenomes of 3 bay cats and 40 Asian golden cats derived mainly from archival samples. Our molecular data suggested a time of split between the two species approximately 3.16 Ma and revealed very low nucleotide diversity within the Asian golden cat population, which supports recent expansion of the population. Discussion. The low nucleotide diversity suggested a population bottleneck in the Asian golden cat, possibly caused by the eruption of the Toba volcano in Northern Sumatra (approx. 74 kya), followed by a continuous population expansion in the Late Pleistocene/Early Holocene. Species distribution projections, the reconstruction of the demographic history, a genetic isolation-by-distance pattern and a gradual variation of pelage pattern support the hypothesis of a post-Toba population expansion of the Asian golden cat from south China/Indochina to Peninsular Malaysia and Sumatra. Our findings reject the current classification of five subspecies for the Asian golden cat, but instead support either a monotypic species or one comprising two subspecies: (i) the Sunda golden cat, distributed south of the Isthmus of Kra: C. t. temminckii and (ii) Indochinese, Indian, Himalayan and Chinese golden cats, occurring north of the Isthmus: C. t. moormensis.
    Matched MeSH terms: Base Sequence
  12. Fulltext Two novel tyrosinase (TYR) gene mutations with pathogenic impact on oculocutaneous albinism type 1 (OCA1)
    Ghodsinejad Kalahroudi V, Kamalidehghan B, Arasteh Kani A, Aryani O, Tondar M, Ahmadipour F, et al.
    PLoS One, 2014;9(9):e106656.
    PMID: 25216246 DOI: 10.1371/journal.pone.0106656
    Oculocutaneous albinism (OCA) is a heterogeneous group of autosomal recessive disorders resulting from mutations of the tyrosinase (TYR) gene and presents with either complete or partial absence of pigment in the skin, hair and eyes due to a defect in an enzyme involved in the production of melanin. In this study, mutations in the TYR gene of 30 unrelated Iranian OCA1 patients and 100 healthy individuals were examined using PCR-sequencing. Additionally, in order to predict the possible effects of new mutations on the structure and function of tyrosinase, these mutations were analyzed by SIFT, PolyPhen and I-Mutant 2 software. Here, two new pathogenic p.C89S and p.H180R mutations were detected in two OCA1 patients. Moreover, the R402Q and S192Y variants, which are common non-pathogenic polymorphisms, were detected in 17.5% and 35% of the patients, respectively. The outcome of this study has extended the genotypic spectrum of OCA1 patients, which paves the way for more efficient carrier detection and genetic counseling.
    Matched MeSH terms: Base Sequence
  13. Two novel polyadenylation mutations leading to beta(+)-thalassemia
    Jankovic L, Efremov GD, Petkov G, Kattamis C, George E, Yang KG, et al.
    Br J Haematol, 1990 May;75(1):122-6.
    PMID: 2375910
    In an ongoing effort to identify point mutations causing beta-thalassaemia, we have found two previously unreported mutations which are located in the Poly A site of the beta-globin gene. The screening programme used amplified DNA and dot-blot hybridization with several 32P-labelled oligonucleotide probes. DNA samples which remained unidentified by this methodology were subjected to sequencing with 32P-labelled primers and modified T7 DNA polymerase. The newly discovered mutations were confirmed by the dot-blot hybridization technique. One type concerned an AATAAA----AATGAA mutation in the polyadenylation site and was found in one family from Yugoslavia (including one patient with the C----T mutation at codon 29 in trans), one from Bulgaria (the patient had the G----A mutation at IVS-I-110 in trans), and one from Greece (this patient had the C----G mutation at IVS-II-745 in trans). Haematological data for three simple heterozygotes suggested a rather mild beta(+)-thalassemia. The second type involved an AATAAA----AATAGA mutation and was found in one family from Malaysia. The propositus had the beta E mutation on the other chromosome, was originally diagnosed as mild Hb E-beta(+)-thalassaemia, and had Hb A and Hb E percentages which were nearly the same.
    Matched MeSH terms: Base Sequence
  14. Two microsatellite loci from Brugia malayi show polymorphisms among isolates from Indonesia and Malaysia
    Underwood AP, Supali T, Wu Y, Bianco AE
    Mol Biochem Parasitol, 2000 Mar 05;106(2):299-302.
    PMID: 10699259
    Matched MeSH terms: Base Sequence
  15. Two New and Nontoxigenic Pseudo-nitzschia species (Bacillariophyceae) from Chinese Southeast Coastal Waters
    Chen XM, Pang JX, Huang CX, Lundholm N, Teng ST, Li A, et al.
    J Phycol, 2021 Feb;57(1):335-344.
    PMID: 33174223 DOI: 10.1111/jpy.13101
    To explore the species diversity and toxin profile of Pseudo-nitzschia, monoclonal strains were established from Chinese southeast coastal waters. The morphology was examined under light and transmission electron microscopy. The internal transcribed spacer region of ribosomal DNA was sequenced for phylogenetic analyses, and the secondary structure of ITS2 was predicted and compared among allied taxa. A combination of morphological and molecular data showed the presence of two new species, Pseudo-nitzschia hainanensis sp. nov. and Pseudo-nitzschia taiwanensis sp. nov. Pseudo-nitzschia hainanensis was characterized by a dumpy-lanceolate valve with slightly blunt apices and a central nodule, as well as striae comprising two rows of poroids. Pseudo-nitzschia taiwanensis was characterized by a slender-lanceolate valve, and striae comprising one row of split poroids. The poroid structure mainly comprised two sectors. Both taxa constituted their own monophyletic lineage in the phylogenetic analyses inferred from ITS2 rDNA and were well differentiated from other Pseudo-nitzschia species. Morphologically, P. hainanensis and P. taiwanensis could be assigned to the Pseudo-nitzschia delicatissima and the Pseudo-nitzschia pseudodelicatissima complex, respectively. Particulate domoic acid was measured using liquid chromatography coupled with tandem mass spectrometry (LC-MS/MS), but no detectable pDA was found. With the description of the two new species, the species diversity of genus Pseudo-nitzschia reaches 58 worldwide, among which 31 have been recorded from Chinese coastal waters.
    Matched MeSH terms: Base Sequence
  16. Trinucleotide insertion in the SMN2 promoter may not be related to the clinical phenotype of SMA
    Harahap NI, Takeuchi A, Yusoff S, Tominaga K, Okinaga T, Kitai Y, et al.
    Brain Dev, 2015 Aug;37(7):669-76.
    PMID: 25459970 DOI: 10.1016/j.braindev.2014.10.006
    More than 90% of spinal muscular atrophy (SMA) patients show homozygous deletion of SMN1 (survival motor neuron 1). They retain SMN2, a highly homologous gene to SMN1, which may partially compensate for deletion of SMN1. Although the promoter sequences of these two genes are almost identical, a GCC insertion polymorphism has been identified at c.-320_-321 in the SMN1 promoter. We have also found this insertion polymorphism in an SMN2 promoter in an SMA patient (Patient A) who has SMA type 2/3.
    Matched MeSH terms: Base Sequence
  17. Tridimensional personalities and polymorphism of dopamine D2 receptor among heroin addicts
    Teh LK, Izuddin AF, M H FH, Zakaria ZA, Salleh MZ
    Biol Res Nurs, 2012 Apr;14(2):188-96.
    PMID: 21613340 DOI: 10.1177/1099800411405030
    Drug addiction is a multifactorial disorder. Researchers have posited that an individual's inherited behavioral propensity or temperament contributes to the disorder by shaping a personality strongly linked with the risk of drug abuse. Further, they hypothesize that the polymorphism of dopamine D2 receptor increases the susceptibility to and severity of addiction. We, therefore, investigated possible associations between dopamine D2 receptor (DRD2) and personality traits among intravenous heroin addicts.
    Matched MeSH terms: Base Sequence
  18. Fulltext Triallelic and epigenetic-like inheritance in human disorders of telomerase
    Collopy LC, Walne AJ, Cardoso S, de la Fuente J, Mohamed M, Toriello H, et al.
    Blood, 2015 Jul 09;126(2):176-84.
    PMID: 26024875 DOI: 10.1182/blood-2015-03-633388
    Dyskeratosis congenita (DC) and related diseases are a heterogeneous group of disorders characterized by impaired telomere maintenance, known collectively as the telomeropathies. Disease-causing variants have been identified in 10 telomere-related genes including the reverse transcriptase (TERT) and the RNA component (TERC) of the telomerase complex. Variants in TERC and TERT can impede telomere elongation causing stem cells to enter premature replicative senescence and/or apoptosis as telomeres become critically short. This explains the major impact of the disease on highly proliferative tissues such as the bone marrow and skin. However, telomerase variants are not always fully penetrant and in some families disease-causing variants are seen in asymptomatic family members. As a result, determining the pathogenic status of newly identified variants in TERC or TERT can be quite challenging. Over a 3-year period, we have identified 26 telomerase variants (16 of which are novel) in 23 families. Additional investigations (including family segregation and functional studies) enabled these to be categorized into 3 groups: (1) disease-causing (n = 15), (2) uncertain status (n = 6), and (3) bystanders (n = 5). Remarkably, this process has also enabled us to identify families with novel mechanisms of inheriting human telomeropathies. These include triallelic mutations, involving 2 different telomerase genes, and an epigenetic-like inheritance of short telomeres in the absence of a telomerase mutation. This study therefore highlights that telomerase variants have highly variable functional and clinical manifestations and require thorough investigation to assess their pathogenic contribution.
    Matched MeSH terms: Base Sequence
  19. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations
    Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
    Matched MeSH terms: Base Sequence
  20. Transcriptome-wide identification and characterization of the Rab GTPase family in mango
    Lawson T, Lycett GW, Mayes S, Ho WK, Chin CF
    Mol Biol Rep, 2020 Jun;47(6):4183-4197.
    PMID: 32444976 DOI: 10.1007/s11033-020-05519-y
    The Rab GTPase family plays a vital role in several plant physiological processes including fruit ripening. Fruit softening during ripening involves trafficking of cell wall polymers and enzymes between cellular compartments. Mango, an economically important fruit crop, is known for its delicious taste, exotic flavour and nutritional value. So far, there is a paucity of information on the mango Rab GTPase family. In this study, 23 genes encoding Rab proteins were identified in mango by a comprehensive in silico approach. Sequence alignment and similarity tree analysis with the model plant Arabidopsis as a reference enabled the bona fide assignment of the deduced mango proteins to classify into eight subfamilies. Expression analysis by RNA-Sequencing (RNA-Seq) showed that the Rab genes were differentially expressed in ripe and unripe mangoes suggesting the involvement of vesicle trafficking during ripening. Interaction analysis showed that the proteins involved in vesicle trafficking and cell wall softening were interconnected providing further evidence of the involvement of the Rab GTPases in fruit softening. Correlation analyses showed a significant relationship between the expression level of the RabA3 and RabA4 genes and fruit firmness at the unripe stage of the mango varieties suggesting that the differences in gene expression level might be associated with the contrasting firmness of these varieties. This study will not only provide new insights into the complexity of the ripening-regulated molecular mechanism but also facilitate the identification of potential Rab GTPases to address excessive fruit softening.
    Matched MeSH terms: Base Sequence/genetics
Related Terms
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links