MyMedR

Displaying publications 21 - 40 of 73 in total

Abstract:

Sort:

Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations

Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.

Public Health Genomics, 2015;18(1):60-4.
PMID: 25412720 DOI: 10.1159/000368342

BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.

Matched MeSH terms: beta-Globins/genetics*
The use of Taqman genotyping assays for rapid confirmation of β-thalassaemia mutations in the Malays: accurate diagnosis with low DNA concentrations

Teh LK, Lee TY, Tan JA, Lai MI, George E

Int J Lab Hematol, 2015 Feb;37(1):79-89.
PMID: 24725998 DOI: 10.1111/ijlh.12240

In Malaysia, β-thalassaemia is a common inherited blood disorder in haemoglobin synthesis with a carrier rate of 4.5%. Currently, PCR-incorporating techniques such as amplification refractory mutation system (ARMS) or reverse dot blot hybridization (RDBH) are used in β-thalassaemia mutation detection. ARMS allows single-mutation identification using two reactions, one for wild type and another for mutant alleles. RDBH requires probe immobilization and optimization of hybridization and washing temperatures which is time consuming. The aim of our study was to investigate whether β-thalassaemia mutations can be identified in samples with low DNA concentrations.

Matched MeSH terms: beta-Globins/genetics*
[Case of deletion type beta(0)-thalassemia found in an Asian (Malaysian) family living in Japan]

Harano K, Harano T

Rinsho Byori, 2010 Apr;58(4):325-31.
PMID: 20496759

Hb and gene analyses of a Malaysian mother and her two daughters with microcytic anemia living in Japan were performed. Hb analyses of their hemolysates by IEF and DEAE-HPLC revealed high values of Hb A2 and HbF, but abnormal Hbs such as Hb E and Hb Constant Spring, which cause beta- and alpha-thalassemia traits, were not detected. From these data, they were suspected to be beta-thalassemia carriers. The thalassemic mutations commonly found in the Asian area by ARMS and nucleotide sequencing methods were not detected, and the frameworks of the beta-globin gene and the haplotypes of the beta-like globin gene cluster between the mother and daughters were not identical. These results led us to conclude that there was a beta(0)-thalassemia mutation with a large deletion from the beta-globin gene beyond the 3'beta/BamHI polymorphic site 3' downstream to the beta-globin gene. However, the range of the deletion from the beta-like globin gene cluster has not yet been completed in detail. Recently, there have been many foreigners mainly from Asian countries in Japan. We may encounter people with the rare type thalassemic mutation described in the text besides the mutations frequently found in Asian countries.

Matched MeSH terms: beta-Globins/genetics*
Fulltext Characterisation of beta-globin gene mutations in Malaysian children: a strategy for the control of beta-thalassaemia in a developing country

Thong MK, Tan JA, Tan KL, Yap SF

J Trop Pediatr, 2005 Dec;51(6):328-33.
PMID: 15967770 DOI: 10.1093/tropej/fmi052

beta-thalassaemia major, an autosomal recessive hemoglobinopathy, is one of the most common single gene disorders in multi-racial Malaysia. The control of beta-thalassaemia major requires a multi-disciplinary approach that includes population screening, genetic counselling, prenatal diagnosis and the option of termination of affected pregnancies. To achieve this objective, the molecular characterisation of the spectrum of beta-globin gene mutations in each of the affected ethnic groups is required. We studied 88 consecutive unrelated individuals and their respective families with beta-thalassaemia (74 beta-thalassaemia major, 12 HbE-beta-thalassaemia, 2 with HbE homozygotes) and four individuals with beta-thalassaemia trait that contributed a total 180 alleles for study. Using a 2-step molecular diagnostic strategy consisting of amplification refractory mutation system (ARMS) to identify the 8 most common mutations followed by other DNA-based diagnostic techniques, a total of 177 (98.3 per cent) of the 180 beta-thalassaemia alleles were characterised. One out of 91 (1 per cent) of the Chinese alleles, one out of 46 (2.2 per cent) Malay alleles and one out of two Indian alleles remained unknown. A 100 per cent success rate was achieved in studying the Kadazandusun community in this study. A strategy to identify beta-globin gene mutations in Malaysians with beta-thalassaemia is proposed based on this outcome.

Matched MeSH terms: Globins/genetics*
Fulltext Analysis of selected glutathione S-transferase gene polymorphisms in Malaysian type 2 diabetes mellitus patients with and without cardiovascular disease

Etemad A, Vasudevan R, Aziz AF, Yusof AK, Khazaei S, Fawzi N, et al.

Genet. Mol. Res., 2016 Apr 07;15(2).
PMID: 27173202 DOI: 10.4238/gmr.15025845

Type 2 diabetes mellitus (T2DM) is believed to be associated with excessive production of reactive oxygen species. Glutathione S-transferase (GST) polymorphisms result in decreased or absent enzyme activity and altered oxidative stress, and have been associated with cardiovascular disease (CVD). The present study assessed the effect of GST polymorphisms on the risk of developing T2DM in individuals of Malaysian Malay ethnicity. A total of 287 subjects, consisting of 87 T2DM and 64 CVD/T2DM patients, as well as 136 healthy gender- and age-matched controls were genotyped for selected polymorphisms to evaluate associations with T2DM susceptibility. Genomic DNA was extracted using commercially available kits, and GSTM1, GSTT1, and α-globin sequences were amplified by multiplex polymerase chain reaction. Biochemical parameters were measured with a Hitachi autoanalyzer. The Fisher exact test, the chi-square statistic, and means ± standard deviations were calculated using the SPSS software. Overall, we observed no significant differences regarding genotype and allele frequencies between each group (P = 0.224 and 0.199, respectively). However, in the combined analysis of genotypes and blood measurements, fasting plasma glucose, HbA1c, and triglyceride levels, followed by age, body mass index, waist-hip ratio, systolic blood pressure, and history of T2DM significantly differed according to GST polymorphism (P ˂ 0.05). Genetically induced absence of the GSTT1 enzyme is an independent and powerful predictor of premature vascular morbidity and death in individuals with T2DM, and might be triggered by cigarette smoking's oxidative effects. These polymorphisms could be screened in other ethnicities within Malaysia to determine further possible risk factors.

Matched MeSH terms: alpha-Globins/genetics
Fulltext Non-invasive prenatal diagnosis using fetal DNA in maternal plasma: a preliminary study for identification of paternally-inherited alleles using single nucleotide polymorphisms

Chen JJ, Tan JA, Chua KH, Tan PC, George E

BMJ Open, 2015 Jul 22;5(7):e007648.
PMID: 26201722 DOI: 10.1136/bmjopen-2015-007648

OBJECTIVES: Single nucleotide polymorphism (SNP) with a mutation can be used to identify the presence of the paternally-inherited wild-type or mutant allele as result of the inheritance of either allele in the fetus and allows the prediction of the fetal genotype. This study aims to identify paternal SNPs located at the flanking regions upstream or downstream from the β-globin gene mutations at CD41/42 (HBB:c.127_130delCTTT), IVS1-5 (HBB:c.92+5G>C) and IVS2-654 (HBB:c.316-197C>T) using free-circulating fetal DNA.
SETTING: Haematology Lab, Department of Biomedical Science, University of Malaya.
PARTICIPANTS: Eight couples characterised as β-thalassaemia carriers where both partners posed the same β-globin gene mutations at CD41/42, IVS1-5 and IVS2-654, were recruited in this study.
OUTCOME MEASURES: Genotyping was performed by allele specific-PCR and the locations of SNPs were identified after sequencing alignment.
RESULTS: Genotype analysis revealed that at least one paternal SNP was present for each of the couples. Amplification on free-circulating DNA revealed that the paternal mutant allele of SNP was present in three fcDNA. Thus, the fetuses may be β-thalassaemia carriers or β-thalassaemia major. Paternal wild-type alleles of SNP were present in the remaining five fcDNA samples, thus indicating that the fetal genotypes would not be homozygous mutants.
CONCLUSIONS: This preliminary research demonstrates that paternal allele of SNP can be used as a non-invasive prenatal diagnosis approach for at-risk couples to determine the β-thalassaemia status of the fetus.

Matched MeSH terms: beta-Globins/genetics*
BamH1 polymorphism in the Chinese, Malays, and Indians in Singapore and its application in the prenatal diagnosis of beta-thalassemia

Tan JA, Tay SH, Kham KY, Wong HB

Jpn. J. Hum. Genet., 1993 Sep;38(3):315-8.
PMID: 7903173 DOI: 10.1007/BF01874141

The distribution of restriction fragment length polymorphism (RFLP) at the BamH1 site of the beta-globin gene was investigated in the Chinese, Indian, and Malay race in Singapore. The sample comprised of 183 normal individuals and 35 beta-thalassemia carriers in which 13 were couples with at least one beta-major child. The results from this study indicate that BamH1 polymorphism will be informative in 22% of pregnancies at risk for beta-thalassemia major in Chinese, 19% in Malays and 7% in Indians. In prenatal diagnosis using BamH1 polymorphism for one beta-major affected family, the fetus was diagnosed to be normal or beta-carrier. The validity of BamH1 polymorphism in the exclusion of beta-thalassemia major was subsequently confirmed at birth by globin chain biosynthesis.

Matched MeSH terms: Globins/genetics*
Preimplantation genetic diagnosis for beta-thalassemia using single-cell DNA analysis for codons 17 and 26 of beta-globin gene

Nasri NW, Jamal AR, Abdullah NC, Razi ZR, Mokhtar NM

Arch Med Res, 2009 Jan;40(1):1-9.
PMID: 19064120 DOI: 10.1016/j.arcmed.2008.10.008

Preimplantation genetic diagnosis (PGD) of monogenic autosomal hereditary disorders following assisted conception usually involves the removal of one or two blastomeres from preimplantation embryos. However, the amount of DNA from a single blastomere is insufficient to amplify the region of interest. Hence, the whole genome amplification (WGA) method is performed prior to amplifying the genes of interest before analysis of DNA material through polymerase chain reaction (PCR).

Matched MeSH terms: beta-Globins/genetics*
Phage N15 protelomerase resolves its tos recognition site into hairpin telomeres within mammalian cells

Liew PS, Chen Q, Ng AWR, Chew YC, Ravin NV, Sim EUH, et al.

Anal Biochem, 2019 10 15;583:113361.
PMID: 31306622 DOI: 10.1016/j.ab.2019.113361

Phage N15 protelomerase (TelN) cleaves double-stranded circular DNA containing a telomerase-occupancy-site (tos) and rejoins the resulting linear-ends to form closed-hairpin-telomeres in Escherichia coli (E. coli). Continued TelN expression is essential to support resolution of the linear structure. In mammalian cells, no enzyme with TelN-like activities has been found. In this work, we show that phage TelN, expressed transiently and stably in human and mouse cells, recapitulates its native activities in these exogenous environments. We found TelN to accurately resolve tos-DNA in vitro and in vivo within human and mouse cells into linear DNA-containing terminal telomeres that are resistant to RecBCD degradation, a hallmark of protelomerase processing. In stable cells, TelN activity was detectable for at least 60 days, which suggests the possibility of limited silencing of its expression. Correspondingly, linear plasmid containing a 100 kb human β-globin gene expressed for at least 120 h in non-β-globin-expressing mouse cells with TelN presence. Our results demonstrate TelN is able to cut and heal DNA as hairpin-telomeres within mammalian cells, providing a tool for creating novel structures by DNA resolution in these hosts. The TelN protelomerase may be useful for exploring novel technologies for genome interrogation and chromosome engineering.

Matched MeSH terms: beta-Globins/genetics*
A comparison of bleeding efficiency, microbiological quality and lipid oxidation in goats subjected to conscious halal slaughter and slaughter following minimal anesthesia

Sabow AB, Sazili AQ, Zulkifli I, Goh YM, Ab Kadir MZ, Abdulla NR, et al.

Meat Sci, 2015 Jun;104:78-84.
PMID: 25732178 DOI: 10.1016/j.meatsci.2015.02.004

The study assessed the effect of conscious halal slaughter and slaughter following minimal anesthesia on bleeding efficiency of goats and keeping quality of goat meat. Ten Boer cross bucks were divided into two groups and subjected to either halal slaughter without stunning (HS) or minimal anesthesia prior to slaughter (AS). The blood lost during exsanguination was measured. Residual blood was further quantified by determination of hemoglobin and myoglobin content in longissimus lumborum muscle. Storage stability of the meat was evaluated by microbiological analysis and lipid oxidation. Blood loss at exsanguination, residual hemoglobin and lipid oxidation were not significantly different (p>0.05) between HS and AS. Lactic acid bacteria was the only microbe that was significantly elevated after 24h of storage at 4°C in the AS group. In conclusion, slaughtering goats under minimal anesthesia or fully conscious did not affect bleeding efficiency and keeping quality of goat meat.

Matched MeSH terms: Globins/analysis
Hb Bart's level in cord blood and deletions of alpha-globin genes

Lie-Injo LE, Solai A, Herrera AR, Nicolaisen L, Kan YW, Wan WP, et al.

Blood, 1982 Feb;59(2):370-6.
PMID: 6895707

The white blood cell DNA of 36 cord blood samples with Hb Bart's in the red blood cells was studied for alpha-globin gene deletions by hybridization of DNA fragments digested by the restriction endonucleases Eco RI, Hpa I, Bam HI, and Bgl II. All 16 DNA samples from cord blood with Hb Bart's below 3% and no other abnormal hemoglobin had one alpha-globin gene deletion (alpha thal2), except one which had two alpha-globin gene deletions (alpha thal1). Most of the alpha thal2 were of the rightward deletion alpha thal2 genotype. Two new types of alpha thal2 variation was found, probably due to a polymorphism somewhere in an area outside the alpha-globin gene. All 14 cases with Hb Bart's between 3.5% and 8.5% and no other abnormal hemoglobin had two alpha-globin gene deletions (alpha thal1), except one that did not have any alpha-globin gene deletion and one that had one alpha-globin gene deletion. Three DNA samples of cord blood with Hb Bart's accompanied by Hb CoSp did not have any alpha-globin gene deletion. Sixty-five DNA samples from cord blood without Hb Bart's or other abnormal hemoglobin had no alpha-globin gene deletions, except one that had one alpha-globin gene deletion (alpha thal2). Two of the 65 DNA samples were found to have triplicated alpha-globin gene loci.

Matched MeSH terms: Globins/genetics*; Hemoglobins, Abnormal/analysis*
High frequency of triplicated alpha-globin loci and absence or low frequency of alpha thalassemia in Polynesian Samoans

Lie-Injo LE, Pawson IG, Solai A

Hum Genet, 1985;70(2):116-8.
PMID: 2989152

Most of the population in certain areas of Melanesia have one alpha-globin gene deletion (alpha thal2). It is thought that the high frequencies of alpha thal2 in this population is due to a selective advantage given by malaria infection to carriers of alpha thal2. We are interested in neighboring Polynesia which, although adjacent to Melanesia, has always been free of malaria due to the absence of the vector anopheles. We studied 60 Polynesian Samoans and 150 Malaysians by restriction endonuclease gene mapping using Eco RI, Bam HI, and Bgl II and hybridization to 32P-labeled alpha-globin gene probe. Seven among the 60 (11.7%) Samoans had triplicated alpha-globin loci type 1, while none had alpha thal2. On digestion with Bgl II the third alpha-globin gene was found in an additional 3.7 kb fragment in all seven Samoans with triplicated alpha-globin loci, while digestion with Bam HI produced an abnormal elongated 18.2 kb fragment carrying alpha-globin genes in addition to the normal 14.5 kb fragment. None of the Polynesian Samoans had alpha thal2 or alpha thal1. Only two of the Malaysians had triplicated alpha-globin loci.

Matched MeSH terms: Globins/genetics*
Two types of triplicated alpha-globin loci in humans

Lie-Injo LE, Herrera AR, Kan YW

Nucleic Acids Res, 1981 Aug 11;9(15):3707-17.
PMID: 6269090

DNA from healthy Malaysian newborns was studied on gene maps after digestion with different restriction endonucleases. Of 65 newborns, two were found to be carriers of two different variants of triplicated alpha-globin loci. In variant no. 1, found in an Malay, the three alpha-globin genes are in an elongated DNA fragment on digestion with Eco RI and Bam HI. The third alpha-globin gene was found in a additional 3.7-kb fragment on digestion with Hpa I, Bgl II and Hind III. In variant no. 2, a new type of triplicated alpha-globin loci, found in a Chinese, the three alpha-globin genes reside in an elongated DNA fragment longer than that of variant no. 1 on digestion with Eco RI and Bam HI. The third alpha-globin gene was found in an additional 4.2-kb fragment on digestion with Hpa I and Hind III. Digestion of this variant DNA with Bg1 II produced an abnormal 16.7-kb fragment in addition to the normal 7.0-kb Bgl-II fragment. The locations of the restriction sites in the two types of triplicated alpha-globin loci are compatible with a mechanism of unequal crossing over following two different modes of misalignment.

Matched MeSH terms: Globins/genetics*; Hemoglobins, Abnormal/genetics
Two novel polyadenylation mutations leading to beta(+)-thalassemia

Jankovic L, Efremov GD, Petkov G, Kattamis C, George E, Yang KG, et al.

Br J Haematol, 1990 May;75(1):122-6.
PMID: 2375910

In an ongoing effort to identify point mutations causing beta-thalassaemia, we have found two previously unreported mutations which are located in the Poly A site of the beta-globin gene. The screening programme used amplified DNA and dot-blot hybridization with several 32P-labelled oligonucleotide probes. DNA samples which remained unidentified by this methodology were subjected to sequencing with 32P-labelled primers and modified T7 DNA polymerase. The newly discovered mutations were confirmed by the dot-blot hybridization technique. One type concerned an AATAAA----AATGAA mutation in the polyadenylation site and was found in one family from Yugoslavia (including one patient with the C----T mutation at codon 29 in trans), one from Bulgaria (the patient had the G----A mutation at IVS-I-110 in trans), and one from Greece (this patient had the C----G mutation at IVS-II-745 in trans). Haematological data for three simple heterozygotes suggested a rather mild beta(+)-thalassemia. The second type involved an AATAAA----AATAGA mutation and was found in one family from Malaysia. The propositus had the beta E mutation on the other chromosome, was originally diagnosed as mild Hb E-beta(+)-thalassaemia, and had Hb A and Hb E percentages which were nearly the same.

Matched MeSH terms: Globins/genetics*
Molecular characterization of beta-globin gene mutations in Malay patients with Hb E-beta-thalassaemia and thalassaemia major

Yang KG, Kutlar F, George E, Wilson JB, Kutlar A, Stoming TA, et al.

Br J Haematol, 1989 May;72(1):73-80.
PMID: 2736244

This study concerned the identification of the beta-thalassaemia mutations that were present in 27 Malay patients with Hb E-beta-thalassaemia and seven Malay patients with thalassaemia major who were from West Malaysia. Nearly 50% of all beta-thalassaemia chromosomes carried the G----C substitution at nucleotide 5 of IVS-I; the commonly occurring Chinese anomalies such as the frameshift at codons 41 and 42, the nonsense mutation A----T at codon 17, the A----G substitution at position -28 of the promoter region, and the C----T substitution at position 654 of the second intron, were rare or absent. Two new thalassaemia mutations were discovered. The first involves a frameshift at codon 35 (-C) that was found in two patients with Hb E-beta zero-thalassaemia and causes a beta zero-thalassaemia because a stop codon is present at codon 60. The second is an AAC----AGC mutation in codon 19 that was present on six chromosomes. This substitution results in the production of an abnormal beta chain (beta-Malay) that has an Asn----Ser substitution at position beta 19. Hb Malay is a 'Hb Knossos-like' beta +-thalassaemia abnormality; the A----G mutation at codon 19 likely creates an alternate splicing site between codons 17 and 18, reducing the efficiency of the normal donor splice site at IVS-I to about 60%.

Matched MeSH terms: Globins/genetics*; Hemoglobins, Abnormal/genetics*
Multiple alpha-globin genes in crab-eating macaques (Macaca fascicularis)

Takenaka A, Ueda S, Terao K, Takenaka O

Mol Biol Evol, 1991 May;8(3):320-6.
PMID: 2072861

Alpha-globin genes in crab-eating macaques were found to be triplicated at high frequencies according to restriction-enzyme comparisons. The frequencies of triplicated alpha-globin genes in macaques originally from Malaysia and Indonesia were 0.432 and 0.275, respectively, while no triplication was found in individuals from either the Philippines or northern and central Thailand. Quadruplicated alpha-globin genes were also observed, at frequencies of 0.045 (Malaysia), 0.075 (Indonesia), and 0.021 (the Philippines). A single locus was detected in only one of 40 chromosomes from Indonesia (frequency 0.025).

Matched MeSH terms: Globins/genetics*
A case of beta-thalassemia with a C----T substitution at position 654 of the second intervening sequence of the beta-globin gene

Jo T, Momita S, Sadamori N, Tomonaga M, Fucharoem S, Fukumaki Y, et al.

Intern. Med., 1992 Feb;31(2):269-72.
PMID: 1600278

A 26-year-old Chinese-Malaysian female patient with beta-thalassemia is presented. The main hematological values found in this patient were as follows: 1) normocytic hypochromic anemia (RBC 444 x 10(4)/microliters, Hb 11.8 g/dl) with marked anisopoikilocytosis, 2) erythroid hyperplasia, and 3) increased HbF (HbA 41.4%, HbA2 2.9%, HbF 48.9%). DNA obtained from peripheral leukocytes was analyzed using dot blot hybridization of the polymerase chain reaction (PCR)-amplified DNA with allele-specific oligonucleotide probes. A C----T substitution at position 654 of the second intervening sequence (IVS-2) was detected in her beta-globin clone.

Matched MeSH terms: Globins/genetics*
Multiplexed genotyping of beta globin mutations with MALDI-TOF mass spectrometry

Looi ML, Sivalingam M, Husin ND, Radin FZ, Isa RM, Zakaria SZ, et al.

Clin Chim Acta, 2011 May 12;412(11-12):999-1002.
PMID: 21315703 DOI: 10.1016/j.cca.2011.02.006

BACKGROUND: Beta thalassemia represents a great heterogeneity as over 300 mutations have been identified and each population at-risk has its own spectrum of mutations. Molecular characterization with high accuracy, sensitivity and economics is required for population screening and genetic counseling.
METHODS: We used the MALDI-TOF mass spectrometry (MS) platform to develop novel multiplex assays for comprehensive detection of 27 mutations in beta-thalassemia patients. Six multiplex assays were designed to detect 13 common known ß-mutations, namely CD41/42, CD71/72, IVS1-5, IVS1-1, CD26, IVS2-654, CAP+1, CD19, -28, -29, IVS1-2, InCD (T-G) and CD17; and 14 rare ß-mutations, i.e. InCD (A-C), CD8/9, CD43, -86, CD15, Poly A, Poly T/C, IVS2-1, CD1, CD35/36, CD27/28, CD16, CD37, and 619bpDEL in 165 samples. We compared the efficiencies of genotyping by MS and Amplification Refractory Mutation System (ARMS). Discrepant results were confirmed by sequencing analysis.
RESULTS: A total of 88.7% (260/293 allele) of MS and ARMS results was in agreement. More than fifty percent of the discrepant result was due to the false interpretation of ARMS results. Failed CD19 assay by MS method might be due to the assay design. The MS method detected 5 rare ß-mutations (CD15, CD35/36, CD8/9, Poly A and Poly T/C) presented in 13 alleles, which were not included in the ARMS screening panel.
CONCLUSION: We revealed that the MS method is a sensitive, high-throughput, highly automated, flexible, and cost-effective alternative to conventional ß-thalassemia genotyping methods.

Matched MeSH terms: beta-Globins/genetics*
Prevalence and Distribution of Major β-Thalassemia Mutations and HbE/β-Thalassemia Variant in Nepalese Ethnic Groups

Lama R, Yusof W, Shrestha TR, Hanafi S, Bhattarai M, Hassan R, et al.

Hematol Oncol Stem Cell Ther, 2022 Mar 01;15(1):279-284.
PMID: 33592169 DOI: 10.1016/j.hemonc.2021.01.004

BACKGROUND: Beta-thalassemia is a genetic disorder that is inherited in an autosomal recessive pattern. This genetic disease leads to a defective beta-globin hemoglobin chain causing partial or complete beta-globin chain synthesis loss. Beta-thalassemia major patients need a continuous blood transfusion and iron chelation to maintain the normal homeostasis of red blood cells (RBCs) and other systems in the body. Patients also require treatment procedures that are costly and tedious, resulting in a serious health burden for developing nations such as Nepal.
METHODS: A total of 61 individuals clinically diagnosed to have thalassemia were genotyped with multiplex amplification refractory mutation system-polymerase chain reaction (ARMS-PCR). Twenty-one major mutations were investigated using allele-specific primers grouped into six different panels.
RESULTS: The most common mutations found (23%) were IVS 1-5 (G-C) and Cd 26 (G-A) (HbE), followed by 619 deletion, Cd 8/9 (+G), Cd 16 (-C), Cd 41/42 (-TTCT), IVS 1-1 (G-T), Cd 19 (A-G), and Cd 17 (A-T) at 20%, 12%, 8%, 6%, 4%, 3%, and 1%, respectively.
CONCLUSION: The results of this study revealed that Nepal's mutational profile is comparable to that of its neighboring countries, such as India and Myanmar. This study also showed that thalassemia could be detected across 17 Nepal's ethnic groups, especially those whose ancestors originated from India and Central Asia.

Matched MeSH terms: beta-Globins/genetics
Fulltext Molecular characterization of α- and β-thalassaemia among Malay patients

Yatim NF, Rahim MA, Menon K, Al-Hassan FM, Ahmad R, Manocha AB, et al.

Int J Mol Sci, 2014 May 19;15(5):8835-45.
PMID: 24857915 DOI: 10.3390/ijms15058835

Both α- and β-thalassaemia syndromes are public health problems in the multi-ethnic population of Malaysia. To molecularly characterise the α- and β-thalassaemia deletions and mutations among Malays from Penang, Gap-PCR and multiplexed amplification refractory mutation systems were used to study 13 α-thalassaemia determinants and 20 β-thalassaemia mutations in 28 and 40 unrelated Malays, respectively. Four α-thalassaemia deletions and mutations were demonstrated. --SEA deletion and αCSα accounted for more than 70% of the α-thalassaemia alleles. Out of the 20 β-thalassaemia alleles studied, nine different β-thalassaemia mutations were identified of which βE accounted for more than 40%. We concluded that the highest prevalence of (α- and β-thalassaemia alleles in the Malays from Penang are --SEA deletion and βE mutation, respectively.

Matched MeSH terms: alpha-Globins/genetics

Filters

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links