Displaying publications 1 - 20 of 99 in total

Abstract:
Sort:
  1. Halim-Fikri H, Etemad A, Abdul Latif AZ, Merican AF, Baig AA, Annuar AA, et al.
    BMC Res Notes, 2015;8:176.
    PMID: 25925844 DOI: 10.1186/s13104-015-1123-y
    The Malaysian Node of the Human Variome Project (MyHVP) is one of the eighteen official Human Variome Project (HVP) country-specific nodes. Since its inception in 9(th) October 2010, MyHVP has attracted the significant number of Malaysian clinicians and researchers to participate and contribute their data to this project. MyHVP also act as the center of coordination for genotypic and phenotypic variation studies of the Malaysian population. A specialized database was developed to store and manage the data based on genetic variations which also associated with health and disease of Malaysian ethnic groups. This ethnic-specific database is called the Malaysian Node of the Human Variome Project database (MyHVPDb).
    Matched MeSH terms: Ethnic Groups/genetics*
  2. NurWaliyuddin HZ, Edinur HA, Norazmi MN, Sundararajulu P, Chambers GK, Zafarina Z
    Int. J. Immunogenet., 2014 Dec;41(6):472-9.
    PMID: 25367623 DOI: 10.1111/iji.12161
    The KIR system shows variation at both gene content and allelic level across individual genome and populations. This variation reflects its role in immunity and has become a significant tool for population comparisons. In this study, we investigate KIR gene content in 120 unrelated individuals from the four Malay subethnic groups (Kelantan, Jawa, Banjar and Pattani Malays). Genotyping using commercial polymerase chain reaction-sequence-specific primer (PCR-SSP) kits revealed a total of 34 different KIR genotypes; 17 for Kelantan, 15 for Banjar, 14 for Jawa and 13 for Pattani Malays. Two new variants observed in Banjar Malays have not previously been reported. Genotype AA and haplotype A were the most common in Jawa (0.47 and 0.65, respectively), Banjar (0.37 and 0.52, respectively) and Pattani (0.40 and 0.60, respectively) Malays. In contrast, Kelantan Malays were observed to have slightly higher frequency (0.43) of genotype BB as compared with the others. Based on the KIR genes distribution, Jawa, Pattani and Banjar subethnic groups showed greater similarity and are discrete from Kelantan Malays. A principal component plot carried out using KIR gene carrier frequency shows that the four Malay subethnic groups are clustered together with other South-East Asian populations. Overall, our observation on prevalence of KIR gene content demonstrates genetic affinities between the four Malay subethnic groups and supports the common origins of the Austronesian-speaking people.
    Matched MeSH terms: Ethnic Groups/genetics*
  3. Loo KW, Gan SH
    Gene, 2014 Jul 15;545(1):1-4.
    PMID: 24815047 DOI: 10.1016/j.gene.2014.05.016
    The Kelantanese Malays who resided in the remote northeastern regions of the Malay Peninsula in the Kelantan state are believed to have a unique genetic signature. The objective of this review is to analyze the populational sub-structure of the Kelantanese Malays from historical, genetic and linguistic perspectives. Historical data suggest that the Semang were composed of the Jahai, Bateq and Kensiu sub-tribes, whereas the Senoi were composed of only the Temiar sub-tribe. The Mendriq sub-tribe is believed to be the first group of aborigines to land in Kelantan. Subsequently, genetic analysis showed that the Kelantanese Malays are an independent clade at the base of the phylogenetic tree and contain genetic material similar to that of the Semang, specifically the Jahai and the Kensiu sub-tribes. The genetic data are supported by the fact that the Aslian language, a branch of the Austroasiatic languages that is widely spoken by the Semang, was potentially transmitted through agricultural activities. However, the potential limitation of this mini-review is the lack of primary reliable sources covering the historical, linguistic and genetic features of the Kelantanese Malays.
    Matched MeSH terms: Ethnic Groups/genetics*
  4. Teh LK, George E, Lai MI, Tan JA, Wong L, Ismail P
    J Hum Genet, 2014 Mar;59(3):119-23.
    PMID: 24369358 DOI: 10.1038/jhg.2013.131
    Beta-thalassemia is one of the most prevalent inherited diseases and a public health problem in Malaysia. Malaysia is geographically divided into West and East Malaysia. In Sabah, a state in East Malaysia, there are over 1000 estimated cases of β-thalassemia major patients. Accurate population frequency data of the molecular basis of β-thalassemia major are needed for planning its control in the high-risk population of Sabah. Characterization of β-globin gene defects was done in 252 transfusion dependent β-thalassemia patients incorporating few PCR techniques. The study demonstrates that β-thalassemia mutations inherited are ethnically dependent. It is important to note that 86.9% of transfusion-dependent β-thalassemia major patients in Sabah were of the indigenous population and homozygous for a single mutation. The Filipino β(0)-deletion was a unique mutation found in the indigenous population of Sabah. Mutations common in West Malaysia were found in 11 (4.3%) patients. Four rare mutations (Hb Monroe, CD 8/9, CD 123/124/125 and IVS I-2) were also found. This study is informative on the population genetics of β-thalassemia major in Sabah.
    Matched MeSH terms: Ethnic Groups/genetics
  5. Laitman Y, Feng BJ, Zamir IM, Weitzel JN, Duncan P, Port D, et al.
    Eur J Hum Genet, 2013 Feb;21(2):212-6.
    PMID: 22763381 DOI: 10.1038/ejhg.2012.124
    The 185delAG* BRCA1 mutation is encountered primarily in Jewish Ashkenazi and Iraqi individuals, and sporadically in non-Jews. Previous studies estimated that this is a founder mutation in Jewish mutation carriers that arose before the dispersion of Jews in the Diaspora ~2500 years ago. The aim of this study was to assess the haplotype in ethnically diverse 185delAG* BRCA1 mutation carriers, and to estimate the age at which the mutation arose. Ethnically diverse Jewish and non-Jewish 185delAG*BRCA1 mutation carriers and their relatives were genotyped using 15 microsatellite markers and three SNPs spanning 12.5 MB, encompassing the BRCA1 gene locus. Estimation of mutation age was based on a subset of 11 markers spanning a region of ~5 MB, using a previously developed algorithm applying the maximum likelihood method. Overall, 188 participants (154 carriers and 34 noncarriers) from 115 families were included: Ashkenazi, Iraq, Kuchin-Indians, Syria, Turkey, Iran, Tunisia, Bulgaria, non-Jewish English, non-Jewish Malaysian, and Hispanics. Haplotype analysis indicated that the 185delAG mutation arose 750-1500 years ago. In Ashkenazim, it is a founder mutation that arose 61 generations ago, and with a small group of founder mutations was introduced into the Hispanic population (conversos) ~650 years ago, and into the Iraqi-Jewish community ~450 years ago. The 185delAG mutation in the non-Jewish populations in Malaysia and the UK arose at least twice independently. We conclude that the 185delAG* BRCA1 mutation resides on a common haplotype among Ashkenazi Jews, and arose about 61 generations ago and arose independently at least twice in non-Jews.
    Matched MeSH terms: Ethnic Groups/genetics
  6. Suadi Z, Siew LC, Tie R, Hui WB, Asam A, Thiew SH, et al.
    J Forensic Sci, 2007 Jan;52(1):231-4.
    PMID: 17209948
    Matched MeSH terms: Ethnic Groups/genetics*
  7. Langmia IM, Apalasamy YD, Suki SZ, Omar SZ, Mohamed Z
    J Perinatol, 2015 Sep;35(9):700-4.
    PMID: 26110499 DOI: 10.1038/jp.2015.68
    Preterm birth (PTB) is a multifactorial complication in which genetic and environmental factors contribute to the phenotype. The AKAP10 protein encoded by AKAP10 gene has a vital role in the maintenance of myometrial quiescence and pregnancy. This study aimed to investigate whether polymorphisms in the AKAP10 gene are associated with the risk of PTB.
    Matched MeSH terms: Ethnic Groups/genetics
  8. Dharap AS, Tanuseputro H
    Anthropol Anz, 1997 Mar;55(1):63-8.
    PMID: 9161682
    The interalar width of the nose and the intercanine distance were measured in 266 Malay subjects (111 males and 155 females) randomly selected from the students of the School of Medical Sciences. University Sains Malaysia in Kota Bharu, Malaysia. The mean interalar width of the nose in male subjects was 39.8 +/- 2.3 mm (range 34-45 mm) and in female subjects 36.2 mm +/- 2.2 mm (range 30-41 mm). There is a statistically significant difference (t = 12.9: p < 0.05) in the nasal width between male and female Malay subjects. This agrees with the findings of other similar studies that males have wider noses than females. The mean maxillary intercanine distance in male subjects was 36.7 = 2.6 mm (range 30-42 mm) and in female subjects 36.2 = 2.3 mm (range 30-42 mm). The anterior maxillary arch is significantly wider in Malay subjects compared to Chinese from Singapore (Keng 1986) as p < 0.05 and to Caucasians (Sawiris 1977) as p < 0.05. There is a significant correlation (r = 0.312; p < 0.05) between the nasal width and the intercanine distance in female subjects but not in male subjects.
    Matched MeSH terms: Ethnic Groups/genetics*
  9. Yahya P, Sulong S, Harun A, Wan Isa H, Ab Rajab NS, Wangkumhang P, et al.
    Forensic Sci Int Genet, 2017 09;30:152-159.
    PMID: 28743033 DOI: 10.1016/j.fsigen.2017.07.005
    Malay, the main ethnic group in Peninsular Malaysia, is represented by various sub-ethnic groups such as Melayu Banjar, Melayu Bugis, Melayu Champa, Melayu Java, Melayu Kedah Melayu Kelantan, Melayu Minang and Melayu Patani. Using data retrieved from the MyHVP (Malaysian Human Variome Project) database, a total of 135 individuals from these sub-ethnic groups were profiled using the Affymetrix GeneChip Mapping Xba 50-K single nucleotide polymorphism (SNP) array to identify SNPs that were ancestry-informative markers (AIMs) for Malays of Peninsular Malaysia. Prior to selecting the AIMs, the genetic structure of Malays was explored with reference to 11 other populations obtained from the Pan-Asian SNP Consortium database using principal component analysis (PCA) and ADMIXTURE. Iterative pruning principal component analysis (ipPCA) was further used to identify sub-groups of Malays. Subsequently, we constructed an AIMs panel for Malays using the informativeness for assignment (In) of genetic markers, and the K-nearest neighbor classifier (KNN) was used to teach the classification models. A model of 250 SNPs ranked by In, correctly classified Malay individuals with an accuracy of up to 90%. The identified panel of SNPs could be utilized as a panel of AIMs to ascertain the specific ancestry of Malays, which may be useful in disease association studies, biomedical research or forensic investigation purposes.
    Matched MeSH terms: Ethnic Groups/genetics*
  10. Matsuoka H, Wang J, Hirai M, Arai M, Yoshida S, Kobayashi T, et al.
    J Hum Genet, 2004;49(10):544-547.
    PMID: 15349799 DOI: 10.1007/s10038-004-0187-7
    We conducted a survey of malaria diagnoses and treatments in remote areas of Myanmar. Blood specimens from more than 1,000 people were collected by the finger-prick method, and 121 (11%) of these people were found to be glucose-6-phosphate dehydrogenase (G6PD) deficient. Of these 121, 50 consented to analysis of the G6PD genome. We read the G6PD sequences of these subjects and found 45 cases of G6PD Mahidol (487G>A), two of G6PD Coimbra (592C>T), two of G6PD Union (1360C>T), and one of G6PD Canton (1376G>T). Taken together with data from our previous report, 91.3% (73/80) of G6PD variants were G6PD Mahidol. This finding suggests that the Myanmar population is derived from homogeneous ancestries and are different from Thai, Malaysian, and Indonesian populations.
    Matched MeSH terms: Ethnic Groups/genetics
  11. Kee BP, Chua KH, Lee PC, Lian LH
    Ann Hum Biol, 2012 Nov-Dec;39(6):505-10.
    PMID: 22989108 DOI: 10.3109/03014460.2012.719548
    The present study is the first to report the genetic relatedness of indigenous populations of Sabah, Malaysia, using a set of Indel markers (HS4.32, TPA25, APO, PV92, B65 and HS3.23). The primary aim was to assess the genetic relationships among these populations and with populations from other parts of the world by examining the distribution of these markers.
    Matched MeSH terms: Ethnic Groups/genetics*
  12. Huynh-Le MP, Fan CC, Karunamuni R, Thompson WK, Martinez ME, Eeles RA, et al.
    Nat Commun, 2021 02 23;12(1):1236.
    PMID: 33623038 DOI: 10.1038/s41467-021-21287-0
    Genetic models for cancer have been evaluated using almost exclusively European data, which could exacerbate health disparities. A polygenic hazard score (PHS1) is associated with age at prostate cancer diagnosis and improves screening accuracy in Europeans. Here, we evaluate performance of PHS2 (PHS1, adapted for OncoArray) in a multi-ethnic dataset of 80,491 men (49,916 cases, 30,575 controls). PHS2 is associated with age at diagnosis of any and aggressive (Gleason score ≥ 7, stage T3-T4, PSA ≥ 10 ng/mL, or nodal/distant metastasis) cancer and prostate-cancer-specific death. Associations with cancer are significant within European (n = 71,856), Asian (n = 2,382), and African (n = 6,253) genetic ancestries (p ethnic dataset.
    Matched MeSH terms: Ethnic Groups/genetics*
  13. Yew CW, Hoque MZ, Pugh-Kitingan J, Minsong A, Voo CLY, Ransangan J, et al.
    Ann. Hum. Genet., 2018 07;82(4):216-226.
    PMID: 29521412 DOI: 10.1111/ahg.12246
    The region of northern Borneo is home to the current state of Sabah, Malaysia. It is located closest to the southern Philippine islands and may have served as a viaduct for ancient human migration onto or off of Borneo Island. In this study, five indigenous ethnic groups from Sabah were subjected to genome-wide SNP genotyping. These individuals represent the "North Borneo"-speaking group of the great Austronesian family. They have traditionally resided in the inland region of Sabah. The dataset was merged with public datasets, and the genetic relatedness of these groups to neighboring populations from the islands of Southeast Asia, mainland Southeast Asia and southern China was inferred. Genetic structure analysis revealed that these groups formed a genetic cluster that was independent of the clusters of neighboring populations. Additionally, these groups exhibited near-absolute proportions of a genetic component that is also common among Austronesians from Taiwan and the Philippines. They showed no genetic admixture with Austro-Melanesian populations. Furthermore, phylogenetic analysis showed that they are closely related to non-Austro-Melansian Filipinos as well as to Taiwan natives but are distantly related to populations from mainland Southeast Asia. Relatively lower heterozygosity and higher pairwise genetic differentiation index (FST ) values than those of nearby populations indicate that these groups might have experienced genetic drift in the past, resulting in their differentiation from other Austronesians. Subsequent formal testing suggested that these populations have received no gene flow from neighboring populations. Taken together, these results imply that the indigenous ethnic groups of northern Borneo shared a common ancestor with Taiwan natives and non-Austro-Melanesian Filipinos and then isolated themselves on the inland of Sabah. This isolation presumably led to no admixture with other populations, and these individuals therefore underwent strong genetic differentiation. This report contributes to addressing the paucity of genetic data on representatives from this strategic region of ancient human migration event(s).
    Matched MeSH terms: Ethnic Groups/genetics*
  14. Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
    Matched MeSH terms: Ethnic Groups/genetics
  15. Hatin WI, Nur-Shafawati AR, Zahri MK, Xu S, Jin L, Tan SG, et al.
    PLoS One, 2011;6(4):e18312.
    PMID: 21483678 DOI: 10.1371/journal.pone.0018312
    Patterns of modern human population structure are helpful in understanding the history of human migration and admixture. We conducted a study on genetic structure of the Malay population in Malaysia, using 54,794 genome-wide single nucleotide polymorphism genotype data generated in four Malay sub-ethnic groups in peninsular Malaysia (Melayu Kelantan, Melayu Minang, Melayu Jawa and Melayu Bugis). To the best of our knowledge this is the first study conducted on these four Malay sub-ethnic groups and the analysis of genotype data of these four groups were compiled together with 11 other populations' genotype data from Indonesia, China, India, Africa and indigenous populations in Peninsular Malaysia obtained from the Pan-Asian SNP database. The phylogeny of populations showed that all of the four Malay sub-ethnic groups are separated into at least three different clusters. The Melayu Jawa, Melayu Bugis and Melayu Minang have a very close genetic relationship with Indonesian populations indicating a common ancestral history, while the Melayu Kelantan formed a distinct group on the tree indicating that they are genetically different from the other Malay sub-ethnic groups. We have detected genetic structuring among the Malay populations and this could possibly be accounted for by their different historical origins. Our results provide information of the genetic differentiation between these populations and a valuable insight into the origins of the Malay sub-ethnic groups in Peninsular Malaysia.
    Matched MeSH terms: Ethnic Groups/genetics*
  16. Lee YC, Chan SH, Ren EC
    Immunogenetics, 2008 Nov;60(11):645-54.
    PMID: 18668235 DOI: 10.1007/s00251-008-0321-3
    Killer cell immunoglobulin-like receptors (KIR) gene frequencies have been shown to be distinctly different between populations and contribute to functional variation in the immune response. We have investigated KIR gene frequencies in 370 individuals representing three Asian populations in Singapore and report here the distribution of 14 KIR genes (2DL1, 2DL2, 2DL3, 2DL4, 2DL5, 2DS1, 2DS2, 2DS3, 2DS4, 2DS5, 3DL1, 3DL2, 3DL3, 3DS1) with two pseudogenes (2DP1, 3DP1) among Singapore Chinese (n = 210); Singapore Malay (n = 80), and Singapore Indian (n = 80). Four framework genes (KIR3DL3, 3DP1, 2DL4, 3DL2) and a nonframework pseudogene 2DP1 were detected in all samples while KIR2DS2, 2DL2, 2DL5, and 2DS5 had the greatest significant variation across the three populations. Fifteen significant linkage patterns, consistent with associations between genes of A and B haplotypes, were observed. Eighty-four distinct KIR profiles were determined in our populations, 38 of which had not been described in other populations. KIR haplotype studies were performed using nine Singapore Chinese families comprising 34 individuals. All genotypes could be resolved into corresponding pairs of existing haplotypes with eight distinct KIR genotypes and eight different haplotypes. The haplotype A2 with frequency of 63.9% was dominant in Singapore Chinese, comparable to that reported in Korean and Chinese Han. The A haplotypes predominate in Singapore Chinese, with ratio of A to B haplotypes of approximately 3:1. Comparison with KIR frequencies in other populations showed that Singapore Chinese shared similar distributions with Chinese Han, Japanese, and Korean; Singapore Indian was found to be comparable with North Indian Hindus while Singapore Malay resembled the Thai.
    Matched MeSH terms: Ethnic Groups/genetics*
  17. Yong RY, Gan LS, Coble MD, Yap EP
    Leg Med (Tokyo), 2007 Sep;9(5):278-81.
    PMID: 17467323
    MiniSTR loci has demonstrated to be an effective approach to recover genetic information from degraded sample, due to the improved PCR efficiency of their reduced PCR amplicon sizes. This study constructed a partial miniSGM panel and investigated the performance of four miniSTR loci, D2S1338, D16S539, D18S51 and FGA, in three ethnic populations residing in Singapore. The suitability of the miniSTR primers for Singapore populations was assessed for loci D16S539, D18S51 and FGA.
    Matched MeSH terms: Ethnic Groups/genetics*
  18. Tuladhar BS, Haslindawaty N, Nada B, Panneerchelvam S, Norazmi MN
    J Forensic Sci, 2006 Sep;51(5):1205-6.
    PMID: 17018114
    Matched MeSH terms: Ethnic Groups/genetics
  19. Chang YM, Perumal R, Keat PY, Kuehn DL
    Forensic Sci Int, 2007 Mar 22;167(1):70-6.
    PMID: 16457976
    We have analyzed 16 Y-STR loci (DYS456, DYS389I, DYS390, DYS389II, DYS458, DYS19, DYS385a/b, DYS393, DYS391, DYS439, DYS635 or Y-GATA C4, DYS392, Y-GATA H4, DYS437, DYS438 and DYS448) from the non-recombining region of the human Y-chromosome in 980 male individuals from three main ethnic populations in Malaysia (Malay, Chinese, Indian) using the AmpFlSTR((R)) Y-filertrade mark (Applied Biosystems, Foster City, CA). The observed 17-loci haplotypes and the individual allele frequencies for each locus were estimated, whilst the locus diversity, haplotype diversity and discrimination capacity were calculated in the three ethnic populations. Analysis of molecular variance indicated that 88.7% of the haplotypic variation is found within population and 11.3% is between populations (fixation index F(ST)=0.113, p=0.000). This study has revealed Y-chromosomes with null alleles at several Y-loci, namely DYS458, DYS392, DYS389I, DYS389II, DYS439, DYS448 and Y-GATA H4; and several occurrences of duplications at the highly polymorphic DYS385 loci. Some of these deleted loci were in regions of the Y(q) arm that have been implicated in the occurrence of male infertility.
    Matched MeSH terms: Ethnic Groups/genetics*
  20. Panneerchelvam S, Kumara KT, KokFai L, Saravanakumar M, Sumathy V, Yuvaneswari KC, et al.
    J Forensic Sci, 2004 Sep;49(5):1132-3.
    PMID: 15461127
    Matched MeSH terms: Ethnic Groups/genetics*
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links