Displaying publications 1 - 20 of 250 in total

Abstract:
Sort:
  1. Fulltext High-density genotyping of immune-related loci identifies new SLE risk variants in individuals with Asian ancestry
    Sun C, Molineros JE, Looger LL, Zhou XJ, Kim K, Okada Y, et al.
    Nat Genet, 2016 Mar;48(3):323-30.
    PMID: 26808113 DOI: 10.1038/ng.3496
    Systemic lupus erythematosus (SLE) has a strong but incompletely understood genetic architecture. We conducted an association study with replication in 4,478 SLE cases and 12,656 controls from six East Asian cohorts to identify new SLE susceptibility loci and better localize known loci. We identified ten new loci and confirmed 20 known loci with genome-wide significance. Among the new loci, the most significant locus was GTF2IRD1-GTF2I at 7q11.23 (rs73366469, Pmeta = 3.75 × 10(-117), odds ratio (OR) = 2.38), followed by DEF6, IL12B, TCF7, TERT, CD226, PCNXL3, RASGRP1, SYNGR1 and SIGLEC6. We identified the most likely functional variants at each locus by analyzing epigenetic marks and gene expression data. Ten candidate variants are known to alter gene expression in cis or in trans. Enrichment analysis highlights the importance of these loci in B cell and T cell biology. The new loci, together with previously known loci, increase the explained heritability of SLE to 24%. The new loci share functional and ontological characteristics with previously reported loci and are possible drug targets for SLE therapeutics.
  2. Fulltext Amino acid signatures of HLA Class-I and II molecules are strongly associated with SLE susceptibility and autoantibody production in Eastern Asians
    Molineros JE, Looger LL, Kim K, Okada Y, Terao C, Sun C, et al.
    PLoS Genet, 2019 04;15(4):e1008092.
    PMID: 31022184 DOI: 10.1371/journal.pgen.1008092
    Human leukocyte antigen (HLA) is a key genetic factor conferring risk of systemic lupus erythematosus (SLE), but precise independent localization of HLA effects is extremely challenging. As a result, the contribution of specific HLA alleles and amino-acid residues to the overall risk of SLE and to risk of specific autoantibodies are far from completely understood. Here, we dissected (a) overall SLE association signals across HLA, (b) HLA-peptide interaction, and (c) residue-autoantibody association. Classical alleles, SNPs, and amino-acid residues of eight HLA genes were imputed across 4,915 SLE cases and 13,513 controls from Eastern Asia. We performed association followed by conditional analysis across HLA, assessing both overall SLE risk and risk of autoantibody production. DR15 alleles HLA-DRB1*15:01 (P = 1.4x10-27, odds ratio (OR) = 1.57) and HLA-DQB1*06:02 (P = 7.4x10-23, OR = 1.55) formed the most significant haplotype (OR = 2.33). Conditioned protein-residue signals were stronger than allele signals and mapped predominantly to HLA-DRB1 residue 13 (P = 2.2x10-75) and its proxy position 11 (P = 1.1x10-67), followed by HLA-DRB1-37 (P = 4.5x10-24). After conditioning on HLA-DRB1, novel associations at HLA-A-70 (P = 1.4x10-8), HLA-DPB1-35 (P = 9.0x10-16), HLA-DQB1-37 (P = 2.7x10-14), and HLA-B-9 (P = 6.5x10-15) emerged. Together, these seven residues increased the proportion of explained heritability due to HLA to 2.6%. Risk residues for both overall disease and hallmark autoantibodies (i.e., nRNP: DRB1-11, P = 2.0x10-14; DRB1-13, P = 2.9x10-13; DRB1-30, P = 3.9x10-14) localized to the peptide-binding groove of HLA-DRB1. Enrichment for specific amino-acid characteristics in the peptide-binding groove correlated with overall SLE risk and with autoantibody presence. Risk residues were in primarily negatively charged side-chains, in contrast with rheumatoid arthritis. We identified novel SLE signals in HLA Class I loci (HLA-A, HLA-B), and localized primary Class II signals to five residues in HLA-DRB1, HLA-DPB1, and HLA-DQB1. These findings provide insights about the mechanisms by which the risk residues interact with each other to produce autoantibodies and are involved in SLE pathophysiology.
  3. Fulltext Gut microbiome of helminth-infected indigenous Malaysians is context dependent
    Tee MZ, Er YX, Easton AV, Yap NJ, Lee IL, Devlin J, et al.
    Microbiome, 2022 Dec 07;10(1):214.
    PMID: 36476263 DOI: 10.1186/s40168-022-01385-x
    BACKGROUND: While microbiomes in industrialized societies are well characterized, indigenous populations with traditional lifestyles have microbiomes that are more akin to those of ancient humans. However, metagenomic data in these populations remains scarce, and the association with soil-transmitted helminth infection status is unclear. Here, we sequenced 650 metagenomes of indigenous Malaysians from five villages with different prevalence of helminth infections.

    RESULTS: Individuals from villages with higher prevalences of helminth infections have more unmapped reads and greater microbial diversity. Microbial community diversity and composition were most strongly associated with different villages and the effects of helminth infection status on the microbiome varies by village. Longitudinal changes in the microbiome in response to albendazole anthelmintic treatment were observed in both helminth infected and uninfected individuals. Inference of bacterial population replication rates from origin of replication analysis identified specific replicating taxa associated with helminth infection.

    CONCLUSIONS: Our results indicate that helminth effects on the microbiota were highly dependent on context, and effects of albendazole on the microbiota can be confounding for the interpretation of deworming studies. Furthermore, a substantial quantity of the microbiome remains unannotated, and this large dataset from an indigenous population associated with helminth infections is a valuable resource for future studies. Video Abstract.

  4. Fulltext In situ normoxia enhances survival and proliferation rate of human adipose tissue-derived stromal cells without increasing the risk of tumourigenesis
    Choi JR, Pingguan-Murphy B, Wan Abas WA, Yong KW, Poon CT, Noor Azmi MA, et al.
    PLoS One, 2015;10(1):e0115034.
    PMID: 25615717 DOI: 10.1371/journal.pone.0115034
    Adipose tissue-derived stromal cells (ASCs) natively reside in a relatively low-oxygen tension (i.e., hypoxic) microenvironment in human body. Low oxygen tension (i.e., in situ normoxia), has been known to enhance the growth and survival rate of ASCs, which, however, may lead to the risk of tumourigenesis. Here, we investigated the tumourigenic potential of ASCs under their physiological condition to ensure their safe use in regenerative therapy. Human ASCs isolated from subcutaneous fat were cultured in atmospheric O2 concentration (21% O2) or in situ normoxia (2% O2). We found that ASCs retained their surface markers, tri-lineage differentiation potential, and self-renewal properties under in situ normoxia without altering their morphology. In situ normoxia displayed a higher proliferation and viability of ASCs with less DNA damage as compared to atmospheric O2 concentration. Moreover, low oxygen tension significantly up-regulated VEGF and bFGF mRNA expression and protein secretion while reducing the expression level of tumour suppressor genes p16, p21, p53, and pRb. However, there were no significant differences in ASCs telomere length and their relative telomerase activity when cultured at different oxygen concentrations. Collectively, even with high proliferation and survival rate, ASCs have a low tendency of developing tumour under in situ normoxia. These results suggest 2% O2 as an ideal culture condition for expanding ASCs efficiently while maintaining their characteristics.
  5. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations
    Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
  6. Gastrointestinal parasites in rural dogs and cats in Selangor and Pahang states in Peninsular Malaysia
    Ngui R, Lee SC, Yap NJ, Tan TK, Aidil RM, Chua KH, et al.
    Acta Parasitol, 2014 Oct;59(4):737-44.
    PMID: 25236287 DOI: 10.2478/s11686-014-0306-3
    To estimate the current prevalence of gastrointestinal (GI) parasites in dogs and cats, a total of 105 fresh faecal samples were collected from rural areas in Peninsular Malaysia. Each faecal sample was examined for the presence of GI parasites by microscopic examination after formalin-ether concentration technique and for protozoa, trichrome and Ziehl-Neelsen staining were employed. The overall prevalence of GI parasitic infection was 88.6% (95% CI = 82.5-94.7) in which 88.3% of dogs and 89.3% of cats were infected with at least one parasites species, respectively. There were 14 different GI parasites species (nematodes, cestodes and protozoa) detected, including Ancylostoma spp. (62.9%), Toxocara spp. (32.4%), Trichuris vulpis (21.0%), Spirometra spp. (9.5%), Toxascaris leonina (5.7%), Dipylidium caninum (4.8%), Ascaris spp. (2.9%), Hymenolepis diminuta (1.0%) and others. General prevalence of GI parasites showed a significant difference between helminth (84.4%) and protozoa (34.3%) infections. Monoparasitism (38.1%) was less frequent than polyparasitism (46.7%). As several of these GI parasites are recognized as zoonotic agents, the results of this investigation revealed that local populations may be exposed to a broad spectrum of zoonotic agents by means of environmental contamination with dogs and cats faeces and this information should be used to mitigate public health risks. Prevention and control measures have to be taken in order to reduce the prevalence rates especially in socioeconomically disadvantaged communities where animals live in close proximity to people, poor levels of hygiene and overcrowding together with a lack in veterinary attention and zoonotic awareness.
  7. Fulltext Helminth colonization is associated with increased diversity of the gut microbiota
    Lee SC, Tang MS, Lim YA, Choy SH, Kurtz ZD, Cox LM, et al.
    PLoS Negl Trop Dis, 2014 May;8(5):e2880.
    PMID: 24851867 DOI: 10.1371/journal.pntd.0002880
    Soil-transmitted helminths colonize more than 1.5 billion people worldwide, yet little is known about how they interact with bacterial communities in the gut microbiota. Differences in the gut microbiota between individuals living in developed and developing countries may be partly due to the presence of helminths, since they predominantly infect individuals from developing countries, such as the indigenous communities in Malaysia we examine in this work. We compared the composition and diversity of bacterial communities from the fecal microbiota of 51 people from two villages in Malaysia, of which 36 (70.6%) were infected by helminths. The 16S rRNA V4 region was sequenced at an average of nineteen thousand sequences per samples. Helminth-colonized individuals had greater species richness and number of observed OTUs with enrichment of Paraprevotellaceae, especially with Trichuris infection. We developed a new approach of combining centered log-ratio (clr) transformation for OTU relative abundances with sparse Partial Least Squares Discriminant Analysis (sPLS-DA) to enable more robust predictions of OTU interrelationships. These results suggest that helminths may have an impact on the diversity, bacterial community structure and function of the gut microbiota.
  8. Fulltext Combined protein- and nucleic acid-level effects of rs1143679 (R77H), a lupus-predisposing variant within ITGAM
    Maiti AK, Kim-Howard X, Motghare P, Pradhan V, Chua KH, Sun C, et al.
    Hum Mol Genet, 2014 Aug 1;23(15):4161-76.
    PMID: 24608226 DOI: 10.1093/hmg/ddu106
    Integrin alpha M (ITGAM; CD11b) is a component of the macrophage-1 antigen complex, which mediates leukocyte adhesion, migration and phagocytosis as part of the immune system. We previously identified a missense polymorphism, rs1143679 (R77H), strongly associated with systemic lupus erythematosus (SLE). However, the molecular mechanisms of this variant are incompletely understood. A meta-analysis of published and novel data on 28 439 individuals with European, African, Hispanic and Asian ancestries reinforces genetic association between rs1143679 and SLE [Pmeta = 3.60 × 10(-90), odds ratio (OR) = 1.76]. Since rs1143679 is in the most active region of chromatin regulation and transcription factor binding in ITGAM, we quantitated ITGAM RNA and surface protein levels in monocytes from patients with each rs1143679 genotype. We observed that transcript levels significantly decreased for the risk allele ('A') relative to the non-risk allele ('G'), in a dose-dependent fashion: ('AA' < 'AG' < 'GG'). CD11b protein levels in patients' monocytes were directly correlated with RNA levels. Strikingly, heterozygous individuals express much lower (average 10- to 15-fold reduction) amounts of the 'A' transcript than 'G' transcript. We found that the non-risk sequence surrounding rs1143679 exhibits transcriptional enhancer activity in vivo and binds to Ku70/80, NFKB1 and EBF1 in vitro, functions that are significantly reduced with the risk allele. Mutant CD11b protein shows significantly reduced binding to fibrinogen and vitronectin, relative to non-risk, both in purified protein and in cellular models. This two-pronged contribution (nucleic acid- and protein-level) of the rs1143679 risk allele to decreasing ITGAM activity provides insight into the molecular mechanisms of its potent association with SLE.
  9. Comparison of the effects between animal-derived trypsin and recombinant trypsin on human skin cells proliferation, gene and protein expression
    Manira M, Khairul Anuar K, Seet WT, Ahmad Irfan AW, Ng MH, Chua KH, et al.
    Cell Tissue Bank, 2014 Mar;15(1):41-9.
    PMID: 23456438 DOI: 10.1007/s10561-013-9368-y
    Animal-derivative free reagents are preferred in skin cell culture for clinical applications. The aim of this study was to compare the performance and effects between animal-derived trypsin and recombinant trypsin for skin cells culture and expansion. Full thickness human skin was digested in 0.6 % collagenase for 6 h to liberate the fibroblasts, followed by treatment with either animal-derived trypsin; Trypsin EDTA (TE) or recombinant trypsin; TrypLE Select (TS) to liberate the keratinocytes. Both keratinocytes and fibroblasts were then culture-expanded until passage 2. Trypsinization for both cell types during culture-expansion was performed using either TE or TS. Total cells yield was determined using a haemocytometer. Expression of collagen type I, collagen type III (Col-III), cytokeratin 10, and cytokeratin 14 genes were quantified via RT-PCR and further confirmed with immunocytochemical staining. The results of our study showed that the total cell yield for both keratinocytes and fibroblasts treated with TE or TS were comparable. RT-PCR showed that expression of skin-specific genes except Col-III was higher in the TS treated group compared to that in the TE group. Expression of proteins specific to the two cell types were confirmed by immunocytochemical staining in both TE and TS groups. In conclusion, the performance of the recombinant trypsin is comparable with the well-established animal-derived trypsin for human skin cell culture expansion in terms of cell yield and expression of specific cellular markers.
  10. Fulltext Knowledge, attitude, and practices towards schistosomiasis among rural population in Yemen
    Sady H, Al-Mekhlafi HM, Atroosh WM, Al-Delaimy AK, Nasr NA, Dawaki S, et al.
    Parasit Vectors, 2015 Aug 25;8:436.
    PMID: 26302747 DOI: 10.1186/s13071-015-1050-8
    BACKGROUND: Schistosomiasis is highly prevalent in Yemen, with an estimated 3 million cases, particularly among rural communities. This community-based study aims to evaluate the knowledge, attitude and practices (KAP) on schistosomiasis among rural communities in Yemen.

    METHODS: A cross-sectional study was carried out among 250 households from ten rural districts in Yemen. Overall, 400 children were screened for urogenital and intestinal schistosomiasis. Moreover, parents were interviewed using a pre-tested questionnaire to collect information about the demographic and socioeconomic information and their KAP concerning schistosomiasis.

    RESULTS: A total of 127 (31.8%) children were found to be excreting schistosome eggs in either their urine or faeces (22.5% S. haematobium and 8.0% S. mansoni). Although 92.4% of the respondents had heard about schistosomiasis, 49.8%, 68.0% and 47.2% had knowledge concerning the transmission, signs and symptoms, and prevention, respectively. In addition, 77.1% considered schistosomiasis as harmful while 48.5% believed that schistosomiasis could be prevented, albeit their practices to prevent infections were still inadequate. Significant associations between the KAP and age, education, employment status and household monthly income were reported (P 

  11. Fulltext Effect of ethnicity and socioeconomic variation to the gut microbiota composition among pre-adolescent in Malaysia
    Chong CW, Ahmad AF, Lim YA, Teh CS, Yap IK, Lee SC, et al.
    Sci Rep, 2015;5:13338.
    PMID: 26290472 DOI: 10.1038/srep13338
    Gut microbiota plays an important role in mammalian host metabolism and physiological functions. The functions are particularly important in young children where rapid mental and physical developments are taking place. Nevertheless, little is known about the gut microbiome and the factors that contribute to microbial variation in the gut of South East Asian children. Here, we compared the gut bacterial richness and composition of pre-adolescence in Northern Malaysia. Our subjects covered three distinct ethnic groups with relatively narrow range of socioeconomic discrepancy. These included the Malays (n = 24), Chinese (n = 17) and the Orang Asli (indigenous) (n = 20). Our results suggested a strong ethnicity and socioeconomic-linked bacterial diversity. Highest bacterial diversity was detected from the economically deprived indigenous children while the lowest diversity was recorded from the relatively wealthy Chinese children. In addition, predicted functional metagenome profiling suggested an over-representation of pathways pertinent to bacterial colonisation and chemotaxis in the former while the latter exhibited enriched gene pathways related to sugar metabolism.
  12. Fulltext New insights into the genetic diversity of Schistosoma mansoni and S. haematobiumin Yemen
    Sady H, Al-Mekhlafi HM, Webster BL, Ngui R, Atroosh WM, Al-Delaimy AK, et al.
    Parasit Vectors, 2015;8:544.
    PMID: 26482435 DOI: 10.1186/s13071-015-1168-8
    Human schistosomiasis is a neglected tropical disease of great importance that remains highly prevalent in Yemen, especially amongst rural communities. In order to investigate the genetic diversity of human Schistosoma species, a DNA barcoding study was conducted on S. mansoni and S. haematobium in Yemen.
  13. Assessment of tumourigenic potential in long-term cryopreserved human adipose-derived stem cells
    Yong KW, Safwani WKZW, Xu F, Zhang X, Choi JR, Abas WABW, et al.
    J Tissue Eng Regen Med, 2017 08;11(8):2217-2226.
    PMID: 26756982 DOI: 10.1002/term.2120
    Cryopreservation represents an efficient way to preserve human mesenchymal stem cells (hMSCs) at early culture/passage, and allows pooling of cells to achieve sufficient cells required for off-the-shelf use in clinical applications, e.g. cell-based therapies and regenerative medicine. To fully apply cryopreserved hMSCs in a clinical setting, it is necessary to evaluate their biosafety, e.g. chromosomal abnormality and tumourigenic potential. To date, many studies have demonstrated that cryopreserved hMSCs display no chromosomal abnormalities. However, the tumourigenic potential of cryopreserved hMSCs has not yet been evaluated. In the present study, we cryopreserved human adipose-derived mesenchymal stem cells (hASCs) for 3 months, using a slow freezing method with various cryoprotective agents (CPAs), followed by assessment of the tumourigenic potential of the cryopreserved hASCs after thawing and subculture. We found that long-term cryopreserved hASCs maintained normal levels of the tumour suppressor markers p53, p21, p16 and pRb, hTERT, telomerase activity and telomere length. Further, we did not observe significant DNA damage or signs of p53 mutation in cryopreserved hASCs. Our findings suggest that long-term cryopreserved hASCs are at low risk of tumourigenesis. These findings aid in establishing the biosafety profile of cryopreserved hASCs, and thus establishing low hazardous risk perception with the use of long-term cryopreserved hASCs for future clinical applications. Copyright © 2016 John Wiley & Sons, Ltd.
  14. Patterns and Risk Factors of Soil-Transmitted Helminthiasis Among Orang Asli Subgroups in Peninsular Malaysia
    Ngui R, Aziz S, Chua KH, Aidil RM, Lee SC, Tan TK, et al.
    Am J Trop Med Hyg, 2015 Aug;93(2):361-70.
    PMID: 26055746 DOI: 10.4269/ajtmh.13-0677
    A cross-sectional study was conducted to provide comprehensive data on the patterns and associated risk factors of soil-transmitted helminth (STH) infections among five Orang Asli subgroups in Peninsular Malaysia. The overall prevalence of STH infections was 59.9% (95% confidence interval [CI] = 56.1-63.7%). Trichuris trichiura (54.3%; 95% CI = 50.4-58.2%) was the predominant species followed by Ascaris lumbricoides (26.7%; 95% CI = 23.3-30.1%) and hookworm (9.1%; 95% CI = 6.9-11.3%). This study showed diversity for STH infections by subgroup with poverty and personal sanitary behavior as important risk factors for infection. Risk profile analyses indicating that Orang Kuala subgroup who has a generally well-developed infrastructure and better quality of life had a low rate of infection. There is a need for poverty reduction and promotion of deworming programs along with mass scale campaigns to create awareness about health and hygiene to reduce STH infections.
  15. Fulltext Detection of Schistosoma mansoni and Schistosoma haematobium by Real-Time PCR with High Resolution Melting Analysis
    Sady H, Al-Mekhlafi HM, Ngui R, Atroosh WM, Al-Delaimy AK, Nasr NA, et al.
    Int J Mol Sci, 2015;16(7):16085-103.
    PMID: 26193254 DOI: 10.3390/ijms160716085
    The present study describes a real-time PCR approach with high resolution melting-curve (HRM) assay developed for the detection and differentiation of Schistosoma mansoni and S. haematobium in fecal and urine samples collected from rural Yemen. The samples were screened by microscopy and PCR for the Schistosoma species infection. A pair of degenerate primers were designed targeting partial regions in the cytochrome oxidase subunit I (cox1) gene of S. mansoni and S. haematobium using real-time PCR-HRM assay. The overall prevalence of schistosomiasis was 31.8%; 23.8% of the participants were infected with S. haematobium and 9.3% were infected with S. mansoni. With regards to the intensity of infections, 22.1% and 77.9% of S. haematobium infections were of heavy and light intensities, respectively. Likewise, 8.1%, 40.5% and 51.4% of S. mansoni infections were of heavy, moderate and light intensities, respectively. The melting points were distinctive for S. mansoni and S. haematobium, categorized by peaks of 76.49 ± 0.25 °C and 75.43 ± 0.26 °C, respectively. HRM analysis showed high detection capability through the amplification of Schistosoma DNA with as low as 0.0001 ng/µL. Significant negative correlations were reported between the real-time PCR-HRM cycle threshold (Ct) values and microscopic egg counts for both S. mansoni in stool and S. haematobium in urine (p < 0.01). In conclusion, this closed-tube HRM protocol provides a potentially powerful screening molecular tool for the detection of S. mansoni and S. haematobium. It is a simple, rapid, accurate, and cost-effective method. Hence, this method is a good alternative approach to probe-based PCR assays.
  16. Fulltext Phenotypic and functional characterization of long-term cryopreserved human adipose-derived stem cells
    Yong KW, Pingguan-Murphy B, Xu F, Abas WA, Choi JR, Omar SZ, et al.
    Sci Rep, 2015;5:9596.
    PMID: 25872464 DOI: 10.1038/srep09596
    Cryopreservation represents an effective technique to maintain the functional properties of human adipose-derived stem cells (ASCs) and allows pooling of cells via long-term storage for clinical applications, e.g., cell-based therapies. It is crucial to reduce freezing injury during the cryopreservation process by loading the ASCs with the optimum concentration of suitable cryoprotective agents (CPAs). In this study, human ASCs were preserved for 3 months in different combinations of CPAs, including 1) 0.25 M trehalose; 2) 5% dimethylsulfoxide (DMSO); 3) 10% DMSO; 4) 5% DMSO + 20% fetal bovine serum (FBS); 5) 10% DMSO + 20% FBS; 6) 10% DMSO + 90% FBS. Interestingly, even with a reduction of DMSO to 5% and without FBS, cryopreserved ASCs maintained high cell viability comparable with standard cryomedium (10% DMSO + 90% FBS), with normal cell phenotype and proliferation rate. Cryopreserved ASCs also maintained their differentiation capability (e.g., to adipocytes, osteocytes and chondrocytes) and showed an enhanced expression level of stemness markers (e.g., NANOG, OCT-4, SOX-2 and REX-1). Our findings suggest that 5% DMSO without FBS may be an ideal CPA for an efficient long-term cryopreservation of human ASCs. These results aid in establishing standardized xeno-free long-term cryopreservation of human ASCs for clinical applications.
  17. The study of seroprevalence of hepatitis E virus and an investigation into the lifestyle behaviours of the aborigines in Malaysia
    Wong LP, Alias H, Choy SH, Goh XT, Lee SC, Lim YAL, et al.
    Zoonoses Public Health, 2020 05;67(3):263-270.
    PMID: 31927794 DOI: 10.1111/zph.12681
    Malaysia is a non-endemic country for hepatitis E virus (HEV) infection. However, seroprevalence as high as 50% among samples of aboriginal people were reported over two decades ago. A total of 207 samples collected from seven aboriginal villages in rural settlements across two states in Malaysia were analysed for anti-HEV IgG and IgM by an enzyme-linked immunoassay. Following the detection of anti-HEV seroprevalence, we organized health outreach to inform and educate the community. Qualitative interviews were conducted with individuals tested positive for anti-HEV antibodies. Data derived from interviews and observations were used to investigate possible lifestyle behaviours associated with HEV infection. Anti-HEV IgG was detected in six samples (5.9%) from the village of Dusun Kubur. Qualitative inquiry and observation study revealed poor dietary and household hygiene, contaminated food and water, contact with animal faeces, unsanitary and domestic waste disposal, and wildlife reservoirs could be the contributing factors for transmission and acquisition of HEV infection. Investigation during health outreach is important to provide insights for future empirical research and implementation for improvement of lifestyle behaviours among the aborigines. Managing the risk of HEV infection in the aborigines may reduce the risk of HEV transmission to the local communities.
  18. Fulltext Prevalence and risk factors of intestinal parasitism among two indigenous sub-ethnic groups in Peninsular Malaysia
    Chin YT, Lim YA, Chong CW, Teh CS, Yap IK, Lee SC, et al.
    Infect Dis Poverty, 2016;5(1):77.
    PMID: 27430215 DOI: 10.1186/s40249-016-0168-z
    Intestinal parasitic infections (IPIs) among indigenous people have been widely documented in Malaysia, however, the prevalence of these infections remains high. In the past, most studies have focused on specific species of parasites but polyparasitism has received limited attention. In addition, epidemiology studies on indigenous people tend to consider them as a homogenous group, whereas in reality different sub-ethnic groups have different cultural and living practices. Variations in living habits such as personal hygiene practices may predispose different groups to different parasitic infections. To better understand prevalence and risk factors of intestinal parasitism among different sub-ethnic groups, the present study was conducted among two sub-ethnic groups of indigenous people (Temuan and Mah Meri) residing in Selangor state, Malaysia.
  19. Copro-molecular study of Entamoeba infection among the indigenous community in Malaysia: A first report on the species-specific prevalence of Entamoeba in dogs
    Ngui R, Hassan NA, Nordin NMS, Mohd-Shaharuddin N, Chang LY, Teh CSJ, et al.
    Acta Trop, 2020 Apr;204:105334.
    PMID: 31926914 DOI: 10.1016/j.actatropica.2020.105334
    BACKGROUND: Entamoeba is a free-living protozoan parasitic species that infect a variety of hosts. In humans, Entamoeba histolytica is the causative agent of amoebiasis. Entamoeba species has also been reported in dogs. However, little is known about the molecular epidemiology and the specific species of this parasite in dogs globally, including Malaysia. As dogs are important companion animals for the indigenous community, and close contact with dogs is part of the natural living conditions for this community, this study aims to determine the prevalence and molecular epidemiology of Entamoeba species in human and dogs in Malaysia.

    METHOD: The presence of Entamoeba species was examined in 504 fresh fecal samples, collected randomly from 411 humans and 93 dogs using microscopy and polymerase chain reaction (PCR) amplifying 16 s ribosomal RNA (rRNA). Data was analyzed using appropriate statistical analysis.

    RESULTS: The microscopy data showed an overall occurrence of Entamoeba species of 26.3% (108/411) and 36.6% (34/93) in humans and dogs respectively. In humans, the most common species was a single infection of E. dispar (26.5%; 13/49), followed by E. histolytica and E. moshkovskii, (20.4% for each species respectively). Double infection of E. dispar + E. moshkovskii was detected at 10.2%, followed by E. dispar + E. histolytica (8.2%) and E. moshkovskii and E. histolytica (6.1%). 8.2% of the samples had triple infection with all three species. In animals, E. moshkovskii (46.7%) was the most common species detected, followed by E. histolytica, and E. dispar, at 20.0% and 13.3% respectively. Double infection with E. moshkovskii + E. histolytica and a triple infection were found in 2 samples (13.3%) and 1 (6.7%) sample respectively. Risk factor analysis showed that members of the community who used untreated water were more prone to be infected with Entamoeba.

    CONCLUSION: This study provides information on the species-specific occurrence of Entamoeba infection, the potential risk factors and their zoonotic potential to humans. This is the first report to describe the molecular occurrence of Entamoeba species in dogs in Malaysia. The presence of pathogenic Entamoeba species implies that dogs could be a reservoir or mechanical host for human amoebiasis. Further studies need to be conducted to better understand the transmission dynamics and public health significance of Entamoeba species in human and animal hosts.

  20. The Use of Engineered Bilayered Skin (MyDermTM) in the Management of Massive Skin Defect in Grade III Gustilo-Anderson Open Fracture
    Mohamed Haflah NH, Ng MH, Mohd Yunus MH, Naicker AS, Htwe O, Fahmi M, et al.
    Int J Low Extrem Wounds, 2017 Sep;16(3):212-216.
    PMID: 28862056 DOI: 10.1177/1534734617724974
    Open fracture Gustilo-Anderson grade IIIC is associated with higher risk of infection and problems with soft tissue coverage. Various methods have been used for soft tissue coverage in open fractures with large skin defect. We report a case of a patient who had grade IIIC open fracture of the tibia with posterior tibial artery injury. The patient underwent external fixation and reduction. Because of potential compartment syndrome after vascular repair, fasciotomy of the posterior compartment was performed. This wound, however, became infected and because of further debridement, gave rise to a large skin defect. A tissue engineered skin construct, MyDermTM was employed to cover this large defect. Complete wound closure was achieved 35 days postimplantation. The patient then underwent plating of the tibia for nonunion with no adverse effect to the grafted site. The tibia eventually healed 5 months postplating, and the cosmetic appearance of the newly formed skin was satisfactory.
Related Terms
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links