Displaying publications 1 - 20 of 32 in total

Abstract:
Sort:
  1. Fulltext Evaluation of red blood cell indices related disorders among eligible blood donors at the Universiti Putra Malaysia (UPM)
    Riahi S, Mei IL, Idris FB, George E, Noor SM
    Southeast Asian J. Trop. Med. Public Health, 2015 Sep;46(5):911-7.
    PMID: 26863862
    Pre-donation screening declarations and hemoglobin (Hb) testing are measures used to determine the quality of donated blood. The copper sulphate (CuSo4) method used to screen for blood abnormalities can give inaccurate results if strict quality control is not applied. Blood donors who are carriers of thalassemia and those with mild iron deficiency anemia (IDA) are usually asymptomatic and frequently missed at blood donation. The aim of this study was to evaluate the red blood cell (RBC) indices related disorders among blood donors who were deemed qualified to donate blood after screening with CuSo4 method. One hundred fifty-eight volunteer blood donors at the Universiti Putra Malaysia (UPM), who had passed the CuSo4 screening method, were recruited for this study. Their bloods specimens were examined with a complete blood count. Subjects with a low mean corpuscular hemoglobin (MCH) level were examined further by checking a serum ferritin level, Hb quantification, and molecular analysis to examine for common RBC disorders. Fourteen point six percent of subjects had a low Hb level, two (1.3%) had IDA and four (2.5%) had thalassemia or some other hemoglobinopathy. Using a MCH level < 27 pg as a cut-off point, 58 subjects (36.7%) had suspected IDA, thalassemia or some other hemoglobinopathy. Eight point nine percent of subjects with a normal Hb level had thalassemia, and 3.8% had IDA. Malaysia has a high prevalence of thalassemia and other hemoglobinopathies. Pre-donation accurate screening is crucial to protect the quality of blood transfusion products. Public education regarding RBC disorders especially among blood donors is important.
    Matched MeSH terms: Hemoglobinopathies/blood; Hemoglobinopathies/etiology; Hemoglobinopathies/epidemiology*
  2. Genetic red cell abnormalities in Trengganu and Perlis (West Malaysia)
    Eng LI, McKay DA, Govindasamy S
    Southeast Asian J. Trop. Med. Public Health, 1971 Jun;2(2):133-9.
    PMID: 5002823
    Matched MeSH terms: Hemoglobinopathies/epidemiology
  3. Fulltext Causes of low HbA1c in Malaysian university hospital
    Sthaneshwar P, Vethakkan SR, Wong CW
    Med J Malaysia, 2014 Aug;69(4):175-7.
    PMID: 25500845 MyJurnal
    INTRODUCTION: Glycohemoglobin (HbA1c) most accurately reflects the previous two to three months of glycaemic control. HbA1c should be measured regularly in all patients with diabetes, and values should be maintained below 7% to prevent the risk of chronic complications. Apart from the genetic variants of haemoglobins many other conditions also known to affect HbA1c measurements. In this study we evaluated the conditions that cause low HbA1c results.

    METHODS AND MATERIALS: The data was collected retrospectively HbA1c was measured in our laboratory by Biorad Variant II turbo 2.0. The method is based on chromatographic separation of HbA1c on a cation exchange cartridge. This method has been certified by National Glycohemoglobin Standardization Programme (NGSP). 58437 requests were received in a period of one year (January to December 2011). Medical records were reviewed to identify the conditions that might be associated with these low values.

    RESULTS: Among 58437 samples analysed, 53 patients had HbA1c levels < 4.0%. Fourteen patients had haemoglobinopathy. In 34 patients without Hb variants had conditions such as chronic liver disease, chronic kidney disease, haemolytic anaemia, pregnancy, and anaemia of chronic disease. Five non-pregnant individuals who were screened for diabetes mellitus had HbA1c levels < 4%.

    CONCLUSION: Our study underscores the importance of that both laboratories and the physicians should be aware of the factors that can influence the HbA1c results. The haematological status should be taken into consideration for proper interpretation of HbA1c results.
    Matched MeSH terms: Hemoglobinopathies
  4. Fulltext Haemoglobin Sickle D Punjab: - a case report
    Rahimah A, Syahira Lazira O, Siti Hida HM, Faidatul Syazlin AH, Nur Aisyah A, Nik Hafidzah NM, et al.
    Med J Malaysia, 2014 Feb;69(1):42-3.
    PMID: 24814631 MyJurnal
    Haemoglobin S D-Punjab is a rare compound heterozygous haemoglobinopathy characterised by the presence of two β globin gene variants: Β6(GAG→GTG) and Β121(GAA→CAA). These patients' clinical and haematological features mimic haemoglobin S disease. We describe the first case of doubly heterozygous HbSD-Punjab from Malaysia managed with regular blood transfusion at the age of one. This case highlights the propensity for occurrence of rare phenotypes within our multi-ethnic population and emphasises the importance of accurate genotyping to avoid erroneous counselling, and to plan an effective patient management strategy before complication evolves.
    Matched MeSH terms: Hemoglobinopathies
  5. Fulltext Thalassaemia and haemoglobinopathies in Brunei Darussalam
    Ismail JB
    Med J Malaysia, 1992 Jun;47(2):98-102.
    PMID: 1494340
    One thousand consecutive Brunei Darussalam patients referred with low Hb, and/or low MCV and MCH (Hb < 12.5g/dl, MCV < 76fl, MCH < 27pg) were studied in the laboratory for underlying haemoglobinopathies. 30.0% of such patients were proved to have either beta-thalassaemia trait, beta-thalassaemia major, Hb AE, Hb EE, Hb E beta-thalassaemia or Hb H disease. In some, the haemoglobin abnormality was not identified precisely. Alpha-thalassaemia was suspected in an additional 4.3% of cases but confirmation study by globin-chain synthesis was not available. Beta-thalassaemia trait which was the predominant disorder was equally distributed among the three major race groups of Brunei Darussalam. Hb E was found exclusive among the Malay population. Hb H disease appeared as more common among the Chinese or the Malays (p > 0.05). This study reveals that thalassaemia and haemoglobinopathies are prevalent in Brunei Darussalam.
    Matched MeSH terms: Hemoglobinopathies/genetics; Hemoglobinopathies/epidemiology*
  6. Fulltext Haemoglobin E trait: microcytosis and erythrocytosis
    George E, Sivagengei K
    Med J Malaysia, 1982 Jun;37(2):102-3.
    PMID: 7132828
    Matched MeSH terms: Hemoglobinopathies/blood*
  7. Family with hereditary persistence of foetal haemoglobin
    Boon WH
    Med J Malaya, 1968 Sep;23(1):61-6.
    PMID: 4237561
    Matched MeSH terms: Hemoglobinopathies/genetics*
  8. Haemoglobin D trait in a Filipino family
    VELLA F
    Med J Malaya, 1958 Jun;12(4):602-4.
    PMID: 13577152
    Matched MeSH terms: Hemoglobinopathies*
  9. Fulltext Haemoglobin Lepore in a Malay family: a case report
    Pasangna J, George E, Nagaratnam M
    Malays J Pathol, 2005 Jun;27(1):33-7.
    PMID: 16676691
    A 2-year-old Malay boy was brought to the University Malaya Medical Centre for thalassaemia screening. Physical examination revealed thalassaemia facies, pallor, mild jaundice, hepatomegaly and splenomegaly. Laboratory investigations on the patient including studies on the parents lead to a presumptive diagnosis of homozygous Haemoglobin Lepore (Hb Lepore). The aim of this paper is to increase awareness of this rare disorder, this being the first case documented in Malaysia in a Malay. The case also demonstrates the need for this disorder to be included in the differential diagnosis of patients presenting clinically like thalassemia intermedia or thalassemia major. Accurate diagnosis would provide information necessary for prenatal diagnosis, proper clinical management and genetic counseling. The clinical, haematological and laboratory features of this disorder are discussed in this paper.
    Matched MeSH terms: Hemoglobinopathies/blood; Hemoglobinopathies/genetics*
  10. Fulltext Potential use of cord blood for Hb E hemoglobinopathy screening programme using capillary electrophoresis
    Wan Mohd Saman WA, Hassan R, Mohd Yusoff S, Che Yaakob CA, Abdullah NA, Ghazali S, et al.
    Malays J Pathol, 2016 Dec;38(3):235-239.
    PMID: 28028293 MyJurnal
    BACKGROUND: Thalassemia and hemoglobinopathies are inherited red blood cell disorders found worldwide. Hemoglobin (Hb) E disorder is one of the hemoglobinopathies known to have the high prevalence in South East Asia. Most of transfusion-dependent thalassemias were genotypically compound heterozygous Hb E/ β-thalassemia. In Malaysia, the national screening program for thalassemia was implemented for early pregnancy or secondary school girls; however many participants do not turn-up and missed the screening test. Screening for thalassemia using samples from cord blood is an alternative choice as it is a readily available source of blood and hence early detection of the disease. The purpose of this study was to determine the potential use of cord blood for the screening of HbE hemoglobinopathy by using capillary electrophoresis (CE).

    METHODS: Cord blood samples were collected from 300 newborns of healthy mothers. Hematological parameters were determined and hemoglobin quantitation for all cord blood samples were performed using capillary electrophoresis system (CES) and high performance liquid chromatography (HPLC).

    RESULTS: Majority of cord blood samples (63%) revealed Hb AF followed by Hb AFA2 (20%). Hb AFE was detected in 10.7% with the mean value of Hb E ranging from 2.3%-11.1%.

    CONCLUSION: Hemoglobin E was detected in cord blood using capillary electrophoresis system. It can be recommended in areas where Hb E/β is prevalent. Implementation of a screening strategy using CE on cord blood sampling will identify the disease early. With regular follow-up on these patients, the status of their disease can be determined earlier and appropriate management implemented.

    Matched MeSH terms: Hemoglobinopathies/diagnosis*
  11. Fulltext Secondary polycythaemia in a Malay girl with homozygous Hb Tak
    Amran HS, Aziz MA, George E, Mahmud N, Lee TY, Md Noor S
    Malays J Pathol, 2017 Dec;39(3):321-326.
    PMID: 29279598 MyJurnal
    Hb Tak is one of more than 200 high affinity haemoglobin variants reported worldwide. It results from the insertion of two nucleotides (AC) at the termination codon, between codon 146 and codon 147 of the beta-globin gene [Beta 147 (+AC)]. Polycythaemia is the main clinical feature although affected carriers are usually asymptomatic and do not require intervention. Several case studies in this region have reported the co-inheritance of Hb Tak with Hb E, delta beta and beta thalassaemia with one case of homozygous Hb Tak in a Thai boy. In this case report, a cluster of haemoglobin Tak was found in a family of Malay ethnic origin. Cascade family screening was conducted while investigating a 4-year old girl who presented with symptomatic polycythaemia. She had 2 previous Hb analysis done, at 7-month and 2-year-old with the diagnosis of possible Hb Q Thailand and Homozygous Hb D, respectively. Both diagnosis did not fit her clinical presentations. She was plethoric, had reduced exercise tolerance as well as cardiomyopathy. Her parents were consanguineously married and later diagnosed as asymptomatic carriers of Hb Tak. Consequently, re-analysis of the girl's blood sample revealed a homozygous state of Hb Tak. In conclusion, high oxygen affinity haemoglobin like Hb Tak should be considered in the investigation of polycythaemic patients with abnormal Hb analyses. In this case, DNA analysis was crucial in determining the correct diagnosis.
    Matched MeSH terms: Hemoglobinopathies/diagnosis*; Hemoglobinopathies/genetics*
  12. Fulltext Molecular characterisation of Haemoglobin Constant Spring and Haemoglobin Quong Sze with a Combine-Amplification Refractory Mutation System
    Wee YC, Tan KL, Chua KH, George E, Tan JA
    Malays J Med Sci, 2009 Jul;16(3):21-8.
    PMID: 22589661 MyJurnal
    BACKGROUND: The interaction of the non-deletional α(+)-thalassaemia mutations Haemoglobin Constant Spring and Haemoglobin Quong Sze with the Southeast Asian double α-globin gene deletion results in non-deletional Haemoglobin H disease. Accurate detection of non-deletional Haemoglobin H disease, which is associated with severe phenotypes, is necessary as these mutations have been confirmed in the Malaysian population.
    METHODS: DNA from two families with Haemoglobin H disease was extracted from EDTA-anticoagulated whole blood and subjected to molecular analysis for α-thalassaemia. A duplex polymerase chain reaction was used to detect the Southeast Asian α-globin gene deletion. Polymerase chain reaction-restriction fragment length polymorphism analysis was then carried out to determine the presence of Haemoglobin Constant Spring and Haemoglobin Quong Sze. A combine-amplification refractory mutation system protocol was optimised and implemented for the rapid and specific molecular characterisation of Haemoglobin Constant Spring and Haemoglobin Quong Sze in a single polymerase chain reaction.
    RESULTS AND CONCLUSIONS: The combine-amplification refractory mutation system for Haemoglobin Constant Spring and Haemoglobin Quong Sze, together with the duplex polymerase chain reaction, provides accurate pre- and postnatal diagnosis of non-deletional Haemoglobin H disease and allows detailed genotype analyses using minimal quantities of DNA.
    KEYWORDS: Combine-ARMS; Hb Constant Spring; Hb Quong Sze; medical sciences
    Matched MeSH terms: Hemoglobinopathies*
  13. Sacroiliac gout associated with hemoglobin E and hypersplenism
    Lambeth JT, Burns-Cox CJ, MacLean R
    Radiology, 1970 May;95(2):413-5.
    PMID: 5439452 DOI: 10.1148/95.2.413
    Two patients with gout associated with the presence of an abnormal hemoglobin, Hb E, and hypersplenism are presented. Very large sclerotic-rimmed cystic erosions in the sacroiliac joints of both patients are unusual but characteristic of the skeletal lesions of gout. The hyperuricemia may be the result of the disordered nucleic acid metabolism associated with hemoglobin abnormality. The development of hypersplenism very likely accelerated this process and resulted in the clinical and radiographic manifestations of severe gout.
    INDEX TERMS: Blood, diseases • Blood, proteins • globin and Hemoglobin Compounds • Sacroiliac Joint trophy
    Study site: Hospital Gombak, Selangor, Malaysia
    Matched MeSH terms: Hemoglobinopathies/complications*
  14. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations
    Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
    Matched MeSH terms: Hemoglobinopathies/genetics
  15. International perspectives on the implementation of reproductive carrier screening
    Delatycki MB, Alkuraya F, Archibald A, Castellani C, Cornel M, Grody WW, et al.
    Prenat Diagn, 2020 02;40(3):301-310.
    PMID: 31774570 DOI: 10.1002/pd.5611
    Reproductive carrier screening started in some countries in the 1970s for hemoglobinopathies and Tay-Sachs disease. Cystic fibrosis carrier screening became possible in the late 1980s and with technical advances, screening of an ever increasing number of genes has become possible. The goal of carrier screening is to inform people about their risk of having children with autosomal recessive and X-linked recessive disorders, to allow for informed decision making about reproductive options. The consequence may be a decrease in the birth prevalence of these conditions, which has occurred in several countries for some conditions. Different programs target different groups (high school, premarital, couples before conception, couples attending fertility clinics, and pregnant women) as does the governance structure (public health initiative and user pays). Ancestry-based offers of screening are being replaced by expanded carrier screening panels with multiple genes that is independent of ancestry. This review describes screening in Australia, Cyprus, Israel, Italy, Malaysia, the Netherlands, Saudi Arabia, the United Kingdom, and the United States. It provides an insight into the enormous variability in how reproductive carrier screening is offered across the globe. This largely relates to geographical variation in carrier frequencies of genetic conditions and local health care, financial, cultural, and religious factors.
    Matched MeSH terms: Hemoglobinopathies/genetics
  16. Fulltext Thalassaemia screening among healthy blood donors in Hospital Tengku Ampuan Rahimah, Klang
    Irmi Elfina, R., Ezalia, E., Elizabeth, G., Wan Hayati, M.Y, Norhanim, A., Wahidah, A., et al.
    Medicine & Health, 2014;9(1):44-52.
    MyJurnal
    Thalassaemia screening programme has been conducted in Malaysia since 2004. The aim of the programme was to reduce the burden of the disease by identifying thalassaemia carriers. However, the response towards the screening activities was unsatisfactory as there was lack of public awareness against the importance of thalassaemia screening. An alternative approach is to screen blood donors. The purpose of this study was to observe the prevalence of thalassaemia carriers among healthy blood donors. Seven hundred and thirty eight healthy blood donors were screened in Hospital Tengku Ampuan Rahimah, Klang from July to September 2010 using cation-exchange high performance liquid chromatography (HPLC). Cases with haemoglobin variants were further analyzed by gel electrophoresis at alkaline pH. Result shows that the blood donors consisted of 413 Malays (56%), 162 Indians (22%), 148 Chinese (20%) and 15 others (2%). There were 19 (2.6%) individuals with haemoglobin E trait, six (0.8%) with co-inheritance of haemoglobin E and αα- thalassaemia and five (0.7%) with β-thalassaemia trait. Haemoglobin Constant Spring and haemoglobin A2 prime were observed in two (0.3%); and Haemoglobin Lepore and alpha chain variant in one (0.2%). αα-thalassaemia and normal haemoglobin A2 β-thalassaemia could not be excluded in 190 cases (26%), as they required deoxyribonucleic acid (DNA) studies for identification. Thalassaemia screening in blood donors is more feasible and effective. Therefore, a wider scale population screening including blood donors could benefit the existing thalassaemia screening programme in Malaysia.
    Matched MeSH terms: Hemoglobinopathies
  17. Fulltext A holistic approach to education programs in thalassemia for a multi-ethnic population: consideration of perspectives, attitudes, and perceived needs
    Wong LP, George E, Tan JA
    J Community Genet, 2011 Jun;2(2):71-9.
    PMID: 22109791 DOI: 10.1007/s12687-011-0039-z
    Hemoglobin disorders which include thalassemias are the most common heritable disorders. Effective treatment is available, and these disorders can be avoided as identification of carriers is achievable using simple hematological tests. An in-depth understanding of the awareness, attitudes, perceptions, and screening reservations towards thalassemia is necessary, as Malaysia has a multi-ethnic population with different religious beliefs. A total of 13 focus group discussions (70 participants) with members of the general lay public were conducted between November 2008 and January 2009. Lack of knowledge and understanding about thalassemia leads to general confusions over differences between thalassemia carriers and thalassemia major, inheritance patterns, and the physical and psychologically impact of the disorder in affected individuals and their families. Although most of the participants have not been tested for thalassemia, a large majority expressed willingness to be screened. Views on prenatal diagnosis and termination of fetuses with thalassemia major received mixed opinions from participants with different religions and practices. Perceived stigma and discrimination attached to being a carrier emerged as a vital topic in some group discussions where disparity in the answers exhibited differences in levels of participants' literacy and ethnic origins. The two most common needs identified from the discussion were information and screening facilities. Participants' interest in knowing the severity of the disease and assessing their risk of getting the disorder may imply the health belief model as a possible means of predicting thalassemia public screening services. Findings provide valuable insights for the development of more effective educational, screening, and prenatal diagnostic services in the multi-ethnic Asian society.
    Matched MeSH terms: Hemoglobinopathies
  18. Fulltext Screening for thalassaemia among group of students of a higher institution – our experience
    Norlelawati, A.T., Siti Hadijah, M., Siti Nor Haiza, H., Rusmawati, I., Abdul Wahab, J., Naznin, M., et al.
    International Medical Journal Malaysia, 2011;10(1):3-6.
    MyJurnal
    Introduction: Thalassaemia is an inherited blood disorder and is a significant public health alarm in Malaysia with many not knowing they are carriers of this haemoglobin disorders. Materials and methods: This study conducted a one off collection of blood samples from 72 Malays students of International Islamic University Malaysia (IIUM) in Kuantan. Blood samples were subjected to conventional haemoglobin analyses that include full blood count and picture, HPLC, Haemoglobin electrophoresis and H-inclusion test. All samples were also genotyped for alpha thalassaemia–1 of Southeast Asia (a-Thal1SEA). Result: There were 17(23.6%) students who were diagnosed as thalassaemia carriers. Out of this, four (5.5 %) and six (8.3 %) students were presumptive β-thalassaemia trait and Haemoglobin-E trait as determined by the HPLC assay respectively. Nine (12.5%) students were genotyped a-Thal1SEA among whom two were also β-thalassaemia carriers. All thalassaemia cases had MCH of < 27pg. Nonetheless, two out of six Haemoglobin-E trait and three out of nine a-Thal1SEA carrier had MCV value of >80fL. Two out of four (50%) presumptive β -thalassaemia trait and one out of six (17%) students of presumptive Haemoglobin-E trait had family history of thalassaemia respectively. Conclusion: The high occurrence of the three common types of thalassaemia carrier (β, Hb-E and a-Thal1SEA thalassaemia) in our small group of subjects could be due to better participation of students who had family history of thalassaemia. The study reaffirmed the importance of molecular study for detection of alpha-thalassaemia and the use of MCH value of
    Matched MeSH terms: Hemoglobinopathies
  19. Evaluation of role of HPLC (Merits & Pitfalls), in the diagnosis of various hemoglobinopathies & thalassemic syndromes
    Baig MA, Swamy KB, Baksh AD, Bahashwan A, Moshrif Y, Al Sawat A, et al.
    Indian J Pathol Microbiol, 2021 8 4;64(3):518-523.
    PMID: 34341263 DOI: 10.4103/IJPM.IJPM_709_20
    Background: : HPLC is one of the most important tools for accurate diagnosis of hemoglobinopathies and thalassemias. The advantage of the HPLC system is the excellent resolution, reproducibility &quantification of several normal and abnormal hemoglobin.

    Results: BIO RAD Variant II analyzer was used. Sickle cell syndromes including double heterozygous states accounted for 56.13% of total cases. HbSS, HbS/β0-th, HbS/β+-th β-thal trait comprises 29%, 6.5%, 5.1%& 10% of total cases respectively with mean MCV (fl) = 84, 68,71,64 respectively. The Mean HbA2 for β-thal trait, HbE trait &HbE-β thal showed 5.1 ± 1.1, 19 ± 9 & 24 ± 8 respectively. HbF is increased in 8.6% case (excluding SC syndromes & β-thal disorders), of these 5.5% were infants & 12 cases of Aplastic Anemias. Peak P2 >7% (2.4% cases) was seen in uncontrolled diabetes mellitus which on quantification showed HbA1C = 8 ± 2.1 mmol/L.

    Discussion: : HPLC in correlation with CBC parameters & family studies can aid in the diagnosis of majority of Hemoglobinopathies and thalassemic syndrome. The CBC & HPLC parameters of the present study are in good correlation with the research conducted by Tejinder Sing, RiouJ & Alla Joutovsky. Present study showed HPLC comprehensively characterizing HbS, A, A2, F, S, C, D from each other & was also applicable for the quantification of HbA1c for the monitoring of Diabetes Mellitus.

    Conclusion: : The merits of HPLC are small quantity of sample required, economical, less TAT, accurate categorization of HbS, HbA2 & F. But one has to be aware of the limitations and problems associated with this method due to variant hemoglobin within the same retention windows. The present findings show HPLC as an excellent & powerful diagnostic tool for the direct identification of hemoglobin variants with a high degree of precision in the quantification of normal and abnormal hemoglobin fractions.

    Matched MeSH terms: Hemoglobinopathies/blood; Hemoglobinopathies/diagnosis*
  20. High frequencies of a rearrangement (+ATA; -T) at -530 to the beta-globin gene in different populations indicate the absence of a correlation with a silent beta-thalassemia determinant
    Wong SC, Stoming TA, Efremov GD, Huisman TH
    Hemoglobin, 1989;13(1):1-5.
    PMID: 2703362
    DNA samples from numerous subjects of different racial and ethnic backgrounds, with or without various hemoglobinopathies (classical beta-thalassemia; silent beta-thalassemia, Hb E, sickle cell anemia), were studied for a rearrangement (+ATA; -T) at nucleotide -530 in the 5' flanking region of the beta-globin gene using amplified DNA and 32P-labeled synthetic oligonucleotide probes. The data show that this unusual sequence is a common feature among East-Asians and Blacks (particularly SS patients), and is not associated with mild thalassemic features typical for the silent form of beta-thalassemia, as has been suggested (5).
    Matched MeSH terms: Hemoglobinopathies/genetics
Related Terms
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links