Displaying publications 21 - 40 of 68 in total

Abstract:
Sort:
  1. Haemoglobin Ypsilanti: an incidental finding in two diabetic patients
    Sthaneshwar P, Shanmugam H, Arumugam S
    Pathology, 2014 Apr;46(3):263-5.
    PMID: 24614705 DOI: 10.1097/PAT.0000000000000090
    Matched MeSH terms: Hemoglobins, Abnormal/analysis*; Hemoglobins, Abnormal/genetics
  2. Hb lepore/β0-thalassaemia with α+-thalassaemia interactions, a potential diagnostic pitfall
    Alauddin H, Mohamad Nasir S, Ahadon M, Raja Sabudin RZ, Ithnin A, Hussin NH, et al.
    Malays J Pathol, 2015 Dec;37(3):287-92.
    PMID: 26712677
    Haemoglobin (Hb) Lepore is a variant Hb consisting of two α-globin and two δβ-globin chains. In a heterozygote, it is associated with clinical findings of thalassaemia minor, but interactions with other haemoglobinopathies can lead to various clinical phenotypes and pose diagnostic challenges. We reported a pair of siblings from a Malay family, who presented with pallor and hepatosplenomegaly at the ages of 21 months and 14 months old. The red cell indices and peripheral blood smears of both patients showed features of thalassaemia intermedia. Other laboratory investigations of the patients showed conflicting results. However, laboratory investigation results of the parents had led to a presumptive diagnosis of compound heterozygote Hb Lepore/β-thalassaemia and co-inheritance α+-thalassaemia (-α3.7). Hb Lepore has rarely been detected in Southeast Asian countries, particularly in Malaysia. These two cases highlight the importance of family studies for accurate diagnosis, hence appropriate clinical management and genetic counseling.
    Matched MeSH terms: Hemoglobins, Abnormal/genetics*
  3. Fulltext α-Thalassemia with Haemoglobin Adana mutation: prenatal diagnosis
    Zainal NZ, Alauddin H, Ahmad S, Hussin NH
    Malays J Pathol, 2014 Dec;36(3):207-11.
    PMID: 25500521
    Thalassaemia carriers are common in the Asian region including Malaysia. Asymptomatic patients can be undiagnosed until they present for their antenatal visits. Devastating obstetric outcome may further complicate the pregnancy if both parents are thalassaemia carriers leading to hydrophic fetus due to haemoglobin Bart's disease. However in certain cases where unexplained hydrops fetalis occur in parents with heterozygous thalassaemia carrier,mutated α genes should be suspected. We report a twenty-nine year old woman in her third pregnancy with two previous pregnancies complicated by early neonatal death at 21 and 28 weeks of gestation due to hydrops fetalis. DNA analysis revealed the patient to have heterozygous (--SEA) α-gene deletion, while her husband has a compound heterozygosity for α(3.7) deletion and codon 59 (GGC → GAC) mutation of the α-gene. This mutation, also known as hemoglobin Adana, can explain hydrops fetalis resulting from two alpha gene deletions from the patient (mother) and a single alpha gene deletion with mutation from the father. The third pregnancy resulted in a grossly normal baby boy with 3 α-gene deletions (HbH disease). We postulate that, in view of heterogenisity of the α-thalassaemia in this patient with severely unstable haemoglobin Adana chains from her husband, there will be a 25% possibility of fetal hydrops in every pregnancy.
    Matched MeSH terms: Hemoglobins, Abnormal/genetics*
  4. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations
    Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
    Matched MeSH terms: Hemoglobins, Abnormal/analysis
  5. A case series of α-thalassemia intermedia due to compound heterozygosity for Hb Adana [HBA2: c179G>A (or HBA1); p.Gly60Asp] with other α-thalassemias in Malay families
    Alauddin H, Jaapar NA, Azma RZ, Ithnin A, Razak NF, Loh CK, et al.
    Hemoglobin, 2014;38(4):277-81.
    PMID: 24829075 DOI: 10.3109/03630269.2014.916720
    Hb Adana [HBA2: c179G>A (or HBA1); p.Gly60Asp] is a rare hemoglobin (Hb) variant due to a mutation at codon 59 of the α2- or α1-globin gene resulting in a glycine to aspartic acid substitution. Two siblings with a unique coinheritance of Hb Adana and Hb Constant Spring (Hb CS, α142, Term→Gln, TAA>CAA; HBA2: c.427 T>C) (α(codon 59)α/α(CS)α), were compared phenotypically with another two siblings carrying the Hb Adana mutation and a 3.7 kb deletion (α(codon 59)α/-α(3.7)). Although they all had α-thalassemia intermedia (α-TI), the former were clinically more severe than the latter. The first pair of siblings presented at a much younger age than the second pair and showed lower Hb levels and significant extramedullay hemopoiesis. Another case of a hydropic fetus as a result of Hb H/Hb Adana is also described. Their clinical phenotypes and hematological parameters are all presented for comparison.
    Matched MeSH terms: Hemoglobins, Abnormal/genetics*
  6. Fulltext Identification of hemoglobin AC heterozygote status in a Malay family: a decision between hemoglobin electrophoresis and high performance liquid chromotography
    Rosline H, Roshan TM, Ahmed SA, Ilunihayati I
    Southeast Asian J. Trop. Med. Public Health, 2007 May;38(3):543-5.
    PMID: 17877232
    Thalassemia is a common public health problem among Malays. Hemoglobin C (Hb C) is a hemoglobin beta variant resulting from a single base mutation at the 6th position of the beta-globin gene leading to the substitution of glycine for glutamic acid. Hb C is commonly detected in West Africans and in African American but has not been reported in Malaysia. It can be falsely diagnosed as HbE trait in the Malaysian Thalassemia Screening Program which utilizes cellulose acetate hemoglobin electrophoresis. This is the first reported case of Hb AC heterozygote status in a Malay family, with unusual splenomegaly in one of the family members.
    Matched MeSH terms: Hemoglobins, Abnormal/analysis*
  7. Fulltext Haemoglobin Lepore in a Malay family: a case report
    Pasangna J, George E, Nagaratnam M
    Malays J Pathol, 2005 Jun;27(1):33-7.
    PMID: 16676691
    A 2-year-old Malay boy was brought to the University Malaya Medical Centre for thalassaemia screening. Physical examination revealed thalassaemia facies, pallor, mild jaundice, hepatomegaly and splenomegaly. Laboratory investigations on the patient including studies on the parents lead to a presumptive diagnosis of homozygous Haemoglobin Lepore (Hb Lepore). The aim of this paper is to increase awareness of this rare disorder, this being the first case documented in Malaysia in a Malay. The case also demonstrates the need for this disorder to be included in the differential diagnosis of patients presenting clinically like thalassemia intermedia or thalassemia major. Accurate diagnosis would provide information necessary for prenatal diagnosis, proper clinical management and genetic counseling. The clinical, haematological and laboratory features of this disorder are discussed in this paper.
    Matched MeSH terms: Hemoglobins, Abnormal/genetics*
  8. Fulltext DNA studies are necessary for accurate patient diagnosis in compound heterozygosity for Hb Adana (HBA2:c.179>A) with deletional or nondeletional α-thalassaemia
    Tan JA, Kho SL, Ngim CF, Chua KH, Goh AS, Yeoh SL, et al.
    Sci Rep, 2016 06 08;6:26994.
    PMID: 27271331 DOI: 10.1038/srep26994
    Haemoglobin (Hb) Adana (HBA2:c.179>A) interacts with deletional and nondeletional α-thalassaemia mutations to produce HbH disorders with varying clinical manifestations from asymptomatic to severe anaemia with significant hepatosplenomegaly. Hb Adana carriers are generally asymptomatic and haemoglobin subtyping is unable to detect this highly unstable α-haemoglobin variant. This study identified 13 patients with compound heterozygosity for Hb Adana with either the 3.7 kb gene deletion (-α(3.7)), Hb Constant Spring (HbCS) (HBA2:c.427T>C) or Hb Paksé (HBA2:429A>T). Multiplex Amplification Refractory Mutation System was used for the detection of five deletional and six nondeletional α-thalassaemia mutations. Duplex-PCR was used to confirm Hb Paksé and HbCS. Results showed 84.6% of the Hb Adana patients were Malays. Using DNA studies, compound heterozygosity for Hb Adana and HbCS (α(codon 59)α/α(CS)α) was confirmed in 11 patients. A novel point in this investigation was that DNA studies confirmed Hb Paksé for the first time in a Malaysian patient (α(codon 59)α/α(Paksé)α) after nine years of being misdiagnosis with Hb Adana and HbCS (α(codon 59)α/α(CS)α). Thus, the reliance on haematology studies and Hb subtyping to detect Hb variants is inadequate in countries where thalassaemia is prevalent and caused by a wide spectrum of mutations.
    Matched MeSH terms: Hemoglobins, Abnormal/genetics*
  9. Haemaglobin Bart's in cord blood of Malaysians
    George E, Selamah G
    Southeast Asian J. Trop. Med. Public Health, 1981 Mar;12(1):87-9.
    PMID: 6894805
    In the newborn the diagnosis of alpha thalassaemia trait is easier because of the presence of haemoglobin Bart's (Hb Bart's). Alpha thalassaemia is common in Southeast Asia. Malaysians are composed of the ethnic groups Malays, Chinese, Indians and Eurasians. Hb Bart's itself is not a simple inherited character but arises from genetically determined imbalance in the biosynthesis of alpha and non alpha chains. 58% of the cord blood samples tested showed raised levels of Hb Bart's. In the Chinese the most common cause of hereditary haemolytic anaemia is haemoglobin H and hydrops foetalis is seen. The rare occurrence of these syndromes in the Malays and Indians in spite of the presence of Hb Bart's indicates an altered expression of the alpha thalassaemia gene in these populations.
    Matched MeSH terms: Hemoglobins, Abnormal/analysis*
  10. Fulltext Homozygous haemoglobin E in association with hereditary ovalocytosis
    George E, Kudva MV
    Med J Malaysia, 1989 Sep;44(3):255-8.
    PMID: 2626141
    Hereditary stomatocytic ovalocytosis and haemoglobin E are two genes present in 3-5% of Malays. This is a report of a 22 year old Malay college student with homozygous haemoglobin E and hereditary stomatocytic ovalocytosis where the clinical effects seen were the result of the summation of these genes: he was asymptomatic, presenting with moderate jaundice, moderate hepatosplenomegaly, and a mild haemolytic anaemia.
    Matched MeSH terms: Hemoglobins, Abnormal/genetics*
  11. Identification of slow-moving haemoglobins in haemoglobin H disease from different racial groups
    Fessas P, Eng LI, Na-Nakorn S, Todd D, Clegg JB, Weatherall DJ
    Lancet, 1972 Jun 17;1(7764):1308-10.
    PMID: 4113401
    Matched MeSH terms: Hemoglobins, Abnormal/isolation & purification*
  12. Haemoglobin F Malaysia: alpha 2, gamma 2 1(NA1) glycine--cysteine; 136 glycine
    Eng LI, Kamuzora H, Lehmann H
    J Med Genet, 1974 Mar;11(1):25-30.
    PMID: 4837284
    Matched MeSH terms: Hemoglobins, Abnormal/analysis*
  13. A Unique Interaction of IVS-I-1 (G>A) (HBA2: c.95+1G>A) with Hb Adana (HBA2: c.179G>A) Presenting as Transfusion-Dependent α-Thalassemia
    Alauddin H, Kamarudin K, Loong TY, Azma RZ, Ithnin A, Jalil N, et al.
    Hemoglobin, 2018 Jul;42(4):247-251.
    PMID: 30623696 DOI: 10.1080/03630269.2018.1528985
    Nondeletional α-globin mutations are known to cause more serious clinical effects than deletional ones. A rare IVS-I-1 (G>A) (HBA2: c.95+1G>A) donor splice site mutation interferes with normal splicing of pre mRNA and results in activation of a cryptic splice site as well as a frameshift mutation. Hb Adana [HBA2: c.179G>A (or HBA1)] is a highly unstable variant hemoglobin (Hb) resulting from a mutation at codon 59 on the HBA2 or HBA1 gene, recognized to cause severe α-thalassemia (α-thal) syndromes. We report a unique case of compound heterozygosity for these two mutations in a 9-year-old boy who presented with a Hb level of 5.3 g/dL and hepatomegaly at the age of 15 months. He required regular blood transfusions in view of a Hb level of <7.0 g/dL and failure to thrive. He had thalassemic red cell indices and peripheral blood film. The Hb electrophoresis only showed a raised Hb F level (3.3%) and a pre run peak but the Hb H inclusion test was negative. His father had thalassemic red cell indices but a normal Hb level. His mother had almost normal Hb levels and red cell indices. Hb Adana involving the HBA2 gene was detected by mutiplex amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) in the proband and his father. DNA sequencing of the HBA2 gene confirmed the IVS-I-1 mutation in the proband and his mother. This case highlighted the unique interaction of the IVS-I-1 mutation with Hb Adana in a young Malay boy presenting with transfusion-dependent α-thal.
    Matched MeSH terms: Hemoglobins, Abnormal/genetics*
  14. Fulltext Alpha-chain thalassemia and hydrops fetalis in Malaya: report of five cases
    Lie-Injo LE
    Blood, 1962 Nov;20:581-90.
    PMID: 13930509
    Five cases of severe hydrops and erythroblastosis fetalis in association with a large amount of Hb “Bart’s,” all of Chinese origin, are described. The following characteristic clinical and hematologic symptoms were found. There were generalized hydrops, ascites and gross enlargement of the liver. The spleen, however, was not ahvays enlarged. The placenta was large and friable. Severe erythroblastosis of the blood was always found, with reticulocytosis, many target cells and thin cells. The MCV of the red cells was very high. The cells showed an interesting sickling phenomenon. No evidence of isoimmunization was found. In eight parents examined, no abnormal hemoglobin was detected, and alkali-resistant hemoglobin and hemoglobin A2 were not found to be increased. Their blood showed microcytosis of the red cells cxcept in one father and one mother. In this mother, however, the blood was examimied after a blood transfusion. It is thought probable that these were cases of homozygous alpha-chain thalassemia.
    Matched MeSH terms: Hemoglobins, Abnormal*
  15. Hb Bart's level in cord blood and deletions of alpha-globin genes
    Lie-Injo LE, Solai A, Herrera AR, Nicolaisen L, Kan YW, Wan WP, et al.
    Blood, 1982 Feb;59(2):370-6.
    PMID: 6895707
    The white blood cell DNA of 36 cord blood samples with Hb Bart's in the red blood cells was studied for alpha-globin gene deletions by hybridization of DNA fragments digested by the restriction endonucleases Eco RI, Hpa I, Bam HI, and Bgl II. All 16 DNA samples from cord blood with Hb Bart's below 3% and no other abnormal hemoglobin had one alpha-globin gene deletion (alpha thal2), except one which had two alpha-globin gene deletions (alpha thal1). Most of the alpha thal2 were of the rightward deletion alpha thal2 genotype. Two new types of alpha thal2 variation was found, probably due to a polymorphism somewhere in an area outside the alpha-globin gene. All 14 cases with Hb Bart's between 3.5% and 8.5% and no other abnormal hemoglobin had two alpha-globin gene deletions (alpha thal1), except one that did not have any alpha-globin gene deletion and one that had one alpha-globin gene deletion. Three DNA samples of cord blood with Hb Bart's accompanied by Hb CoSp did not have any alpha-globin gene deletion. Sixty-five DNA samples from cord blood without Hb Bart's or other abnormal hemoglobin had no alpha-globin gene deletions, except one that had one alpha-globin gene deletion (alpha thal2). Two of the 65 DNA samples were found to have triplicated alpha-globin gene loci.
    Matched MeSH terms: Hemoglobins, Abnormal/analysis*
  16. Two types of triplicated alpha-globin loci in humans
    Lie-Injo LE, Herrera AR, Kan YW
    Nucleic Acids Res, 1981 Aug 11;9(15):3707-17.
    PMID: 6269090
    DNA from healthy Malaysian newborns was studied on gene maps after digestion with different restriction endonucleases. Of 65 newborns, two were found to be carriers of two different variants of triplicated alpha-globin loci. In variant no. 1, found in an Malay, the three alpha-globin genes are in an elongated DNA fragment on digestion with Eco RI and Bam HI. The third alpha-globin gene was found in a additional 3.7-kb fragment on digestion with Hpa I, Bgl II and Hind III. In variant no. 2, a new type of triplicated alpha-globin loci, found in a Chinese, the three alpha-globin genes reside in an elongated DNA fragment longer than that of variant no. 1 on digestion with Eco RI and Bam HI. The third alpha-globin gene was found in an additional 4.2-kb fragment on digestion with Hpa I and Hind III. Digestion of this variant DNA with Bg1 II produced an abnormal 16.7-kb fragment in addition to the normal 7.0-kb Bgl-II fragment. The locations of the restriction sites in the two types of triplicated alpha-globin loci are compatible with a mechanism of unequal crossing over following two different modes of misalignment.
    Matched MeSH terms: Hemoglobins, Abnormal/genetics
  17. A molecular marker associated with mild hemoglobin H disease
    George E, Ferguson V, Yakas J, Kronenberg H, Trent RJ
    Pathology, 1989 Jan;21(1):27-30.
    PMID: 2762043
    The clinical spectrum of HbH disease varies from a benign disorder to a severe anemia which is blood-transfusion dependent. Heterogeneity at the clinical level is now being understood in terms of the underlying molecular defects. In this study a mild phenotype found in a group of patients with HbH disease is associated with two types of alpha-thalassemia. These are: alpha+-thalassemia (-alpha 3.7/) and alpha 0-thalassemia (--SEA/). In contrast, a second group with more severe HbH disease has a non-deletional alpha-thalassemia defect instead of alpha+-thalassemia (genotype alpha alpha T/--SEA). In the majority of cases, the basis for non-deletional alpha-thalassemia is Hb Constant Spring.
    Matched MeSH terms: Hemoglobins, Abnormal/genetics*
  18. Haemoglobin Constant Spring (HbA2: c.427T>C) and Haemoglobin Adana (HbA2: c.179G>A) in jaundiced Malaysian term neonates with clinically significant hyperbilirubinemia
    Shwe S, Boo NY, Ong HK, Chee SC, Maslina M, Ling MMM, et al.
    Malays J Pathol, 2020 Aug;42(2):253-257.
    PMID: 32860378
    INTRODUCTION: Haemoglobin Constant Spring (Hb CoSp) and Haemoglobin Adana (Hb Adana), are two non-deletion type of α-thalassemia reported in Malaysia. Owing to their structural instability, they cause hemolysis and hyperbilirubinemia. This observational study was part of a large study investigating multiple factors associated with severe neonatal jaundice. In this part we aimed to determine the prevalence of Hb CoSp and Hb Adana and their association with clinically significant neonatal hyperbilirubinemia (SigNH, total serum bilirubin (TSB>290µmol/L)) among jaundiced Malaysian term neonates.

    MATERIALS AND METHODS: The inclusion criteria were normal term-gestation neonates admitted consecutively for phototherapy. PCR-restriction fragment length polymorphism method was applied on DNA extracted from dry blood spot specimens of each neonate to detect for Hb CoSp and Hb Adana gene. Positive samples were verified by gene sequencing.

    RESULTS: Of the 1121 neonates recruited (719 SigNH and 402 no-SigNH), heterozygous Hb CoSp gene was detected in only two (0.27%) neonates. Both were SigNH neonates (0.3% or 2/719). No neonate had Hb Adana variant.

    CONCLUSION: Hb CoSp was not common but could be a risk factor associated with SigNH. No Hb Adana was detected.

    Matched MeSH terms: Hemoglobins, Abnormal/genetics*
  19. Molecular characterization of beta-globin gene mutations in Malay patients with Hb E-beta-thalassaemia and thalassaemia major
    Yang KG, Kutlar F, George E, Wilson JB, Kutlar A, Stoming TA, et al.
    Br J Haematol, 1989 May;72(1):73-80.
    PMID: 2736244
    This study concerned the identification of the beta-thalassaemia mutations that were present in 27 Malay patients with Hb E-beta-thalassaemia and seven Malay patients with thalassaemia major who were from West Malaysia. Nearly 50% of all beta-thalassaemia chromosomes carried the G----C substitution at nucleotide 5 of IVS-I; the commonly occurring Chinese anomalies such as the frameshift at codons 41 and 42, the nonsense mutation A----T at codon 17, the A----G substitution at position -28 of the promoter region, and the C----T substitution at position 654 of the second intron, were rare or absent. Two new thalassaemia mutations were discovered. The first involves a frameshift at codon 35 (-C) that was found in two patients with Hb E-beta zero-thalassaemia and causes a beta zero-thalassaemia because a stop codon is present at codon 60. The second is an AAC----AGC mutation in codon 19 that was present on six chromosomes. This substitution results in the production of an abnormal beta chain (beta-Malay) that has an Asn----Ser substitution at position beta 19. Hb Malay is a 'Hb Knossos-like' beta +-thalassaemia abnormality; the A----G mutation at codon 19 likely creates an alternate splicing site between codons 17 and 18, reducing the efficiency of the normal donor splice site at IVS-I to about 60%.
    Matched MeSH terms: Hemoglobins, Abnormal/genetics*
  20. Fulltext Detection of α-thalassaemia in neonates on cord blood and dried blood spot samples by capillary electrophoresis
    Alauddin H, Langa M, Mohd Yusoff M, Raja Sabudin RZA, Ithnin A, Abdul Razak NF, et al.
    Malays J Pathol, 2017 Apr;39(1):17-23.
    PMID: 28413201 MyJurnal
    INTRODUCTION: Haemoglobin Bart's (Hb Bart's) level is associated with α-thalassaemia traits in neonates, enabling early diagnosis of α-thalassaemia. The study aimed to detect and quantify the Hb Bart's using Cord Blood (CB) and CE Neonat Fast Hb (NF) progammes on fresh and dried blood spot (DBS) specimen respectively by capillary electrophoresis (CE).

    METHODS: Capillarys Hemoglobin (E) Kit (for CB) and Capillarys Neonat Hb Kit (for NF) were used to detect and quantify Hb Bart's by CE in fresh cord blood and dried blood spot (DBS) specimens respectively. High performance liquid chromatography (HPLC) using the β-Thal Short Programme was also performed concurrently with CE analysis. Confirmation was obtained by multiplex ARMS Gap PCR.

    RESULTS: This study was performed on 600 neonates. 32/600 (5.3%) samples showed presence of Hb Bart's peak using the NF programme while 33/600 (5.5%) were positive with CB programme and HPLC methods. The range of Hb Bart's using NF programme and CB programme were (0.5-4.1%) and (0.5-7.1%), respectively. Molecular analysis confirmed all positive samples possessed α-thalassaemia genetic mutations, with 23/33 cases being αα/--SEA, four -α3.7/-α3.7, two αα/-α3.7 and three αα/ααCS. Fifty Hb Bart's negative samples were randomly tested for α-genotypes, three were also found to be positive for α-globin gene mutations. Thus, resulting in sensitivity of 91.7% and 88.9% and specificity of 100% for the Capillarys Cord Blood programme and Capillarys Neonat Fast programme respectively.

    CONCLUSION: Both CE programmes using fresh or dried cord blood were useful as a screening tool for α-thalassaemia in newborns. All methods show the same specificity (100%) with variable, but acceptable sensitivities in the detection of Hb Bart.
    Matched MeSH terms: Hemoglobins, Abnormal/metabolism*
Related Terms
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links