MyMedR

Displaying publications 41 - 60 of 84 in total

Abstract:

Sort:

Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations

Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.

Public Health Genomics, 2015;18(1):60-4.
PMID: 25412720 DOI: 10.1159/000368342

BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
Fulltext Genome-wide association study of susceptibility to infection by Mycobacterium avium subspecies paratuberculosis in Holstein cattle

Alpay F, Zare Y, Kamalludin MH, Huang X, Shi X, Shook GE, et al.

PLoS One, 2014;9(12):e111704.
PMID: 25473852 DOI: 10.1371/journal.pone.0111704

Paratuberculosis, or Johne's disease, is a chronic, granulomatous, gastrointestinal tract disease of cattle and other ruminants caused by the bacterium Mycobacterium avium, subspecies paratuberculosis (MAP). Control of Johne's disease is based on programs of testing and culling animals positive for infection with MAP while concurrently modifying management to reduce the likelihood of infection. The current study is motivated by the hypothesis that genetic variation in host susceptibility to MAP infection can be dissected and quantifiable associations with genetic markers identified. For this purpose, a case-control, genome-wide association study was conducted using US Holstein cattle phenotyped for MAP infection using a serum ELISA and/or fecal culture test. Cases included cows positive for either serum ELISA, fecal culture or both. Controls consisted of animals negative for the serum ELISA test or both serum ELISA and fecal culture when both were available. Controls were matched by herd and proximal birth date with cases. A total of 856 cows (451 cases and 405 controls) were used in initial discovery analyses, and an additional 263 cows (159 cases and 104 controls) from the same herds were used as a validation data set. Data were analyzed in a single marker analysis controlling for relatedness of individuals (GRAMMAR-GC) and also in a Bayesian analysis in which multiple marker effects were estimated simultaneously (GenSel). For the latter, effects of non-overlapping 1 Mb marker windows across the genome were estimated. Results from the two discovery analyses were generally concordant; however, discovery results were generally not well supported in analysis of the validation data set. A combined analysis of discovery and validation data sets provided strongest support for SNPs and 1 Mb windows on chromosomes 1, 2, 6, 7, 17 and 29.
HbA2 levels in β-thalassaemia carriers with the Filipino β0-deletion: are the levels higher than what is found with non-deletional forms of β0-thalassaemia?

George E, Teh LK, Tan J, Lai MI, Wong L

Pathology, 2013 01;45(1):62-5.
PMID: 23222244 DOI: 10.1097/PAT.0b013e32835af7c1

AIMS: Classical carriers of β-thalassaemia are identified by a raised HbA2 level. Earlier studies indicated that the Filipino β-deletion has high raised HbA2 levels. The introduction of automated high performance liquid chromatography (HPLC) for thalassaemia screening is an important advance in technology for haematology laboratories. The BioRad Variant II Hb analyser is a common instrument used to quantify HbA2 levels in thalassaemia screening. This study aimed to determine HbA2 levels in carriers of Filipino β-mutation using the BioRad Variant II Hb analyser.
METHODS: The Filipino β-deletion was identified using gap-polymerase chain reaction (PCR) in the parents of transfusion dependent β-thalassaemia patients who were homozygous for the Filipino β-deletion in the indigenous population of Sabah, Malaysia. Hb subtypes were quantified on the BioRad Variant II Hb analyser. Concurrent α-thalassaemia was identified by multiplex gap-PCR for deletions and amplification refractory mutation system (ARMS)-PCR for non-deletional mutations.
RESULTS: The mean HbA2 level for Filipino β-thalassaemia trait was 5.9 ± 0.47 and with coinheritance of α-thalassaemia was 6.3 ± 0.44 (-α heterozygous) and 6.7 ± 0.36 (-α homozygous). The HbA2 levels were all >4% in keeping with the findings of classical β-thalassaemia trait and significantly higher than levels seen in non-deletional forms of β-thalassaemia.
CONCLUSION: The HbA2 level measured on the BioRad Variant II Hb analyser was lower than the level in the first description of the Filipino β-thalassaemia. β-thalassaemia trait with coinheritance of α-thalassaemia (-α) is associated with significantly higher HbA2 level.
Characterisation and confirmation of rare beta-thalassaemia mutations in the Malay, Chinese and Indian ethnic groups in Malaysia

Tan JA, Chin PS, Wong YC, Tan KL, Chan LL, George E

Pathology, 2006 Oct;38(5):437-41.
PMID: 17008283

In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations.
A molecular marker associated with mild hemoglobin H disease

George E, Ferguson V, Yakas J, Kronenberg H, Trent RJ

Pathology, 1989 Jan;21(1):27-30.
PMID: 2762043

The clinical spectrum of HbH disease varies from a benign disorder to a severe anemia which is blood-transfusion dependent. Heterogeneity at the clinical level is now being understood in terms of the underlying molecular defects. In this study a mild phenotype found in a group of patients with HbH disease is associated with two types of alpha-thalassemia. These are: alpha+-thalassemia (-alpha 3.7/) and alpha 0-thalassemia (--SEA/). In contrast, a second group with more severe HbH disease has a non-deletional alpha-thalassemia defect instead of alpha+-thalassemia (genotype alpha alpha T/--SEA). In the majority of cases, the basis for non-deletional alpha-thalassemia is Hb Constant Spring.
Fulltext Functional single nucleotide polymorphisms within the cyclin-dependent kinase inhibitor 2A/2B region affect pancreatic cancer risk

Campa D, Pastore M, Gentiluomo M, Talar-Wojnarowska R, Kupcinskas J, Malecka-Panas E, et al.

Oncotarget, 2016 08 30;7(35):57011-57020.
PMID: 27486979 DOI: 10.18632/oncotarget.10935

The CDKN2A (p16) gene plays a key role in pancreatic cancer etiology. It is one of the most commonly somatically mutated genes in pancreatic cancer, rare germline mutations have been found to be associated with increased risk of developing familiar pancreatic cancer and CDKN2A promoter hyper-methylation has been suggested to play a critical role both in pancreatic cancer onset and prognosis. In addition several unrelated SNPs in the 9p21.3 region, that includes the CDNK2A, CDNK2B and the CDNK2B-AS1 genes, are associated with the development of cancer in various organs. However, association between the common genetic variability in this region and pancreatic cancer risk is not clearly understood. We sought to fill this gap in a case-control study genotyping 13 single nucleotide polymorphisms (SNPs) in 2,857 pancreatic ductal adenocarcinoma (PDAC) patients and 6,111 controls in the context of the Pancreatic Disease Research (PANDoRA) consortium. We found that the A allele of the rs3217992 SNP was associated with an increased pancreatic cancer risk (ORhet=1.14, 95% CI 1.01-1.27, p=0.026, ORhom=1.30, 95% CI 1.12-1.51, p=0.00049). This pleiotropic variant is reported to be a mir-SNP that, by changing the binding site of one or more miRNAs, could influence the normal cell cycle progression and in turn increase PDAC risk. In conclusion, we observed a novel association in a pleiotropic region that has been found to be of key relevance in the susceptibility to various types of cancer and diabetes suggesting that the CDKN2A/B locus could represent a genetic link between diabetes and pancreatic cancer risk.
Fulltext Genetic variants in HBS1L-MYB with Hb subtypes level among Filipino β°-deletion carriers coinherited with -α3.7 deletion

Lim, L. N., Yu, K. S., Chua, S. M., George, E., Lai, M. I., Wong, L., et al.

Malaysian Journal of Medicine and Health Sciences, 2019;15(102):47-47.
MyJurnal

Introduction: Filipino β°-deletion is predominant among the β-thalassaemia patients in the indigenous population of Sabah, Malaysia particularly among the Kadazandusun. Individuals who co-inherit with α- and β-thalassaemia will demonstrate milder clinical symptoms with modified complete blood count (CBC) and Hb subtype parameters. HBS1L-MYB variants act as one of the key regulator of haematopoiesis and erythropoiesis and display strong association
with variation of HbF levels. Therefore, this study aims to evaluate the association between genetic variants in HBS1L-MYB with Hb subtypes level among Filipino β°-deletion carriers co-inherited with -α3.7 deletion. Methods: Filipino β°-deletion and -α3.7 deletion were identified using gap-polymerase chain reaction (PCR). A total of 34 subjects found with coinheritance of Filipino β°-deletion and -α3.7 deletion were subjected for HBS1L-MYB intergenic polymorphisms (HMIP) analysis. Hb subtypes level were quantified using BioRad Variant II Hb analyser. Genotyping of HBS1L-MYB variants rs9399137 and rs11759553 was done using own designed tetra primer ARMS-PCR. Results: The minor allele frequencies (MAF) of the two HMIP is found more than 0.05 (rs11759553, MAF=0.18 and rs9399137, MAF=0.15), indicating the significance of these variants among the study subjects. Significant difference was found between HbF level and HBS1L-MYB variant rs11759553 with p-value less than 0.05 (p=0.001). Subjects with homozygous genotype for rs11759553 (T/T) was found with higher HbF, followed by heterozygous (A/T) and wild type (A/A). rs11759553 and rs9399137 was found did not influence the level of HbA and HbA2. HMIP of rs11759553 and rs9399137 are found significant among Filipino β°-deletion carriers co-inherited with -α3.7deletion with its high minor allelic frequency and high HbF level. Strong association with HbF level was demonstrated when
coinheritance of rs11759553. Conclusion: This study demonstrates that there are significant associations between certain genetic variants in HBS1L-MYB with Hb subtypes level among Filipino β°-deletion carriers co-inherited with -α3.7 deletion.
Fulltext Serum soluble transferrin receptor concentration as a biomarker of erythropoietic activity: surrogate marker of adequate transfusion in adult beta-thalassaemia intermedia patients

Thambiah, S., George, E., Nor Aini, U., Sathar, J., Zarida, H., Mokhtar, A.B.

Malaysian Journal of Medicine and Health Sciences, 2013;9(2):3-12.
MyJurnal

Management of Beta (β)-thalassaemia intermedia in contrast to β-thalassaemia major patients has no clear guidelines as to indicators of adequate transfusion. Regular blood transfusion suppresses bone marrow erythropoietic activity. Serum soluble transferrin receptor (sTfR) concentration is a marker for erythropoietic activity, with increased sTfR being associated with functional iron deficiency and increased erythropoietic activity. This study aimed to determine the use of sTfR as an indicator of adequate transfusion in adult β-thalassaemia intermedia patients. A cross-sectional study was conducted at Hospital Ampang, Malaysia, for six months. Patient group included six β-thalassaemia intermedia and 34 HbE-β-thalassaemia transfused patients. None of the patients were on regular monthly blood transfusions as in β-thalassaemia major. The control group comprised of 16 healthy subjects with normal haematological parameters. Haemoglobin (Hb) analysis, sTfR and ferritin assays were performed. Hb and HbA percentages (%) were found to be significantly lower in patients compared to the controls, while HbE%, HbF%, sTfR and ferritin were significantly higher in patients. An inverse relationship was found in the controls between HbF% with Hb (r = -0.515, p < 0.05) and HbA% (r = -0.534, p < 0.05). In patients, sTfR showed an inverse relationship with HbA% (r = -0.618, p = 0.000) and a positive correlation with HbE% (r = 0.418, p = 0.007) and HbF% (r = 0.469, p = 0.002). Multivariate analysis showed that HbA% (r = 2.875, p = 0.048), HbE% (r = 2.872, p = 0.020) and HbF% (r = 2.436, p = 0.013) best predicted sTfR independently in patients. Thus, sTfR is a useful marker for erythropoiesis. The elevated sTfR in these patients indicate that the transfusion regimen used was inadequate to suppress ineffective erythropoiesis. Hb levels may not be the best target for monitoring transfusion treatment in β-thalassaemia intermedia patients, but the use of sTfR is helpful in individualising transfusion regimens.
Fulltext Anaemia in type 2 diabetes mellitus (T2DM) patients in Hospital Putrajaya

Thambiah CS, Samsudin IN, George E, Ranjit LK, Saat NS, Hussein Z, et al.

Malaysian Journal of Medicine and Health Sciences, 2015;11(1):49-62.
MyJurnal

Patients with diabetes have an earlier onset and increased severity of anaemia compared to those with similar degree of renal impairment from other causes. Anaemia is associated with an increased risk of vascular complications. In this study, we determined the prevalence of anaemia in T2DM patients and its association with sociodemographic, clinical and laboratory parameters in an endocrine tertiary hospital in Malaysia. This was a cross-sectional study using retrospective electronic data from January 2011 to December 2013 of 165 T2DM patients in Hospital Putrajaya. Data was analysed using IBM SPSS Statistics version 21.0 for Windows. The prevalence of anaemia was 39.4% and majority had normocytic normochromic (80%), mild (58.5%) anaemia. Majority were Malays (73.9%), aged below 60 with comparable gender percentage and long-standing, poorly-controlled DM [median fasting blood sugar (FBS) 8mmol/L; glycated haemoglobin (HbA1c) 7.9%]. Using the KDIGO chronic kidney disease (CKD) staging system, 86% of these patients were in stages 3-5. Anaemic patients had a significantly higher serum urea, creatinine and a lower FBS, estimated glomerular filtration rate (eGFR) compared to non-anaemic patients. Anaemic patients with diabetic nephropathy had a significantly lower haemoglobin (Hb) compared to those without this complication (p=0.022). The sensitivity and specificity at a cut-off eGFR value of 38.3 ml/min/1.73 m2 (maximum Youden index = 0.462) was 66.7% and 79.5%, respectively to discriminate mild from moderate anaemia. This study shows that anaemia is already present in T2DM patients in Hospital Putrajaya at initial presentation to the specialist outpatient clinic and is significantly associated with CKD. Hence, it emphasises the obligatory need for routine and follow-up full blood count monitoring in T2DM patients in primary care as well as tertiary settings in Malaysia to enable early detection and aggressive correction of anaemia in preventing further complications.

Study site: endocrine clinic, Hospital Putrajaya
Fulltext Identification of αo-thalassaemia (–SEA) using an Enzyme- Linked Immunosorbent Assay (ELISA) for embryonic zeta-globin chain detection – a preliminary study

Tan, J. A. M. A., George, E., Lim, E. J., Zakaria, Z., Hassan, R., Wee, Y. C., et al.

Malaysian Journal of Medicine and Health Sciences, 2006;2(2):81-87.
MyJurnal

Objectives: This study aimed to evaluate the UBI MAGIWELTM ζ-GLOBIN ELISA Kit for the presumptive diagnosis of αo-thalassaemia. The ELISA results obtained were confirmed by molecular characterisation of αo-thalassaemia using a Duplex-PCR. Methods: Routine peripheral blood counts and red cell indices were determined in 94 blood samples sent for Hb analysis. Hb subtypes were quantified by high performance liquid chromatography (HPLC) and Hb electrophoresis conducted on agarose gel at pH 8.5. Zeta-globin chain levels were determined using the UBI MAGIWELTM ζ-GLOBIN ELISA Kit. Molecular analysis was performed using a duplex-PCR which simultaneously amplifies
a normal 136 bp sequence between the ψα−α2-globin genes and a 730 bp Southeast Asian deletion-specific sequence (–SEA) between the ψα2−θ1-globin genes. Results: Using the ELISA assay kit, 20 blood samples were presumptively identified as α-thalassaemia carriers from elevated ζ-globin chains (OD>0.3) while the remaining 74 blood samples showed OD
Fulltext Prevalence of dyslipidaemia in type 2 diabetes mellitus patients and Its association to diabetic retinopathy in a Malaysian tertiary hospital

Samsudin IN, Md Saleh R, Thambiah SC, Mohamad Amir Hamzah AS, Wan Khalik WNF, George E

Malaysian Journal of Medicine and Health Sciences, 2014;10(2):47-51.
MyJurnal

Background: Diabetic retinopathy (DR) is a microvascular complication of diabetes, which is a cause of visual impairment and blindness. Its development and progression have been linked to dyslipidaemia, although the link remains inconclusive.
Aim: This study aimed to determine the prevalence of dyslipidaemia among type 2 diabetic patients with DR in a tertiary setting and to determine the association between dyslipidaemia and DR severity.
Materials and methods: This was a cross sectional study using retrospective data of type 2 diabetic patients attending the opthalmology clinic of a tertiary centre from January 2007 to June 2014. Results of their fasting lipid profile and clinical data were retrieved from the hospital information system.
Results: A total of 178 patient’s data were collected. 120 (n=67.4%) patients had non-proliferative diabetic retinopathy (NDPR) with moderate NPDR being the most prevalent. Dyslipidaemia was noted in 151 (84.8%) of the patients. Patients had a combination of more than one abnormality in the lipid profile with increased LDL-cholesterol being the main abnormality. Dyslipidaemia was however, not significantly associated with DR severity.
Conclusion: Dyslipidaemia was highly prevalent in DR patients. The dyslipidaemia was however not associated with severity of DR.
Study site: Ophthalmology clinic, Hospital (?name), Malaysia
Fulltext Beta thalassaemia mutations in Malays: a simplified cost-effective strategy to identify the mutations

George, E., Teh, L.K., Rosli, R., Lai, M.I., Tan, J.A.M.A.

Malaysian Journal of Medicine and Health Sciences, 2012;8(1):45-53.
MyJurnal

Beta (β)- thalassaemia is a public health problem in Malaysia. The carrier rate is estimated to be 4.5% by micro-mapping studies particularly among Malays who comprise 53.5% of the population in Malaysia. The common diagnostic method in Malaysia for mutation detection is by amplification refractory mutation system (ARMS). It allows single mutation detection in each reaction but is labour intensive and time consuming when many mutations need to be identified. The purpose of this study was to develop a diagnostic tool for effective mutation detection of beta thalassaemia in Malay patients and compare its efficacy with ARMS-PCR, the current method in use. Methods: Reverse dot blot hybridization (RDBH) technique was incorporated in the development of two strip assays [RDBH-Strip M(6) and RDBH-Strip C(6)] to identify common beta thalassaemia mutations in the Malays. The panels of selected mutations were based on the mutation frequencies in Malaysia reported in previous studies. RDBH-Strip M(6) was applied as step 1 and RDBH-Strip C(6) was applied as step 2 for unidentified mutations. The strips were validated with the gold standard method, ARMS- PCR. Results: One hundred and thirty seven Malay patients with 274 alleles were studied. In Step 1 mutation detection, 238 alleles (86.9%) were identified in 119 of patients by RDBH-Strip M(6). Step 2 resulted in a further detection of 20 alleles in another 10 patients by RDBH-Strip C(6). The combination of both strips resulted in the identification of 258 alleles in 129 (94.6%) of 137 Malay patients. The strip assays were 100% sensitive and specific when compared with ARMS-PCR method. Conclusion: Two strip assays utilising the RDBH technique were developed to identify common β-thalassaemia mutations in Malays. The RDBH Strip M(6) identified 86.9% of the mutations and the RDBH-Strip C (6) detected further 7.3% alleles. This two step strategy was found to be rapid and cost effective for the direct diagnosis of β-thalassaemia mutations in the Malays. The remaining unidentified mutations would require DNA sequencing. It can serve as a specific molecular diagnostic tool for effective diagnosis of
β-thalassaemia mutations in this ethnic group.
Fulltext Monoclonal gammopathy with systemic amyloidosis: an evaluation of diagnostic elements

Subashini, C. T., George, E., Nor Aini, U.

Malaysian Journal of Medicine and Health Sciences, 2011;7(1):51-55.
MyJurnal

Monoclonal gammopathies result from an overproduction of a single abnormal clone of plasma cell
or B lymphocyte that produce an immunologically homogenous immunoglobulin (Ig) commonly referred to as paraprotein or monoclonal (M) protein. The circulating M-protein may consist of an intact immunoglobulin, the light chain only, or (rarely) the heavy chain only. The heavy chain is from one of the five immunoglobulin classes G, A, M, D or E, while the light chain is either kappa (κ) or lambda (λ) in type. Accurate detection and quantitation of monoclonal immunoglobulins is important for the diagnosis and management of monoclonal gammopathies. We report a case of a 71 year old lady with a history of chronic gastritis and recurrent lower respiratory tract infection whereby no specific diagnosis was made until a computed tomography (CT) guided lung biopsy and orogastroduodenoscopy (OGDS) 5 years later from the onset of initial symptoms revealed pulmonary and gastric amyloidosis, respectively.
Fulltext Screening for thalassaemia in pregnant women: a laboratory perspective

George E, Khoo SK, Mokhtar AB, Nor Aini U

Malaysian Journal of Medicine and Health Sciences, 2005;1(2):111-117.

Aims: To investigate whether in Malaysia, a mean corpuscular volume (MCV) less than 80 fl and a mean corpuscular haemoglobin (MCH) less than 27 pg will identify carriers in pregnant women with severe forms of thalassaemia, a-thal 1 (a0) and classical b (b0)-thalassaemia. The results from this study will aid the implementation of a national program to screen for thalassaemia.
Methods: For classical b (b0)-thalassaemia, blood samples collected in EDTA from 153 pregnant women were taken for full blood counts and haemoglobin subtyping by automated blood counting and high performance liquid chromatography (HPLC) respectively. For a-thal 1 (a0), the full blood counts were obtained from archives of 30 pregnant women who were genotyped positive for the a-thal 1 (a0) during prenatal diagnosis for Hb Barts hydrops fetalis. The effects of storage on MCV, MCH and Hb A2 were determined by tests done daily for 3 weeks.
Results: By correlating red cell indices with high performance liquid chromatography and genotypic data, we show that mean corpuscular volume (MCV) <80 fl and mean corpuscular haemoglobin <27pg is able to detect all heterozygous carriers of a-thal 1 (a0) and classical b (b0)-thalassaemia. On storage, the MCV of heterozygous carriers with classical b (b0)-thalassaemia rose at 1% a day after 24 hours reaching a mean of 80 fl by day 15. However, the MCH and Hb A2 were stable for 3 weeks.
Conclusion: A mean corpuscular volume (MCV) <80 fl and mean corpuscular haemoglobin <27pg should be recommended as cut-off values for screening of carriers of a-thal 1 (a0) and classical b (b0)-thalassaemia. In blood samples, not processed within a day, MCH with a cut-off value of 27 pg is the recommended choice for screening of carriers. Keywords: Screen, thalassaemia, pregnant, MCV, MCH
Hearing loss: a global health issue

Looi LM, Ganten D, McGrath PF, Gross M, Griffin GE

Lancet, 2015 Mar 14;385(9972):943-4.
PMID: 25743174 DOI: 10.1016/S0140-6736(15)60208-2
Molecular basis of transfusion dependent beta-thalassemia major patients in Sabah

Teh LK, George E, Lai MI, Tan JA, Wong L, Ismail P

J Hum Genet, 2014 Mar;59(3):119-23.
PMID: 24369358 DOI: 10.1038/jhg.2013.131

Beta-thalassemia is one of the most prevalent inherited diseases and a public health problem in Malaysia. Malaysia is geographically divided into West and East Malaysia. In Sabah, a state in East Malaysia, there are over 1000 estimated cases of β-thalassemia major patients. Accurate population frequency data of the molecular basis of β-thalassemia major are needed for planning its control in the high-risk population of Sabah. Characterization of β-globin gene defects was done in 252 transfusion dependent β-thalassemia patients incorporating few PCR techniques. The study demonstrates that β-thalassemia mutations inherited are ethnically dependent. It is important to note that 86.9% of transfusion-dependent β-thalassemia major patients in Sabah were of the indigenous population and homozygous for a single mutation. The Filipino β(0)-deletion was a unique mutation found in the indigenous population of Sabah. Mutations common in West Malaysia were found in 11 (4.3%) patients. Four rare mutations (Hb Monroe, CD 8/9, CD 123/124/125 and IVS I-2) were also found. This study is informative on the population genetics of β-thalassemia major in Sabah.
Fulltext A holistic approach to education programs in thalassemia for a multi-ethnic population: consideration of perspectives, attitudes, and perceived needs

Wong LP, George E, Tan JA

J Community Genet, 2011 Jun;2(2):71-9.
PMID: 22109791 DOI: 10.1007/s12687-011-0039-z

Hemoglobin disorders which include thalassemias are the most common heritable disorders. Effective treatment is available, and these disorders can be avoided as identification of carriers is achievable using simple hematological tests. An in-depth understanding of the awareness, attitudes, perceptions, and screening reservations towards thalassemia is necessary, as Malaysia has a multi-ethnic population with different religious beliefs. A total of 13 focus group discussions (70 participants) with members of the general lay public were conducted between November 2008 and January 2009. Lack of knowledge and understanding about thalassemia leads to general confusions over differences between thalassemia carriers and thalassemia major, inheritance patterns, and the physical and psychologically impact of the disorder in affected individuals and their families. Although most of the participants have not been tested for thalassemia, a large majority expressed willingness to be screened. Views on prenatal diagnosis and termination of fetuses with thalassemia major received mixed opinions from participants with different religions and practices. Perceived stigma and discrimination attached to being a carrier emerged as a vital topic in some group discussions where disparity in the answers exhibited differences in levels of participants' literacy and ethnic origins. The two most common needs identified from the discussion were information and screening facilities. Participants' interest in knowing the severity of the disease and assessing their risk of getting the disorder may imply the health belief model as a possible means of predicting thalassemia public screening services. Findings provide valuable insights for the development of more effective educational, screening, and prenatal diagnostic services in the multi-ethnic Asian society.
Fulltext High prevalence of alpha- and beta-thalassemia in the Kadazandusuns in East Malaysia: challenges in providing effective health care for an indigenous group

Tan JA, Lee PC, Wee YC, Tan KL, Mahali NF, George E, et al.

J Biomed Biotechnol, 2010;2010.
PMID: 20871816 DOI: 10.1155/2010/706872

Thalassemia can lead to severe transfusion-dependent anemia, and it is the most common genetic disorder in Malaysia. This paper aims to determine the prevalence of thalassemia in the Kadazandusuns, the largest indigenous group in Sabah, East Malaysia. α- and β-thalassemia were confirmed in 33.6% and 12.8%, of the individuals studied respectively. The high prevalence of α- and β-thalassemia in the Kadazandusuns indicates that thalassemia screening, genetic counseling, and prenatal diagnosis should be included as part of their healthcare system. This preliminary paper serves as a baseline for further investigations into the health and genetic defects of the major indigenous population in Sabah, East Malaysia.
The use of Taqman genotyping assays for rapid confirmation of β-thalassaemia mutations in the Malays: accurate diagnosis with low DNA concentrations

Teh LK, Lee TY, Tan JA, Lai MI, George E

Int J Lab Hematol, 2015 Feb;37(1):79-89.
PMID: 24725998 DOI: 10.1111/ijlh.12240

In Malaysia, β-thalassaemia is a common inherited blood disorder in haemoglobin synthesis with a carrier rate of 4.5%. Currently, PCR-incorporating techniques such as amplification refractory mutation system (ARMS) or reverse dot blot hybridization (RDBH) are used in β-thalassaemia mutation detection. ARMS allows single-mutation identification using two reactions, one for wild type and another for mutant alleles. RDBH requires probe immobilization and optimization of hybridization and washing temperatures which is time consuming. The aim of our study was to investigate whether β-thalassaemia mutations can be identified in samples with low DNA concentrations.
An assessment of three noncommercial DNA extraction methods from dried blood spots for beta-thalassaemia mutation identification

Karthipan SN, George E, Jameela S, Lim WF, Teh LK, Lee TY, et al.

Int J Lab Hematol, 2011 Oct;33(5):540-4.
PMID: 21884505 DOI: 10.1111/j.1751-553X.2011.01304.x

Dried blood spots (DBS) are currently the recommended sample collection method for newborn screening programmes in America. Early diagnosis of beta-thalassaemia screening is essential as it provides an added advantage especially in sickle cell disease. Beta-thalassaemia frequency is high in many poor countries, and the cost of using commercial DNA extraction kits can be prohibitive. Our study assessed three methods that use minimal reagents and materials to extract DNA from DBS for beta-thalassaemia identification.

Filters

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links