Displaying publications 41 - 56 of 56 in total

Abstract:
Sort:
  1. Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
    Matched MeSH terms: beta-Globins/genetics*
  2. Abd Rahim MR, Kho SL, Kuppusamy UR, Tan JA
    Clin. Lab., 2015;61(9):1325-30.
    PMID: 26554253
    BACKGROUND: Beta-thalassemia is the most common genetic disorder in Malaysia. Confirmation of the β-globin gene mutations involved in thalassemia is usually carried out by molecular analysis of DNA extracted from leukocytes in whole blood. Molecular analysis is generally carried out when affected children are around 1 - 2 years as clinical symptoms are expressed during this period. Blood taking at this age can be distressing for the child. High yield and pure DNA extracted from non-invasive sampling methods can serve as alternative samples in molecular studies for genetic diseases especially in pediatric cases.

    METHODS: In this study, mouthwash, saliva, and buccal cytobrush samples were collected from β-thalassemia major patients who had previously been characterized using DNA extracted from peripheral blood. DNA was extracted from mouthwash, saliva, and buccal cytobrush samples using the conventional inexpensive phenol-chloroform method and was measured by spectrophotometry for yield and purity. Molecular characterization of β-globin gene mutations was carried out using the amplification refractory mutation system (ARMS).

    RESULTS: DNA extracted from mouthwash, saliva, and buccal cytobrush samples produced high concentration and pure DNA. The purified DNA was successfully amplified using ARMS. Results of the β-globin gene mutations using DNA from the three non-invasive samples were in 100% concordance with results from DNA extracted from peripheral blood.

    CONCLUSIONS: The conventional in-house developed methods for non-invasive sample collection and DNA extraction from these samples are effective and negate the use of more expensive commercial kits. In conclusion, DNA extracted from mouthwash, saliva, and buccal cytobrush samples provided sufficiently high amounts of pure DNA suitable for molecular analysis of β-thalassemia.

    Matched MeSH terms: beta-Globins/genetics*
  3. Teh AH, Saito JA, Najimudin N, Alam M
    Sci Rep, 2015;5:11407.
    PMID: 26094577 DOI: 10.1038/srep11407
    Globins are haem-binding proteins with a conserved fold made up of α-helices and can possess diverse properties. A putative globin-coupled sensor from Methylacidiphilum infernorum, HGbRL, contains an N-terminal globin domain whose open and closed structures reveal an untypical dimeric architecture. Helices E and F fuse into an elongated helix, resulting in a novel site-swapped globin fold made up of helices A-E, hence the distal site, from one subunit and helices F-H, the proximal site, from another. The open structure possesses a large cavity binding an imidazole molecule, while the closed structure forms a unique Lys-His hexacoordinated species, with the first turn of helix E unravelling to allow Lys52(E10) to bind to the haem. Ligand binding induces reorganization of loop CE, which is stabilized in the closed form, and helix E, triggering a large conformational movement in the open form. These provide a mechanical insight into how a signal may be relayed between the globin domain and the C-terminal domain of HGbRL, a Roadblock/LC7 domain. Comparison with HGbI, a closely related globin, further underlines the high degree of structural versatility that the globin fold is capable of, enabling it to perform a diversity of functions.
    Matched MeSH terms: Globins/genetics
  4. Lee TY, Muniandy L, Teh LK, Abdullah M, George E, Sathar J, et al.
    Turk J Haematol, 2016 Mar 05;33(1):15-20.
    PMID: 26377036 DOI: 10.4274/tjh.2014.0197
    The diverse clinical phenotype of hemoglobin E (HbE)/β-thalassemia has not only confounded clinicians in matters of patient management but has also led scientists to investigate the complex mechanisms involved in maintaining the delicate red cell environment where, even with apparent similarities of α- and β-globin genotypes, the phenotype tells a different story. The BTB and CNC homology 1 (BACH1) protein is known to regulate α- and β-globin gene transcriptions during the terminal differentiation of erythroid cells. With the mutations involved in HbE/β-thalassemia disorder, we studied the role of BACH1 in compensating for the globin chain imbalance, albeit for fine-tuning purposes.
    Matched MeSH terms: Globins/genetics*
  5. Etemad A, Vasudevan R, Aziz AF, Yusof AK, Khazaei S, Fawzi N, et al.
    Genet. Mol. Res., 2016 Apr 07;15(2).
    PMID: 27173202 DOI: 10.4238/gmr.15025845
    Type 2 diabetes mellitus (T2DM) is believed to be associated with excessive production of reactive oxygen species. Glutathione S-transferase (GST) polymorphisms result in decreased or absent enzyme activity and altered oxidative stress, and have been associated with cardiovascular disease (CVD). The present study assessed the effect of GST polymorphisms on the risk of developing T2DM in individuals of Malaysian Malay ethnicity. A total of 287 subjects, consisting of 87 T2DM and 64 CVD/T2DM patients, as well as 136 healthy gender- and age-matched controls were genotyped for selected polymorphisms to evaluate associations with T2DM susceptibility. Genomic DNA was extracted using commercially available kits, and GSTM1, GSTT1, and α-globin sequences were amplified by multiplex polymerase chain reaction. Biochemical parameters were measured with a Hitachi autoanalyzer. The Fisher exact test, the chi-square statistic, and means ± standard deviations were calculated using the SPSS software. Overall, we observed no significant differences regarding genotype and allele frequencies between each group (P = 0.224 and 0.199, respectively). However, in the combined analysis of genotypes and blood measurements, fasting plasma glucose, HbA1c, and triglyceride levels, followed by age, body mass index, waist-hip ratio, systolic blood pressure, and history of T2DM significantly differed according to GST polymorphism (P ˂ 0.05). Genetically induced absence of the GSTT1 enzyme is an independent and powerful predictor of premature vascular morbidity and death in individuals with T2DM, and might be triggered by cigarette smoking's oxidative effects. These polymorphisms could be screened in other ethnicities within Malaysia to determine further possible risk factors.
    Matched MeSH terms: alpha-Globins/genetics
  6. Koh DXR, Raja Sabudin RZA, Mohd Yusoff M, Hussin NH, Ahmad R, Othman A, et al.
    Ann. Hum. Genet., 2017 Sep;81(5):205-212.
    PMID: 28620953 DOI: 10.1111/ahg.12201
    Thalassaemia is a public health problem in Malaysia, with each ethnic group having their own common mutations. However, there is a lack on data on the prevalence and common mutations among the indigenous people. This cross-sectional study was performed to determine the common mutations of α- and β-thalassaemia among the subethnic groups of Senoi, the largest Orang Asli group in Peninsular Malaysia. Blood samples collected from six Senoi subethnic groups were analysed for full blood count and haemoglobin analysis (HbAn). Samples with abnormal findings were then screened for α- and β-globin gene mutations. Out of the 752 samples collected, 255 showed abnormal HbAn results, and 122 cases showing abnormal red cell indices with normal HbAn findings were subjected to molecular screening. DNA analysis revealed a mixture of α- and β-globin gene mutations with 25 concomitant cases. The types of gene abnormalities detected for α-thalassaemia were termination codon (T>C) Hb CS (αCS α), Cd59 (G>A) haemoglobin Adana (Hb Adana) (αCd59 α), initiation codon (ATG>A-G) (αIniCd α), two-gene deletion (-SEA ), and single-gene 3.7-kb deletion (-α3.7 ). For β-thalassaemia, there were Cd26 (G>A) Hb E (βE ), Cd19 (A>G) Haemoglobin Malay (Hb Malay) (βCd19 ), and IVS 1-5 (G>C) (βIVS 1-5 ).
    Matched MeSH terms: alpha-Globins/genetics*; beta-Globins/genetics*
  7. Hsu CH, Langdown J, Lynn R, Fisher C, Rose A, Proven M, et al.
    Hemoglobin, 2018 May;42(3):199-202.
    PMID: 30328734 DOI: 10.1080/03630269.2018.1513849
    We report a novel hemoglobin (Hb) variant with a β chain amino acid substitution at codon 78 (CTG>CCG) (HBB: c.236T>C), detected through prenatal screening via capillary electrophoresis (CE) in an otherwise healthy and asymptomatic 38-year-old female of Southeast Asian ancestry. The variant, named Hb Penang after the proband's Malaysian city of origin, underwent further characterization through high performance liquid chromatography (HPLC), reversed phase HPLC, Sanger sequencing, isopropanol stability testing and isoelectric focusing (IEF).
    Matched MeSH terms: beta-Globins/genetics*
  8. Alauddin H, Kamarudin K, Loong TY, Azma RZ, Ithnin A, Jalil N, et al.
    Hemoglobin, 2018 Jul;42(4):247-251.
    PMID: 30623696 DOI: 10.1080/03630269.2018.1528985
    Nondeletional α-globin mutations are known to cause more serious clinical effects than deletional ones. A rare IVS-I-1 (G>A) (HBA2: c.95+1G>A) donor splice site mutation interferes with normal splicing of pre mRNA and results in activation of a cryptic splice site as well as a frameshift mutation. Hb Adana [HBA2: c.179G>A (or HBA1)] is a highly unstable variant hemoglobin (Hb) resulting from a mutation at codon 59 on the HBA2 or HBA1 gene, recognized to cause severe α-thalassemia (α-thal) syndromes. We report a unique case of compound heterozygosity for these two mutations in a 9-year-old boy who presented with a Hb level of 5.3 g/dL and hepatomegaly at the age of 15 months. He required regular blood transfusions in view of a Hb level of <7.0 g/dL and failure to thrive. He had thalassemic red cell indices and peripheral blood film. The Hb electrophoresis only showed a raised Hb F level (3.3%) and a pre run peak but the Hb H inclusion test was negative. His father had thalassemic red cell indices but a normal Hb level. His mother had almost normal Hb levels and red cell indices. Hb Adana involving the HBA2 gene was detected by mutiplex amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) in the proband and his father. DNA sequencing of the HBA2 gene confirmed the IVS-I-1 mutation in the proband and his mother. This case highlighted the unique interaction of the IVS-I-1 mutation with Hb Adana in a young Malay boy presenting with transfusion-dependent α-thal.
    Matched MeSH terms: alpha-Globins/genetics
  9. Yang Z, Cui Q, Zhou W, Qiu L, Han B
    Mol Genet Genomic Med, 2019 06;7(6):e680.
    PMID: 30968607 DOI: 10.1002/mgg3.680
    BACKGROUND: Thalassemia is a common genetic disorder. High prevalence of thalassemia is found in South China, Southeast Asia, India, the Middle East, and the Mediterranean regions. Thalassemia was thought to exist only in southern China, but an increasing number of cases from northern China have been recently reported.

    METHODS: During 2012 to 2017, suspected thalassemia people were detected for common α- and β-thalassemia mutations by gap-Polymerase Chain Reaction (PCR) and reverse dot blot (RDB) analysis in Peking Union Medical College Hospital. One thousand and fifty-nine people with thalassemia mutations were analyzed retrospectively. We picked mutated individuals who originally came from northern areas, and conducted telephone follow-up survey in order to collect their ancestral information. Besides, we used "thalassemia", "mutation", and "Southeast Asian countries" as keywords to search the relevant studies in PubMed and Embase databases.

    RESULTS: All carriers included in our study were resided in northern China. Among them, 17.3% were native northerners and 82.7% were immigrants from southern China. Although substantial difference was found in α- and β-thalassemia ratio and detailed spectrum of α- and β-globin mutation spectrum between our data and data obtained from a previous meta-analysis literature focused on southern China, the most common gene mutations were the same. Similar β-thalassemia mutation spectrum was found among Thai, Malaysian Chinese, and Guangdong people, however, no other similarities in gene profile were found between Chinese and other ethnic groups in Southeast Asia.

    CONCLUSION: Chinese people in different areas had similar gene mutation, whereas they had significantly different mutation spectrums from other ethnic groups in Southeast Asia.

    Matched MeSH terms: alpha-Globins/genetics*; beta-Globins/genetics*
  10. Liew PS, Chen Q, Ng AWR, Chew YC, Ravin NV, Sim EUH, et al.
    Anal Biochem, 2019 10 15;583:113361.
    PMID: 31306622 DOI: 10.1016/j.ab.2019.113361
    Phage N15 protelomerase (TelN) cleaves double-stranded circular DNA containing a telomerase-occupancy-site (tos) and rejoins the resulting linear-ends to form closed-hairpin-telomeres in Escherichia coli (E. coli). Continued TelN expression is essential to support resolution of the linear structure. In mammalian cells, no enzyme with TelN-like activities has been found. In this work, we show that phage TelN, expressed transiently and stably in human and mouse cells, recapitulates its native activities in these exogenous environments. We found TelN to accurately resolve tos-DNA in vitro and in vivo within human and mouse cells into linear DNA-containing terminal telomeres that are resistant to RecBCD degradation, a hallmark of protelomerase processing. In stable cells, TelN activity was detectable for at least 60 days, which suggests the possibility of limited silencing of its expression. Correspondingly, linear plasmid containing a 100 kb human β-globin gene expressed for at least 120 h in non-β-globin-expressing mouse cells with TelN presence. Our results demonstrate TelN is able to cut and heal DNA as hairpin-telomeres within mammalian cells, providing a tool for creating novel structures by DNA resolution in these hosts. The TelN protelomerase may be useful for exploring novel technologies for genome interrogation and chromosome engineering.
    Matched MeSH terms: beta-Globins/genetics*
  11. Abdullah UYH, Ibrahim HM, Mahmud NB, Salleh MZ, Teh LK, Noorizhab MNFB, et al.
    Hemoglobin, 2020 May;44(3):184-189.
    PMID: 32586164 DOI: 10.1080/03630269.2020.1781652
    Effective prevention of β-thalassemia (β-thal) requires strategies to detect at-risk couples. This is the first study attempting to assess the prevalence of silent β-thal carriers in the Malaysian population. Hematological and clinical parameters were evaluated in healthy blood donors and patients with β-thal trait, Hb E (HBB: c.79G>A)/β-thal and β-thal major (β-TM). β-Globin gene sequencing was carried out for 52 healthy blood donors, 48 patients with Hb E/β-thal, 34 patients with β-TM and 38 patients with β-thal trait. The prevalence of silent β-thal carrier phenotypes found in 25.0% of healthy Malaysian blood donors indicates the need for clinician's awareness of this type in evaluating β-thal in Malaysia. Patients with β-TM present at a significantly younger age at initial diagnosis and require more blood transfusions compared to those with Hb E/β-thal. The time at which genomic DNA was extracted after blood collection, particularly from patients with β-TM and Hb E/β-thal, was found to be an important determinant of the quality of the results of the β-globin sequencing. Public education and communication campaigns are recommended as apparently healthy individuals have few or no symptoms and normal or borderline hematological parameters. β-Globin gene mutation characterization and screening for silent β-thal carriers in regions prevalent with β-thal are recommended to develop more effective genetic counseling and management of β-thal.
    Matched MeSH terms: beta-Globins/genetics*
  12. Kalle Kwaifa I, Lai MI, Md Noor S
    Orphanet J Rare Dis, 2020 06 29;15(1):166.
    PMID: 32600445 DOI: 10.1186/s13023-020-01429-1
    BACKGROUND: Defective synthesis of the α-globin chain due to mutations in the alpha-globin genes and/or its regulatory elements leads to alpha thalassaemia syndrome. Complete deletion of the 4 alpha-globin genes results in the most severe phenotype known as haemoglobin Bart's, which leads to intrauterine death. The presence of one functional alpha gene is associated with haemoglobin H disease, characterised by non-transfusion-dependent thalassaemia phenotype, while silent and carrier traits are mostly asymptomatic.

    MAIN BODY: Clinical manifestations of non-deletional in alpha thalassaemia are varied and have more severe phenotype compared to deletional forms of alpha thalassaemia. Literature for the molecular mechanisms of common non-deletional alpha thalassaemia including therapeutic measures that are necessarily needed for the understanding of these disorders is still in demand. This manuscript would contribute to the better knowledge of how defective production of the α-globin chains due to mutations on the alpha-globin genes and/or the regulatory elements leads to alpha thalassaemia syndrome.

    CONCLUSION: Since many molecular markers are associated with the globin gene expression and switching over during the developmental stages, there is a need for increased awareness, new-born and prenatal screening program, especially for countries with high migration impact, and for improving the monitoring of patients with α-thalassaemia.

    Matched MeSH terms: alpha-Globins/genetics
  13. Mahmud N, Maffei M, Mogni M, Forni GL, Pinto VM, Barberio G, et al.
    Genes (Basel), 2021 11 19;12(11).
    PMID: 34828427 DOI: 10.3390/genes12111821
    BACKGROUND: Hemoglobin A (Hb A) (α2β2) in the normal adult subject constitutes 96-98% of hemoglobin, and Hb F is normally less than 1%, while for hemoglobin A2 (Hb A2) (α2δ2), the normal reference values are between 2.0 and 3.3%. It is important to evaluate the presence of possible delta gene mutations in a population at high risk for globin gene defects in order to correctly diagnose the β-thalassemia carrier.

    METHODS: The most used methods for the quantification of Hb A2 are based on automated high performance liquid chromatography (HPLC) or capillary electrophoresis (CE). In particular Hb analyses were performed by HPLC on three dedicated devices. DNA analyses were performed according to local standard protocols.

    RESULTS: Here, we described eight new δ-globin gene variants discovered and characterized in some laboratories in Northern Italy in recent years. These new variants were added to the many already known Hb A2 variants that were found with an estimated frequency of about 1-2% during the screening tests in our laboratories.

    CONCLUSIONS: The knowledge recognition of the delta variant on Hb analysis and accurate molecular characterization is crucial to provide an accurate definitive thalassemia diagnosis, particularly in young subjects who would like to ask for a prenatal diagnosis or preimplantation genetic diagnosis.

    Matched MeSH terms: delta-Globins/genetics*
  14. Lama R, Yusof W, Shrestha TR, Hanafi S, Bhattarai M, Hassan R, et al.
    Hematol Oncol Stem Cell Ther, 2022 Mar 01;15(1):279-284.
    PMID: 33592169 DOI: 10.1016/j.hemonc.2021.01.004
    BACKGROUND: Beta-thalassemia is a genetic disorder that is inherited in an autosomal recessive pattern. This genetic disease leads to a defective beta-globin hemoglobin chain causing partial or complete beta-globin chain synthesis loss. Beta-thalassemia major patients need a continuous blood transfusion and iron chelation to maintain the normal homeostasis of red blood cells (RBCs) and other systems in the body. Patients also require treatment procedures that are costly and tedious, resulting in a serious health burden for developing nations such as Nepal.

    METHODS: A total of 61 individuals clinically diagnosed to have thalassemia were genotyped with multiplex amplification refractory mutation system-polymerase chain reaction (ARMS-PCR). Twenty-one major mutations were investigated using allele-specific primers grouped into six different panels.

    RESULTS: The most common mutations found (23%) were IVS 1-5 (G-C) and Cd 26 (G-A) (HbE), followed by 619 deletion, Cd 8/9 (+G), Cd 16 (-C), Cd 41/42 (-TTCT), IVS 1-1 (G-T), Cd 19 (A-G), and Cd 17 (A-T) at 20%, 12%, 8%, 6%, 4%, 3%, and 1%, respectively.

    CONCLUSION: The results of this study revealed that Nepal's mutational profile is comparable to that of its neighboring countries, such as India and Myanmar. This study also showed that thalassemia could be detected across 17 Nepal's ethnic groups, especially those whose ancestors originated from India and Central Asia.

    Matched MeSH terms: beta-Globins/genetics
  15. Suali L, Mohammad Salih FA, Ibrahim MY, Jeffree MSB, Thomas FM, Siew Moy F, et al.
    Hemoglobin, 2022 Nov;46(6):317-324.
    PMID: 36815306 DOI: 10.1080/03630269.2023.2169154
    β-thalassemia is a serious public health problem in Sabah due to its high prevalence. This study aimed to investigate the effects of different types of β-globin gene mutations, coinheritance with α-globin gene mutations, XmnI-Gγ, and rs368698783 polymorphisms on the β-thalassemia phenotypes in Sabahan patients. A total of 111 patients were included in this study. The sociodemographic profile of the patients was collected using a semi-structured questionnaire, while clinical data were obtained from their medical records. Gap-PCR, ARMS-PCR, RFLP-PCR, and multiplex PCR were performed to detect β- and α-globin gene mutations, as well as XmnI-Gγ and rs368698783 polymorphisms. Our data show that the high prevalence of β-thalassemia in Sabah is not due to consanguineous marriages (5.4%). A total of six different β-globin gene mutations were detected, with Filipino β°-deletion being the most dominant (87.4%). There were 77.5% homozygous β-thalassemia patients, 16.2% compound heterozygous β-thalassemia patients, and 6.3% β-thalassemia/Hb E patients. Further evaluation on compound heterozygous β-thalassemia and β-thalassemia/Hb E patients found no concomitant α-globin gene mutations and the rs368698783 polymorphism. Furthermore, the XmnI-Gγ (-/+) genotype did not demonstrate a strong impact on the disease phenotype, as only two of five patients in the compound heterozygous β-thalassemia group and two of three patients in the β-thalassemia/Hb E group had a moderate phenotype. Our findings indicate that the severity of the β-thalassemia phenotypes is closely related to the type of β-globin gene mutations but not to the XmnI-Gγ and rs368698783 polymorphisms.
    Matched MeSH terms: alpha-Globins/genetics; beta-Globins/genetics
  16. Mahmoud Ahmed NH, Lai MI
    PMID: 36734897 DOI: 10.2174/1871529X23666230123140926
    β-thalassaemia is a genetic disorder resulting in a reduction or absence of β-globin gene expression. Due to the high prevalence of β-thalassaemia and the lack of available treatment other than blood transfusion and haematopoietic stem cell (HSC) transplantation, the disease represents a considerable burden to clinical and economic systems. Foetal haemoglobin has an appreciated ameliorating effect in β-haemoglobinopathy, as the γ-globin chain substitutes the β-globin chain reduction by pairing with the excess α-globin chain in β-thalassaemia and reduces sickling in sickle cell disease (SCD). BCL11A is a critical regulator and repressor of foetal haemoglobin. Downregulation of BCL11A in adult erythroblasts and cell lines expressing adult haemoglobin led to a significant increase in foetal haemoglobin levels. Disruption of BCL11A erythroid enhancer resulted in disruption of the BCL11A gene solely in the erythroid lineages and increased γ-globin expression in adult erythroid cells. Autologous haematopoietic stem cell gene therapy represents an attractive treatment option to overcome the immune complications and donor availability associated with allogeneic transplantation. Using genome editing technologies, the disruption of BCL11A to induce γ- globin expression in HSCs has emerged as an alternative approach to treat β-thalassaemia. Targeting the +58 BCL11A erythroid enhancer or BCL11A binding motif at the γ-gene promoter with CRISPR-Cas9 or base editors has successfully disrupted the gene and the binding motif with a subsequent increment in HbF levels. This review outlines the critical role of BCL11A in γ-globin gene silencing and discusses the different genome editing approaches to downregulate BCL11A as a means for ameliorating β-thalassaemia.
    Matched MeSH terms: gamma-Globins/genetics
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links