The diverse clinical phenotype of hemoglobin E (HbE)/β-thalassemia has not only confounded clinicians in matters of patient management but has also led scientists to investigate the complex mechanisms involved in maintaining the delicate red cell environment where, even with apparent similarities of α- and β-globin genotypes, the phenotype tells a different story. The BTB and CNC homology 1 (BACH1) protein is known to regulate α- and β-globin gene transcriptions during the terminal differentiation of erythroid cells. With the mutations involved in HbE/β-thalassemia disorder, we studied the role of BACH1 in compensating for the globin chain imbalance, albeit for fine-tuning purposes.
Clinical studies were carried out on mild Indian sickle cell anaemia in Malaysia, and genetic and fertility studies were carried out on 101 families with and without sickle-cell haemoglobin (Hb S). The Indian sickle cell anaemia patients reached adulthood, and pregnancies and deliveries were uneventful without blood transfusion. There was no foetal wastage and the number of children produced was not significantly different from that in families without Hb S. 28 Indian patients hospitalized with Plasmodium falciparum malaria infection were also examined for their beta S genotype. P. falciparum malaria infection occurred much more frequently in individuals without Hb S than in Hb S carriers.
AIM: Interactions between different determinants of alpha-thalassemia raises considerable problems, particularly during pregnancies where antenatal diagnosis is necessary. This study aims to determine the different types of deletional alpha-thalassemia and Hemoglobin Constant Spring (HbCS), and their frequency in Malays, Chinese and Indians in Malaysia.
METHODS: DNA from 650 pregnant women from the Antenatal Clinic of the University of Malaya Medical Center in Kuala Lumpur, Malaysia who showed mean cell volume < or =89 fL and/or mean cell hemoglobin < or =28 pg were analyzed for the double alpha-globin gene South-East Asian deletion (--SEA), the -alpha3.7 and -alpha4.2 single alpha-globin gene deletions and HbCS.
RESULTS: One hundred and three (15.8%) of the pregnant women were confirmed as alpha-thalassemia carriers: 25 (3.8%) were alpha-thalassemia-1 carriers with the --SEA/alphaalpha genotype, 64 (9.8%) were heterozygous for the -alpha3.7 rightward deletion (-alpha3.7/alphaalpha), four (0.6%) were heterozygous for the -alpha4.2 leftward deletion (-alpha4.2/alphaalpha), nine (1.4%) were heterozygous for HbCS (alphaCSalpha/alphaalpha) and one (0.2%) was compound heterozygous with the -alpha3.7/alphaCSalpha genotype. The double alpha-globin gene --SEA deletion was significantly higher in the Chinese (15%) compared to the Malays (2.5%) and not detected in the Indians studied. The -alpha3.7 deletion was distributed equally in the three races. HbCS and -alpha4.2 was observed only in the Malays.
CONCLUSION: The data obtained gives a better understanding of the interactions of the different alpha-thalassemia determinants in the different ethnic groups, thus enabling more rapid and specific confirmation of alpha-thalassemia in affected pregnancies where antenatal diagnosis is necessary.
Study site: Antenatal clinic, University Malaya Medical Centre (UMMC), Kuala Lumpur, Malaysia
The spectrum of beta-thalassemia mutations in Malays in Singapore and Kelantan (Northeast Malaysia) was studied. Allele specific priming was used to determine the mutations in beta-carriers at -28, Codon 17, IVSI #1, IVSI #5, Codon 41-42 and IVSII #654 along the beta-globin gene. The most common structural hemoglobin variant in Southeast Asia, Hb E, was detected by DNA amplification with restriction enzyme (Mnl1) analysis. Direct genomic sequencing was carried out to detect the beta-mutations uncharacterized by allele-specific priming. The most prevalent beta-mutations in Singaporean Malays were IVSI #5 (45.83%) followed by Hb E (20.83%), codon 15 (12.5%) and IVSI #1 and IVSII #654 at 4.17% each. In contrast, the distribution of the beta-mutations in Kelantan Malays differed, with Hb E as the most common mutation (39.29%) followed by IVSI #5 (17.86%), codon 41-42 (14.29%), codon 19 (10.71%) and codon 17 (3.57%). The beta-mutations in Kelantan Malays follow closely the distribution of beta-mutations in Thais and Malays of Southern Thailand and Malays of West Malaysia. The AAC-->AGC base substitution in codon 19 has been detected only in these populations. The spectrum of beta-mutations in the Singaporean Malays is more similar to those reported in Indonesia with the beta-mutation at codon 15 (TGG-->TAG) present in both populations. The characterization of beta-mutations in Singaporean and Kelantan Malays will facilitate the establishment of effective prenatal diagnosis programs for beta-thalassemia major in this ethnic group.
Beta-thalassemia in West Malaysia is caused by 14 molecular defects with differing clinical severity. In Chinese patients from West Malaysia, the main beta-thalassemia mutations seen were (a) a 4 base pair-TCTT deletion in codon 41-42 [frameshift mutation (FSC 41-42)]; (b) a C to T substitution at the second intervening sequence (IVS2-654); (c) an A to G substitution in the TATA box [-28 (A to G)], and (d) an A to T substitution in codon 17[17 A to T]. In the Malays, the main mutations seen were (a) a G to C in nucleotide 5 at the intervening sequence I [IVS1-5 (G to C)]; (b) G to T substitution in nucleotide I at the intervening sequence I [IVS1-1 (G to T)]; (c) a A to T substitution in codon 17 (17 A to T); (d) removal of C from codon 35 [codon 35 (-C)], and (e) a 4 base pairs-TCTT deletion in codon 41-42 [frameshift mutation (FSC 41-42)]. A scoring system (Tha1 CS) has been formulated to predict clinical severity. It is the type of beta-thalassemia mutation present that decides on the clinical phenotype. The most severe beta-thalassemia mutation is assigned a score of 4. A score of 8 indicates severe thalassemia.
Beta-thalassemia mutations in 282 alleles of 253 unrelated individuals originating from various provinces in the south of Thailand were characterized by dot blot hybridization, specific PCR-amplification and direct DNA sequencing. It was possible to characterize the mutations in 274 (97.2%) of alleles studied. Twelve different point mutations and two different large deletions of the beta-globin gene were identified. Seven common mutations, namely 4 bp deletion at codons 41/42. IVS1 position 5 (G-C), codon 19 (AAC-AGC), codon 17 (AAG-TAG), IVS1 position 1 (G-T), position -28 (A-G) and 3.5 kb deletion, accounted for about 91.5%. The mutations at mRNA cap site + 1 (A-C) and IVS1 position 1 (G-A), previously undescribed in Thailand, were found in 1 and 2 individuals, respectively. A novel mutation of 105 bp deletion at the 5' end of beta-globin gene was detected in a family originating from this area. The knowledge from this study should be useful for planning of genetic counseling and prenatal diagnosis programs for patients with beta-thalassemia in the south of Thailand.
Haemoglobin S D-Punjab is a rare compound heterozygous haemoglobinopathy characterised by the presence of two β globin gene variants: Β6(GAG→GTG) and Β121(GAA→CAA). These patients' clinical and haematological features mimic haemoglobin S disease. We describe the first case of doubly heterozygous HbSD-Punjab from Malaysia managed with regular blood transfusion at the age of one. This case highlights the propensity for occurrence of rare phenotypes within our multi-ethnic population and emphasises the importance of accurate genotyping to avoid erroneous counselling, and to plan an effective patient management strategy before complication evolves.
A rare case of thalassaemia-intermedia involving a non-deletion alpha thalassemia point mutation in the alpha1-globin gene CD59 (GGC --> GAC) and a deletion alpha+ (-alpha(3.7)) thalassaemia in which use of high performance liquid chromatography (HPLC) C-gram Hb subtype profile and DNA molecular analysis helped establish the diagnosis.
A new haemoglobin, Haemoglobin Malay is described in a 22 year old Malay. Structural analysis showed a AAC----AGC mutation in codon 17, with the production of an abnormal beta chain (beta Malay) that has an Asn----Ser substitution at position beta 19. This haemoglobin variant could not be detected by conventional procedures.
Haemoglobin Constant Spring (Hb CS) mutation and single gene deletions are common underlying genetic abnormalities for alpha thalassaemias. Co-inheritance of deletional and non-deletional alpha (alpha) thalassaemias may result in various thalassaemia syndromes. Concomitant co-inheritance with beta (beta) and delta (delta) gene abnormalities would result in improved clinical phenotype. We report here a 33-year-old male patient who was admitted with dengue haemorrhagic fever, with a background history of Grave's disease, incidentally noted to have mild hypochromic microcytic red cell indices. Physical examination revealed no thalassaemic features or hepatosplenomegaly. His full blood picture showed hypochromic microcytic red cells with normal haemoglobin (Hb) level. Quantitation of Hb using high performance liquid chromatography (HPLC) and capillary electrophoresis (CE) revealed raised Hb F, normal Hb A2 and Hb A levels. There was also small peak of Hb CS noted in CE. H inclusions was negative. Kleihauer test was positive with heterocellular distribution of Hb F among the red cells. DNA analysis for alpha globin gene mutations showed a single -alpha(-3.7) deletion and Hb CS mutation. These findings were suggestive of compound heterozygosity of Hb CS and a single -alpha(-3.7) deletion with a concomitant heterozygous deltabeta thalassaemia. Co-inheritance of Hb CS and a single -alpha(-3.7) deletion is expected to result at the very least in a clinical phenotype similar to that of two alpha genes deletion. However we demonstrate here a phenotypic modification of alpha thalassemia presumptively as a result of co-inheritance with deltabeta chain abnormality as suggested by the high Hb F level.
The Siriraj I Gγ(Aγδβ)0-thalassaemia is a novel mutation involving a 118kb deletion of the β-globin gene cluster. It was first reported in 2012 in two unrelated families from the southern part of Thailand. The carriers in the heterozygous state are clinically asymptomatic. Nonetheless, its complex interaction with other β-thalassaemia could give rise to different clinical phenotypes, ranging from mild thalassaemia intermedia to thalassaemia major. We report here a case of a six-year-old Malay boy, presented with pallor, growth failure and hepatosplenomegaly. His haemoglobin at presentation was 9.2g/dL with a mean cell haemoglobin of 22.6pg and a mean cell volume of 69.9fl. His peripheral blood smear showed features of thalassaemia intermedia. Haemoglobin (Hb) analysis revealed markedly raised Hb F (83%), normal HbA2 levels and absent HbA. Deoxyribonucleic acid (DNA) analysis showed compound heterozygous IVS1-1 (G→T) β-globin gene mutation and Siriraj I Gγ(Aγδβ)0-deletion (genotype βIVS1-1/ β Siriraj I deletion). Both his father and elder sister are carriers of Siriraj I Gγ(Aγδβ)0-thalassaemia while his mother carries IVS1-1 (G→T) gene mutation. Clinically, the patient is transfusion dependent on six weekly regime. To the best of our knowledge, this is the first reported case in Malaysia involving unique Siriraj I Gγ(Aγδβ)0-thalassaemia and IVS1-1 (G→T) in a compound heterozygous state. In summary, detection of Siriraj I Gγ(Aγδβ)0-thalassaemia is essential as this deletion can lead to severe disease upon interaction with a β-thalassemia point mutation as demonstrated in our case. The establishment of effective carrier screening and genetic counselling is important to prevent its adverse consequences.
β-thalassaemia is one of the most common single-gene disorders worldwide. Each ethnic population has its own common mutations, accounting for the majority of cases, with a small number of mutations for the rarer alleles. Due to the heterogeneity of β-thalassaemia and the multi-ethnicity of Malaysians, molecular diagnostics may be expensive and time consuming.
Beta-thalassaemia is characterized by a decrease (β(+)) or absence (β(0)) in the synthesis of β-globin chains of human haemoglobin. The heterozygous state for β(+) or β(0) result in β-thalassaemia trait in which the hallmark is the presence of an elevated level of Haemoglobin (Hb) A(2) (α(2)δ(2)). In the past, the traditional methods such as cellulose acetate electrophoresis with elution and microcolumn chromatrography have been the techniques used by the majority of the laboratories in Malaysia for the estimation of (Hb) A(2) levels. The recommended method currently is high performance liquid chromatography which has only been introduced in a few laboratories in the country.
The distribution of restriction fragment length polymorphism (RFLP) at the BamH1 site of the beta-globin gene was investigated in the Chinese, Indian, and Malay race in Singapore. The sample comprised of 183 normal individuals and 35 beta-thalassemia carriers in which 13 were couples with at least one beta-major child. The results from this study indicate that BamH1 polymorphism will be informative in 22% of pregnancies at risk for beta-thalassemia major in Chinese, 19% in Malays and 7% in Indians. In prenatal diagnosis using BamH1 polymorphism for one beta-major affected family, the fetus was diagnosed to be normal or beta-carrier. The validity of BamH1 polymorphism in the exclusion of beta-thalassemia major was subsequently confirmed at birth by globin chain biosynthesis.
Beta-thalassaemia major is an autosomal recessive disorder that results in severe microcytic, hypochromic, haemolytic anaemia among affected patients. Beta-thalassaemia has emerged as one of the most common public health problems in Malaysia, particularly among Malaysian Chinese and Malays. This study aimed to observe the spectrum of mutations found in Kelantan Malay beta-thalassaemia major patients who attended the Paediatrics Daycare Unit, Hospital Universiti Sains Malaysia, Kelantan, Malaysia, the data of which was being used in establishing the prenatal diagnosis in this Human Genome Centre.
Following complete DNA characterisation patients with Hb H disease were assigned into two groups: deletional (alpha +/alpha o) and non deletional (HbCS/alpha o). Earlier studies have indicated that the group with (HbCS/alpha o) has more severe clinical problems. The serum malonyldialdehyde (MDA) levels, a secondary product of lipid peroxidation were within the normal range, though significantly higher levels of MDA were seen in the non-deletional type of Hb H disease when compared with the deletional type. Markedly low vitamin E levels were also seen in the former group. There were no significant differences in clinical severity may be attributed to an interplay of the accelerated destruction of damaged mature red blood cells secondary to the oxidative denaturation of Hb H and inclusion precipitation; higher levels of Hb H and more inclusion precipitation were seen in the group with (HbCS/alpha o). Low levels of vitamin E in the (HbCS/alpha o) group being due to its consumption in the neutralisation of free radicals formed with the oxidation of globin chains.
Globins are haem-binding proteins with a conserved fold made up of α-helices and can possess diverse properties. A putative globin-coupled sensor from Methylacidiphilum infernorum, HGbRL, contains an N-terminal globin domain whose open and closed structures reveal an untypical dimeric architecture. Helices E and F fuse into an elongated helix, resulting in a novel site-swapped globin fold made up of helices A-E, hence the distal site, from one subunit and helices F-H, the proximal site, from another. The open structure possesses a large cavity binding an imidazole molecule, while the closed structure forms a unique Lys-His hexacoordinated species, with the first turn of helix E unravelling to allow Lys52(E10) to bind to the haem. Ligand binding induces reorganization of loop CE, which is stabilized in the closed form, and helix E, triggering a large conformational movement in the open form. These provide a mechanical insight into how a signal may be relayed between the globin domain and the C-terminal domain of HGbRL, a Roadblock/LC7 domain. Comparison with HGbI, a closely related globin, further underlines the high degree of structural versatility that the globin fold is capable of, enabling it to perform a diversity of functions.
Hb and gene analyses of a Malaysian mother and her two daughters with microcytic anemia living in Japan were performed. Hb analyses of their hemolysates by IEF and DEAE-HPLC revealed high values of Hb A2 and HbF, but abnormal Hbs such as Hb E and Hb Constant Spring, which cause beta- and alpha-thalassemia traits, were not detected. From these data, they were suspected to be beta-thalassemia carriers. The thalassemic mutations commonly found in the Asian area by ARMS and nucleotide sequencing methods were not detected, and the frameworks of the beta-globin gene and the haplotypes of the beta-like globin gene cluster between the mother and daughters were not identical. These results led us to conclude that there was a beta(0)-thalassemia mutation with a large deletion from the beta-globin gene beyond the 3'beta/BamHI polymorphic site 3' downstream to the beta-globin gene. However, the range of the deletion from the beta-like globin gene cluster has not yet been completed in detail. Recently, there have been many foreigners mainly from Asian countries in Japan. We may encounter people with the rare type thalassemic mutation described in the text besides the mutations frequently found in Asian countries.
BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.