Displaying publications 1 - 20 of 73 in total

Abstract:
Sort:
  1. Fulltext Bleeding Efficiency, Microbiological Quality and Oxidative Stability of Meat from Goats Subjected to Slaughter without Stunning in Comparison with Different Methods of Pre-Slaughter Electrical Stunning
    Sabow AB, Zulkifli I, Goh YM, Ab Kadir MZ, Kaka U, Imlan JC, et al.
    PLoS One, 2016;11(4):e0152661.
    PMID: 27035716 DOI: 10.1371/journal.pone.0152661
    The influence of pre-slaughter electrical stunning techniques and slaughter without stunning on bleeding efficiency and shelf life of chevon during a 14 d postmortem aging were assessed. Thirty two Boer crossbred bucks were randomly assigned to four slaughtering techniques viz slaughter without stunning (SWS), low frequency head-only electrical stunning (LFHO; 1 A for 3 s at a frequency of 50 Hz), low frequency head-to-back electrical stunning (LFHB; 1 A for 3 s at a frequency of 50 Hz) and high frequency head-to-back electrical stunning (HFHB; 1 A for 3 s at a frequency of 850 Hz). The SWS, LFHO and HFHB goats had higher (p<0.05) blood loss and lower residual hemoglobin in muscle compared to LFHB. The LFHB meat had higher (p<0.05) TBARS value than other treatments on d 7 and 14 d postmortem. Slaughtering methods had no effect on protein oxidation. Higher bacterial counts were observed in LFHB meat compared to those from SWS, LFHO and HFHB after 3 d postmortem. Results indicate that the low bleed-out in LFHB lowered the lipid oxidative stability and microbiological quality of chevon during aging.
    Matched MeSH terms: Meat Products/microbiology*
  2. Fulltext Physicochemical and sensory characteristics of burger made from duck surimi-like material
    Ramadhan K, Huda N, Ahmad R
    Poult Sci, 2012 Sep;91(9):2316-23.
    PMID: 22912469 DOI: 10.3382/ps.2011-01747
    Burgers were prepared using duck surimi-like material (DSLM) with polydextrose added (SL) and DSLM with sucrose-sorbitol added (SS), and the properties of these burgers were compared with those of burgers made of chicken meat (CB) and duck meat (DB). Quality characteristics such as chemical composition, cooking loss, diameter shrinkage, color, and texture were measured. The DB had a lower moisture content (55.58%) and higher fat content (21.44%) and cooking loss (11.01%) compared with other samples, whereas CB, SS, and SL did not differ significantly in moisture (65.21-66.10%) and fat (10.42-11.16%) content or cooking loss (5.32-6.15%). The SS and SL were positioned below CB and above DB in terms of hardness, chewiness, and springiness. Ten trained panelists assessed the burgers using quantitative descriptive analysis. Among the burgers, CB had the greatest brightness of color, hardness, springiness, and chewiness. The SS had greater sweetness than the other burgers. Both SL and SS had significantly less animalic odor, meaty flavor, oiliness, juiciness, and saltiness compared with DB. The physicochemical and sensory characteristics of burgers prepared from DSLM approached those of burgers made of chicken.
    Matched MeSH terms: Meat Products/analysis; Meat Products/standards*
  3. Fulltext Analysis of Pork in Beef Sausages Using LC-Orbitrap HRMS Untargeted Metabolomics Combined with Chemometrics for Halal Authentication Study
    Windarsih A, Bakar NKA, Dachriyanus, Yuliana ND, Riswanto FDO, Rohman A
    Molecules, 2023 Aug 09;28(16).
    PMID: 37630216 DOI: 10.3390/molecules28165964
    Beef sausage (BS) is one of the most favored meat products due to its nutrition and good taste. However, for economic purposes, BS is often adulterated with pork by unethical players. Pork consumption is strictly prohibited for religions including Islam and Judaism. Therefore, advanced detection methods are highly required to warrant the halal authenticity of BS. This research aimed to develop a liquid chromatography-high-resolution mass spectrometry (LC-HRMS) method to determine the halal authenticity of BS using an untargeted metabolomics approach. LC-HRMS was capable of detecting various metabolites in BS and BS containing pork. The presence of pork in BS could be differentiated using principal component analysis (PCA) and partial least squares-discriminant analysis (PLS-DA) with high accuracy. PLS-DA perfectly classified authentic BS and BS containing pork in all concentration levels of pork with R2X = (0.821), R2Y(= 0.984), and Q2 = (0.795). The level of pork in BS was successfully predicted through partial least squares (PLS) and orthogonal PLS (OPLS) chemometrics. Both models gave high R2 (>0.99) actual and predicted values as well as few errors, indicating good accuracy and precision. Identification of discriminating metabolites' potential as biomarker candidates through variable importance for projections (VIP) value revealed metabolites of 2-arachidonyl-sn-glycero-3-phosphoethanolamine, 3-hydroxyoctanoylcarnitine, 8Z,11Z,14Z-eicosatrienoic acid, D-(+)-galactose, oleamide, 3-hydroxyhexadecanoylcarnitine, arachidonic acid, and α-eleostearic acid as good indicators to detect pork. It can be concluded that LC-HRMS metabolomics combined with PCA, PLS-DA, PLS, and OPLS was successfully used to detect pork adulteration in beef sausages. The results imply that LC-HRMS untargeted metabolomics in combination with chemometrics is a promising alternative as an analytical technique to detect pork in sausage products. Further analysis of larger samples is required to warrant the reproducibility.
    Matched MeSH terms: Meat Products*
  4. Fulltext Physicochemical properties and sensory characteristics of sausage formulated with surimi powder
    Santana P, Huda N, Yang TA
    J Food Sci Technol, 2015 Mar;52(3):1507-15.
    PMID: 25745219 DOI: 10.1007/s13197-013-1145-1
    The objectives of this study were to determine the physicochemical properties and sensory characteristics of fish sausage made with 100 % threadfin bream (Nemipterus japonicus) surimi powder (SP100), a mix of 50 % surimi powder and 50 % frozen surimi (SP50), and a control (100 % frozen surimi). No significant differences in protein content and folding test results (P > 0.05) were detected among the SP100 and SP50 samples and the control. Gel strength of SP100 was lower (P > 0.05) than that of the control. The texture profile analysis (TPA) values (hardness, cohesiveness, springiness, and chewiness) of SP100 were significantly lower (P 
    Matched MeSH terms: Meat Products
  5. Quality characteristics of Malaysian commercial beef frankfurters
    Nurul, H., Alistair, T.L.J., Lim, H.W., Noryati, I.
    International Food Research Journal, 2010;17(2):469-476.
    MyJurnal
    Five different brands of Malaysian commercial beef frankfurters were analyzed for quality characteristics. The proximate contents showed significant differences among the samples. The range of moisture content was 63.0-73.9%; the protein content was 10.63-16.43% while the fat content was 1.71-12.22%. The lightness value (L*) of the uncooked frankfurters, which was in the range of 47.02-52.28, was significantly different among the samples. The lightness of the cooked frankfurters, showed a decrease in all the samples compared to the uncooked samples. No significant differences were observed for the folding test; where all samples showed no cracks after they were folded in half. However, significant differences were observed for the texture analysis. The hardness, cohesiveness, chewiness, springiness, gumminess and shear force ranged between 4.59-10.30 kg, 0.26-0.35, 16.15-51.72 kgmm, 12.73-14.79 mm, 1.17-3.49 kg and 1.67-7.08 kg respectively. The results of the study showed that Malaysian commercial beef frankfurters were significantly different in their physicochemical properties.
    Matched MeSH terms: Meat Products
  6. Fulltext Biosafety assessment of Listeria monocytogenes in vegetarian burger patties in Malaysia
    International Food Research Journal, 2011;18(1):459-463.
    MyJurnal
    The aim of this study was to examine vegetarian burger patties manufactured by two producers in Malaysia for the presence of Listeria monocytogenes. Brand A was produced by an established food manufacturer
    while Brand B was produced by a small-scaled food producer. A total of 108 samples of vegetarian burger
    patties produced by both manufacturers were sampled from retail market and were analyzed by combined
    MPN-PCR and MPN plating method. Of all the samples tested, ten (9.3%) were found to be contaminated with L. monocytogenes. The L. monocytogenes contamination level in vegetarian burger patties manufactured by producer A (20.9% of the samples were contaminated with 3-1100 MPN/g of L. monocytogenes) was significantly higher (P
    Matched MeSH terms: Meat Products
  7. Prevalence of Listeria spp and Listeria monocytogenes in meat and fermented fish in Malaysia
    Hassan Z, Purwati E, Radu S, Rahim RA, Rusul G
    Southeast Asian J. Trop. Med. Public Health, 2001 Jun;32(2):402-7.
    PMID: 11556596
    Fermented fish and meat samples were purchased from supermarket and wet market for microbiological analysis of Listeria species and Listeria monocytogenes contamination. Listeria species were isolated from 17 (73.9%) of 23 samples of imported frozen beef, 10 (43.5%) of the 23 samples of local beef and 14 (56%) of the 25 samples of fermented fish from wet market. Listeria monocytogenes occurred in 15 (75%) of the frozen beef samples, 6 (30.4%) of the 23 samples of local meat and 3 (12%) of the 25 samples from fermented fish. Listeria species was not isolated from any of the 23 samples of imported frozen beef from supermarket and from the 5 samples of buffalo meat examined. This highlights the possibility of Listeria spp or L. monocytogenes to persist in meat and fermented fish in wet market and raises the problem of illness due to the handling and consumption of Listeria-contaminated meat or fermented fish are likely as evidence by the high contamination rates of samples sold at the wet market.
    Matched MeSH terms: Meat Products/microbiology*
  8. Chemical, physical and sensory properties of chicken frankfurters substituted with palm fats
    Tan SS, Aminah A, Mohd Suria Affandi Y, Atil O, Babji AS
    Int J Food Sci Nutr, 2001 Jan;52(1):91-8.
    PMID: 11225183
    Physico-chemical and sensory characteristics of frankfurters prepared with three types of palm fats (PF60: 40, PF70: 30 and PF80: 20) and palm olein (POo) at 20 and 25% of fat levels were studied. Incorporation of different fats at 20 and 25% did not affect the cooking yields of the frankfurters. Frankfurters incorporated with 25% POo showed the highest value of water-holding capacity (WHC) among eight formulations. The frankfurters containing POo showed the least cooking loss compared to those with palm fats. The incorporation of different type and level of fats resulted in significant changes in the colour (lightness, redness, yellowness) of frankfurters. Texture profiles of both raw and cooked frankfurters were found to be altered by the blending of different type and level of fats. In raw frankfurters, hardness for frankfurters mixed with palm fats were significantly higher than the one with POo but greater values for cohesiveness was observed in raw frankfurters blended with POo. Lowest chewiness was demonstrated by frankfurters mixed with 20% POo. Grilling increased the hardness values of all frankfurters. Contrary to the raw counterparts, cooked frankfurter with POo was the hardest among all formulations. Cohesiveness and chewiness was also found to be significantly higher for cooked frankfurters mixed with POo. Raw frankfurters with fat content of 25% showed greater value in hardness than those of 20%. However, there were no significant differences (P > 0.05) observed for all the texture profile attributes in cooked frankfurters due to fat levels. In sensory evaluation, frankfurters prepared with POo were found to be most acceptable by consumer panels as they scored the highest for hardness rating, chicken flavour, oiliness and overall acceptance attributes.
    Matched MeSH terms: Meat Products/analysis*
  9. Quality of mechanically deboned chicken meat frankfurter incorporated with chicken skin
    Babji AS, Chin SY, Seri Chempaka MY, Alina AR
    Int J Food Sci Nutr, 1998 Sep;49(5):319-26.
    PMID: 10367000
    Four formulations were processed into frankfurters with different ratios of mechanically deboned chicken meat (MDCM) and cooked chicken skin (CCS) i.e. 80/0, 70/10, 60/20 and 50/30. The products were evaluated for proximate composition, cholesterol content, colour; 'L' value (lightness) and 'a' value (redness), percentage of cooking loss, physical measurements (shearforce-kgf and folding test), thiobarbituric acid value (TBA) and taste panel evaluation. The increment of CCS in the frankfurters increased the contents of moisture, ash, protein, fat, cholesterol, the lightness ('L' value) and redness ('a' value). After 3 months of frozen storage, the increment continued except for the moisture contents for formulations with 20 and 30% CCS. The lipid oxidation (TBA value) and cooking loss were lowered in formulations with CCS. After 3 months of frozen storage, TBA value decreased, while the cooking loss increased for all the formulations. The addition of CCS increased hardness of the frankfurters but affected folding ability, with formulation with 10% CCS scoring better grade. Sensory evaluation was carried out using 30 untrained panelists to evaluate aroma, colour, appearance, hardness, juiciness, chicken taste, oily taste, rancid taste and overall acceptance of the products. The addition of CCS in the frankfurters at 10 and 20% resulted in products with taste and texture that were acceptable after 3 months of frozen storage.
    Matched MeSH terms: Meat Products/analysis*
  10. Halal authenticity issues in meat and meat products
    Nakyinsige K, Man YB, Sazili AQ
    Meat Sci, 2012 Jul;91(3):207-14.
    PMID: 22405913 DOI: 10.1016/j.meatsci.2012.02.015
    In the recent years, Muslims have become increasingly concerned about the meat they eat. Proper product description is very crucial for consumers to make informed choices and to ensure fair trade, particularly in the ever growing halal food market. Globally, Muslim consumers are concerned about a number of issues concerning meat and meat products such as pork substitution, undeclared blood plasma, use of prohibited ingredients, pork intestine casings and non-halal methods of slaughter. Analytical techniques which are appropriate and specific have been developed to deal with particular issues. The most suitable technique for any particular sample is often determined by the nature of the sample itself. This paper sets out to identify what makes meat halal, highlight the halal authenticity issues that occur in meat and meat products and provide an overview of the possible analytical methods for halal authentication of meat and meat products.
    Matched MeSH terms: Meat Products/analysis*
  11. Development of real-time polymerase chain reaction for analysis of rat meat (Bandicota bengalensis) in beef meatballs for halal authentication
    Rohman A, Nawwaruddin HH, Hossain MAM, Laksitorini MD, Lestari D
    Open Vet J, 2024 Sep;14(9):2484-2492.
    PMID: 39553767 DOI: 10.5455/OVJ.2024.v14.i9.37
    BACKGROUND: Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like rat meat (RM).

    AIM: This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs.

    METHODS: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples.

    RESULTS: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R 2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples.

    CONCLUSION: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.

    Matched MeSH terms: Meat Products/analysis
  12. Optimizing palm oil and palm stearin utilization for sensory and textural properties of chicken frankfurters
    Tan SS, Aminah A, Zhang XG, Abdul SB
    Meat Sci, 2006 Mar;72(3):387-97.
    PMID: 22061722 DOI: 10.1016/j.meatsci.2005.07.012
    This study was designed to explore the potential of refined, bleached and deodorized (RBD) palm oil (PO) and palm stearin (POs) utilization in chicken frankfurters. A 10 points augmented simplex-centroid design was used to study the effect of chicken fat (CF), PO and POs as well as the interaction of these fats on the emulsion, textural and sensory properties of chicken frankfurters. All frankfurters were formulated to contain approx 25% fat, 52% moisture and 10% protein. No significant difference was found in end chopping temperatures of all meat batters even though the temperature of PO and POs upon incorporation into meat batters was 50°C higher than CF. Strong emulsions were formed as no fluid losses were observed in all the meat batters tested after heating. Texture profiles of the frankfurters containing PO and/or CF were quite similar, but increment of POs raised hardness, chewiness, and shear hardness of the frankfurters. Acceptability of the frankfurters was evaluated using hedonic test. Panelists found no difference in hardness preference between frankfurters made from totally CF and PO, while frankfurters made from POs were rated as hard and brittle. CF was important in determining acceptability of the frankfurters, as reduction of CF in formulation resulted in lower scores in chicken flavor, juiciness, oiliness and overall acceptance of the frankfurters. Frankfurters with sensory acceptability comparable to a commercial one were found to comprise of more than 17% CF, and less than 67% PO and 17% POs of the fat blend.
    Matched MeSH terms: Meat Products
  13. Fulltext Physicochemical characteristics and sensory properties of selected Malaysian commercial chicken burgers
    International Food Research Journal, 2011;18(4):1349-1357.
    MyJurnal
    Ten selected brands of commercial chicken burgers were analysed for their proximate composition, texture profiles, colour and sensory properties. Results show commercial chicken burgers consisted of moisture, proteins, fat and ash in the range of 46.72-69.37%, 11.08-18.77%, 9.08-20.54%, and 1.50-2.96%, respectively. Meanwhile, texture profiles comprised of hardness ranging from 8003.25-19038.15g, while chewiness had the value ranging from 650.78-1275.78 g. On the other hands, cohesiveness had the value ranging from 0.223-0.371, while springiness recorded the value in the range from 0.141-0.443. Colour analysis of cooked burgers resulted in lightness (L*) ranging from 48.21-73.59, redness (a*) from 0.75-9.08, and yellowness (b*) from 21.56-31.24. In sensory evaluation, the most acceptable colour of chicken burger was the one which had the medium lightness (L*) with the value of 63.96), medium redness (a*) with the value of 7.00) and the highest yellowness (b*) intensity value at 31.24. In addition, the most acceptable texture was the one with medium hardness value of 12590 g, high chewiness value of 1195.42 g, high cohesiveness value of 0.371, and medium springiness value of 0.254. It can be concluded that the Malaysian commercial chicken burgers complied with the Food Act of Malaysia and contained different levels of chemical compositions, textural characteristics and colour properties.
    Matched MeSH terms: Meat Products
  14. Fulltext Antioxidant capacity and nitrosation inhibition of cruciferous vegetable extracts
    Konsue, N., Amron, N.A.
    International Food Research Journal, 2018;25(1):65-73.
    MyJurnal
    Cruciferous vegetables belong to the mustard family of plants such as Brussels sprouts, kale, broccoli, cabbage and cauliflower. They are well known for their cancer prevention properties which are due to high content of bioactive compounds, isothiocyanates (ITCs). This study was aimed to investigate nitrosation inhibition ability of the cruciferous vegetables commonly consumed with meat products namely, broccoli, cauliflower and cabbage. Aqueous extracts of fresh and steamed (2 and 4 min) vegetables were subjected to determination of antioxidant capacity (DPPH and FRAP assay) and chemical composition i.e. total phenolic and isothiocyanate (ITC) content. It was found that TPC, DPPH and FRAP values of raw vegetables were different in each vegetable and ranged from 17.12-38.91 mg GAE/100 ml, 44.09-63.31% and 1.36-6.81 mg TE/100 ml, respectively. Among three types of cruciferous vegetable, broccoli had the highest PEITC content being 0.21 mmol/100 g compared to cauliflower (0.15 mmol/100 g) and cabbage (0.06 mmol/100 g). Moreover, it was found that steaming process significantly enhanced antioxidant activity, TPC as well as PEITC content in a timedependent manner up to 4 min (p
    Matched MeSH terms: Meat Products
  15. Effect of non-meat proteins, soy protein isolate and sodium caseinate, on the textural properties of chicken bologna
    Yusof SC, Babji AS
    Int J Food Sci Nutr, 1996 Jul;47(4):323-9.
    PMID: 8844254
    Nine formulations were processed into bologna with different ratios of soy protein isolate (SPI):sodium caseinate (SCA), i.e. 1:1, 1:2.5, 1:5, 5:1, 5:2.5, 5:5, 10:1, 10:2.5 and 10:5. The products were evaluated for yields, emulsion stability, physical measurements (shearforce-kgf and folding test) and taste panel evaluation. Formulations with 5:1 and 5:5 SPI:SCA had lower liquid loss resulting in higher yields while the others had poor emulsion stability and high liquid loss. Firmer texture was exhibited by formulations 1:1, 5:1 and 10:1 SPI:SCA but formulation with 1:1 SPI:SCA showed better gelation followed by 1:2.5, 1:5, 5:1, and 5:2.5. The other formulations had poor gelation and binding properties, especially formulation with 10:5 SPI:SCA. Sensory evaluation was carried out using 30 untrained panelists. Attributes evaluated were aroma, texture, chewiness, juiciness, saltiness, chicken taste and overall acceptance. Formulation with 5:1 SPI:SCA was more acceptable for texture, chicken taste and overall acceptance while formulation with 1:1 SPI:SCA was more acceptable for the chewiness, juiciness and saltiness attributes. There was no significant difference (P > 0.05) in aroma attribute, for all formulations.
    Matched MeSH terms: Meat Products/analysis; Meat Products/standards*
  16. Analysis of pork adulteration in commercial meatballs targeting porcine-specific mitochondrial cytochrome b gene by TaqMan probe real-time polymerase chain reaction
    Ali ME, Hashim U, Mustafa S, Che Man YB, Dhahi TS, Kashif M, et al.
    Meat Sci, 2012 Aug;91(4):454-9.
    PMID: 22444666 DOI: 10.1016/j.meatsci.2012.02.031
    A test for assessing pork adulteration in meatballs, using TaqMan probe real-time polymerase chain reaction, was developed. The assay combined porcine-specific primers and TaqMan probe for the detection of a 109 bp fragment of porcine cytochrome b gene. Specificity test with 10 ng DNA of eleven different species yielded a threshold cycle (Ct) of 15.5 ± 0.20 for the pork and negative results for the others. Analysis of beef meatballs with spiked pork showed the assay can determine 100-0.01% contaminated pork with 102% PCR efficiency, high linear regression (r(2) = 0.994) and ≤ 6% relative errors. Residuals analysis revealed a high precision in all determinations. Random analysis of commercial meatballs from pork, beef, chicken, mutton and goat, yielded a Ct between 15.89 ± 0.16 and 16.37 ± 0.22 from pork meatballs and negative results from the others, showing the suitability of the assay to determine pork in commercial meatballs with a high accuracy and precision.
    Matched MeSH terms: Meat Products/analysis*; Meat Products/standards
  17. Fulltext Sodium diacetate and sodium lactate affect microbiology and sensory and objective characteristics of a restructured turkey breast product formulated with a fibrin cold-set binding system
    Mohammed Shafit H, Williams SK
    Poult Sci, 2010 Mar;89(3):594-602.
    PMID: 20181879 DOI: 10.3382/ps.2009-00412
    Research was conducted to manufacture and evaluate a restructured turkey breast product using the Fibrimex cold-set binding system, sodium diacetate (NaD), and sodium lactate (NaL) and to ascertain effects of the treatments on proximate composition, pH, psychrotrophic organisms, water activity, onset of rancidity (TBA), thaw loss, cooking yields, and objective color, and sensory characteristics. Whole turkey breasts were cut into 5-cm-thick strips; treated with either water only (control), 1.5% NaL, 2.0% NaL, 0.1% NaD, 1.5% NaL + 0.1% NaD, or 2.0% NaL + 0.1% NaD; blended with Fibrimex ingredients; stuffed into casings; and stored at -30 degrees C for 0, 1, 2, and 3 mo. After each storage period, frozen chubs were tempered at 4 degrees C, sliced into 1-cm-thick steaks, packaged in retail trays, stored at 0 degrees C to simulate retail storage, and analyzed after 0, 2, 4, 6, 8, and 10 d. Sodium diacetate used alone or in combination with NaL reduced (P < 0.05) growth of psychrotrophic organisms and had no adverse effects on water activity, pH, cooking yield, fat, moisture, protein, objective color, onset of rancidity, and sensory characteristics (juiciness, turkey flavor intensity, and tenderness). Panelists reported slight off-flavor in all steaks treated with NaL. Treating steaks with NaL alone or in combination with NaD resulted in increased (P < 0.05) ash content. Sodium lactate also functioned to minimize thaw loss in the frozen restructured turkey product.
    Matched MeSH terms: Meat Products/microbiology*; Meat Products/standards*
  18. Genetic diversity, virulotyping and antimicrobial resistance susceptibility of Yersinia enterocolitica isolated from pigs and porcine products in Malaysia
    Thong KL, Tan LK, Ooi PT
    J Sci Food Agric, 2018 Jan;98(1):87-95.
    PMID: 28542807 DOI: 10.1002/jsfa.8442
    BACKGROUND: The objectives of the present study were to determine the antimicrobial resistance, virulotypes and genetic diversity of Yersinia enterocolitica isolated from uncooked porcine food and live pigs in Malaysia.

    RESULTS: Thirty-two non-repeat Y. enterocolitica strains of three bioserotypes (3 variant/O:3, n = 27; 1B/O:8, n = 3; 1A/O:5, n = 2) were analysed. Approximately 90% of strains were multidrug-resistant with a multiple antibiotic resistance index < 0.2 and the majority of the strains were resistant to nalidixic acid, clindamycin, ampicillin, ticarcillin, tetracycline and amoxicillin. Yersinia enterocolitica could be distinguished distinctly into three clusters by pulsed-field gel electrophoresis, with each belonging to a particular bioserotype. Strains of 3 variant/O:3 were more heterogeneous than others. Eleven of the 15 virulence genes tested (hreP, virF, rfbC, myfA, sat, inv, ail, ymoA, ystA, tccC, yadA) and pYV virulence plasmid were present in all the bioserotpe 3 variant/03 strains.

    CONCLUSION: The occurrence of virulent strains of Y. enterocolitica in pigs and porcine products reiterated that pigs are important reservoirs for Y. enterocolitica. The increasing trend of multidrug resistant strains is a public health concern. This is the first report on the occurrence of potential pathogenic and resistant strains of Y. enterocolitica in pigs in Malaysia. © 2017 Society of Chemical Industry.

    Matched MeSH terms: Meat Products/analysis; Meat Products/microbiology*
  19. Fulltext Effect of frozen storage on the characteristics of a developed and commercial fish sausages
    Al-Bulushi IM, Kasapis S, Dykes GA, Al-Waili H, Guizani N, Al-Oufi H
    J Food Sci Technol, 2013 Dec;50(6):1158-64.
    PMID: 24426029 DOI: 10.1007/s13197-011-0441-x
    The effect of frozen storage on the physiochemical, chemical and microbial characteristics of two types of fish sausages was studied. Fish sausages developed (DFS) with a spice-sugar formulation and commercial fish sausages (CFS) were stored at -20 °C for 3 months. Fresh DFS contained 12.22% lipids and had a 3.53 cfu/g total bacteria count (TBC) whereas, CFS contained 5.5% lipids and had a 4.81 cfu/g TBC. During storage, TBC decreased significantly (p  0.05) in CFS. A peroxide value (PV) was not detectable until week four and eight of storage in CFS and DFS, respectively. The salt-soluble proteins (SSP) level was stable in DFS but in CFS it declined significantly (p  0.05) in both sausage types. This study showed that the effect of storage at -20 °C on fish sausages characteristics varied between formulations and depended on the ingredients of fish sausages.
    Matched MeSH terms: Meat Products
  20. Modified use of methylene blue in the tissue compression technique to detect sarcocysts in meat-producing animals
    Ng YH, Subramaniam V, Lau YL
    Vet Parasitol, 2015 Nov 30;214(1-2):200-3.
    PMID: 26455572 DOI: 10.1016/j.vetpar.2015.09.032
    Sarcocystosis in meat-producing animals is a major cause of reduced productivity in many countries, especially those that rely on agriculture. Although several diagnostic methods are available to detect sarcocystosis, many are too time-consuming for routine use in abattoirs and meat inspection centers, where large numbers of samples need to be tested. This study aimed to compare the sensitivity of the methylene blue tissue preparation, unstained tissue preparation and nested PCR in the detection of sarcocysts in tissue samples. Approximately three-fold more sarcocysts were detected in methylene blue-stained tissue compared to unstained controls (McNemar's test: P<0.01). Test sensitivity was comparable to that of the gold standard for sarcocyst detection, nested polymerase chain reaction. These results suggest that methylene blue can be used in tissue compression as a rapid, safe, and inexpensive technique for the detection of ruminant sarcocystosis in abattoirs.
    Matched MeSH terms: Meat Products
Related Terms
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links