RESULTS: The adsorption of bovine serum albumin (BSA) onto anion-exchange Q-sepharose solid particulate support was investigated in batch adsorption experiments. Adsorption kinetics and isotherms were developed as a function of key industrially relevant parameters such as polymer loading, stirring speed, buffer pH, protein concentration and the state of protein dispersion (solid/aqueous) in order to optimize binding performance and adsorption capacity. Experimental results showed that the first order rate constant is higher at higher stirring speed, higher polymer loading, and under alkaline conditions, with a corresponding increase in equilibrium adsorption capacity. Increasing the stirring speed and using aqueous dispersion protein system increased the adsorption rate, but the maximum protein adsorption was unaffected. Regardless of the stirring speed, the adsorption capacity of the polymer was 2.8 mg/ml. However, doubling the polymer loading increased the adsorption capacity to 9.4 mg/ml.
CONCLUSIONS: The result demonstrates that there exists a minimum amount of polymer loading required to achieve maximum protein adsorption capacity under specific process conditions.
METHODOLOGY: Proteomics was used to compare protein extracts of skim milk from Saanen, Jamnapari, and Toggenburg. Cow's milk was used as a control. IgE-immunoblotting and mass spectrometry were used to compare and identify proteins that cross-reacted with serum IgE from CMPA patients (n = 10).
RESULTS: The analysis of IgE-reactive proteins revealed that the protein spots identified with high confidence were proteins homologous to common cow's milk allergens such as α-S1-casein (αS1-CN), β-casein (β-CN), κ-casein (κ-CN), and beta-lactoglobulin (β-LG). Jamnapari's milk proteins were found to cross-react with four major milk allergens: α-S1-CN, β-CN, κ-CN, and β-LG. Saanen goat's milk proteins, on the other hand, cross-reacted with two major milk allergens, α-S1-CN and β-LG, whereas Toggenburg goat's milk proteins only react with one of the major milk allergens, κ-CN.
CONCLUSION: These findings may help in the development of hypoallergenic goat milk through cross-breeding strategies of goat breeds with lower allergenic milk protein contents.
AIM: This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs.
METHODS: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples.
RESULTS: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R 2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples.
CONCLUSION: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.
RESULTS: Headspace solid-phase microextraction-gas chromatography-mass spectrometry revealed that the spice flavor of beef was significantly enhanced by 500 W ultrasound-assisted marination. Meanwhile, the experimental results demonstrated that the ultrasound-assisted marination promoted the unfolding of beef myofibrillar protein structure, which increased the number of hydrophobic and hydrogen bonding sites, enhanced the electrostatic effect and improved the functional properties of the protein. Ultrasound-assisted marination significantly enhanced the binding ability of beef myofibrillar proteins to flavor compounds compared with conventional marination. An electronic nose confirmed that this resulted in a significant increase in the flavor of the marinated meat.
CONCLUSION: Ultrasound-assisted marination effectively enhanced the flavor of marinated meat, which was closely related to the development of protein conformation. The results of this study have important implications for the food industry and the role of protein unfolding processes in flavor modulation. In particular, the findings can be practically applied to improving meat flavor under ultrasound-assisted marination. © 2024 Society of Chemical Industry.