Alpha thalassaemia is one of the haemoglobin disordersin which the carriers of alpha thalassaemia may have normal haemoglobin level and are eligible to donate blood which may bring complications. This study is to investigate the interaction of haematological parameter with α-globin genotypes among eligible blood donors. Materials & Methods: A cohort study with 270 eligible blood donors were analysed for red cell indices. Alpha-globin (α-globin) genotyping was performed for seven deletions, six point mutations and two triplications. Statistical analyses were performed to compare the α-globin genotypes with haematological data. Results: High prevalence of α-thalassaemia carriers (7.7%, 21/270) was found among blood donors. All of them did not show anaemic pictures with a normal Hb level (>12 gm/dl). Five genotypes were identified consisting of 249 αα/αα (92.2%), nine -α3.7/αα (3.3%), nine--SEA/αα (3.3%), two -α4.2/αα (0.7%) and one ααCS/αα (0.4%). Different α-globin genotypes showed a significant difference in RBC, MCV, MCH, MCHC, RDW, and Hct/Hb ratio (p
The alpha haemoglobin stabilising protein (AHSP) acts as a molecular chaperone for α-globin by stabilising nascent α-globin before transferring it to waiting free β-globin chains. Binding of AHSP to α-globin renders α-globin chemically inert whereby preventing it from precipitating and forming reactive oxygen species byproducts. The AHSP has been actively studied in the recent years, particularly in its relation to β-thalassaemia. Studies have shown that AHSP is a modifier in β-thalassaemia mice models. However, this relationship is less established in humans. Studies by some groups showed no correlation between the AHSP haplotypes and the severity of β-thalassaemia, whereas others have shown that certain AHSP haplotype could modify the phenotype of β-thalassaemia intermedia patients. We investigated the expression of AHSP in relation to selected demographic data, full blood count, HPLC results, HbE/β-thalassaemia genotype, Xmn-1 Gγ polymorphism, α-globin, β-globin and γ-globin expression. We found that AHSP expression was significantly correlated to mean cell haemoglobin level, HbF %, α-globin, β-globin and excess α-globin expression. We concluded that AHSP could be a secondary compensatory mechanism in red blood cells to counterbalance the excess α-globin chains in HbE/β-thalassaemia individuals.
Dried blood spots (DBS) are currently the recommended sample collection method for newborn screening programmes in America. Early diagnosis of beta-thalassaemia screening is essential as it provides an added advantage especially in sickle cell disease. Beta-thalassaemia frequency is high in many poor countries, and the cost of using commercial DNA extraction kits can be prohibitive. Our study assessed three methods that use minimal reagents and materials to extract DNA from DBS for beta-thalassaemia identification.
The diverse clinical phenotype of hemoglobin E (HbE)/β-thalassemia has not only confounded clinicians in matters of patient management but has also led scientists to investigate the complex mechanisms involved in maintaining the delicate red cell environment where, even with apparent similarities of α- and β-globin genotypes, the phenotype tells a different story. The BTB and CNC homology 1 (BACH1) protein is known to regulate α- and β-globin gene transcriptions during the terminal differentiation of erythroid cells. With the mutations involved in HbE/β-thalassemia disorder, we studied the role of BACH1 in compensating for the globin chain imbalance, albeit for fine-tuning purposes.
Hereditary stomatocytic ovalocytosis and haemoglobin E are two genes present in 3-5% of Malays. This is a report of a 22 year old Malay college student with homozygous haemoglobin E and hereditary stomatocytic ovalocytosis where the clinical effects seen were the result of the summation of these genes: he was asymptomatic, presenting with moderate jaundice, moderate hepatosplenomegaly, and a mild haemolytic anaemia.
Since the discovery of gonadotropin-releasing hormone (GnRH) in mammals at the beginning of the 1970s, it was generally accepted that GnRH is the only hypothalamic neuropeptide regulating gonadotropin release in mammals and other vertebrates. In 2000, however, gonadotropin-inhibitory hormone (GnIH), a novel hypothalamic neuropeptide that actively inhibits gonadotropin release, was discovered in quail. Numerous studies over the past decade and a half have demonstrated that GnIH serves as a key player regulating reproduction across vertebrates, acting on the brain and pituitary to modulate reproductive physiology and behavior. In the latter case, recent evidence indicates that GnIH can regulate reproductive behavior through changes in neurosteroid, such as neuroestrogen, biosynthesis in the brain. This review summarizes the discovery of GnIH, and the contributions to GnIH research focused on its mode of action, regulation of biosynthesis, and how these findings advance our understanding of reproductive neuroendocrinology.
Paratuberculosis, or Johne's disease, is a chronic, granulomatous, gastrointestinal tract disease of cattle and other ruminants caused by the bacterium Mycobacterium avium, subspecies paratuberculosis (MAP). Control of Johne's disease is based on programs of testing and culling animals positive for infection with MAP while concurrently modifying management to reduce the likelihood of infection. The current study is motivated by the hypothesis that genetic variation in host susceptibility to MAP infection can be dissected and quantifiable associations with genetic markers identified. For this purpose, a case-control, genome-wide association study was conducted using US Holstein cattle phenotyped for MAP infection using a serum ELISA and/or fecal culture test. Cases included cows positive for either serum ELISA, fecal culture or both. Controls consisted of animals negative for the serum ELISA test or both serum ELISA and fecal culture when both were available. Controls were matched by herd and proximal birth date with cases. A total of 856 cows (451 cases and 405 controls) were used in initial discovery analyses, and an additional 263 cows (159 cases and 104 controls) from the same herds were used as a validation data set. Data were analyzed in a single marker analysis controlling for relatedness of individuals (GRAMMAR-GC) and also in a Bayesian analysis in which multiple marker effects were estimated simultaneously (GenSel). For the latter, effects of non-overlapping 1 Mb marker windows across the genome were estimated. Results from the two discovery analyses were generally concordant; however, discovery results were generally not well supported in analysis of the validation data set. A combined analysis of discovery and validation data sets provided strongest support for SNPs and 1 Mb windows on chromosomes 1, 2, 6, 7, 17 and 29.
Hereditary haemolytic anaemias have been found to be a significant cause of haemolytic disease in West Malaysia. This paper reports a micromapping study of 916 healthy Malay males from June to August 1983 to determine the distribution of the relevant thalassaemia genes in West Malaysia. Beta thalassaemia trait was found in 2.18%, HbE 3.49% and alpha thal2 (alpha+) trait in 26%. Of the sixteen transfusion dependant Malay thalassaemic patients at the Paediatric Unit, National University of Malaysia, eight patients had HbE beta thalassaemia and the rest are beta thalassaemia major; these patients who are transfusion dependant receive inadequate treatment. Prevention is the only resort.
A new haemoglobin, Haemoglobin Malay is described in a 22 year old Malay. Structural analysis showed a AAC----AGC mutation in codon 17, with the production of an abnormal beta chain (beta Malay) that has an Asn----Ser substitution at position beta 19. This haemoglobin variant could not be detected by conventional procedures.
The optimal training of the highly specialized congenital heart surgeon is a long and complex process, which is a significant challenge in most parts of the world. The World Society for Pediatric and Congenital Heart Surgery (WSPCHS) has established the Global Council on Education for Congenital Heart Surgery as a nonprofit organization with the goal of assessing current training and certification and ultimately establishing standardized criteria for the training, evaluation, and certification of congenital heart surgeons around the world. The Global Council and the WSPCHS have reviewed the present status of training and certification for congenital cardiac surgery around the world. There is currently lack of consensus and standardized criteria for training in congenital heart surgery, with significant disparity between continents and countries. This represents significant obstacles to international job mobility of competent congenital heart surgeons and to the efforts to improve the quality of care for patients with Congenital Heart Disease worldwide. The purpose of this article is to summarize and document the present state of training and certification in congenital heart surgery around the world.
Beta-thalassemia is one of the most prevalent inherited diseases and a public health problem in Malaysia. Malaysia is geographically divided into West and East Malaysia. In Sabah, a state in East Malaysia, there are over 1000 estimated cases of β-thalassemia major patients. Accurate population frequency data of the molecular basis of β-thalassemia major are needed for planning its control in the high-risk population of Sabah. Characterization of β-globin gene defects was done in 252 transfusion dependent β-thalassemia patients incorporating few PCR techniques. The study demonstrates that β-thalassemia mutations inherited are ethnically dependent. It is important to note that 86.9% of transfusion-dependent β-thalassemia major patients in Sabah were of the indigenous population and homozygous for a single mutation. The Filipino β(0)-deletion was a unique mutation found in the indigenous population of Sabah. Mutations common in West Malaysia were found in 11 (4.3%) patients. Four rare mutations (Hb Monroe, CD 8/9, CD 123/124/125 and IVS I-2) were also found. This study is informative on the population genetics of β-thalassemia major in Sabah.
Haemoglobin Bart's hydrops fetalis is the result of complete absence of functional alpha-globin genes where the fetus is homozygous for the alpha 0-thal gene. Prenatal diagnosis can be made by analysis of fetal DNA from chorionic villus, amniotic cells and fetal blood. Earlier studies for analysing genomic DNA needed digestion with restriction enzymes and hybridisation to radiolabelled probes which took 2 weeks. We have used the polymerase chain reaction (PCR) and non-radioactive primers to identify specific target sequences with results available within 1-3 days for the diagnosis of haemoglobin Bart's syndrome. With fetal blood samples, complete absence of alpha-chain synthesis is confirmed by globin chain electrophoresis on cellulose acetate pH 6.0.
Hematological and clinical data are presented for a young Malay patient with a homozygous (delta beta)zero-thalassemic condition. His red blood cells contained 100% fetal hemoglobin with alpha and G gamma chains only. Detailed gene mapping defined a large deletion with a 5' end between the Aha III and Apa I sites, some 200-400 bp 5' to the A gamma globin gene and a 3' end beyond sequences 17-18 kb 3' to the beta globin gene. This G gamma (A gamma delta beta)zero-type of thalassemia is different from all the other six types described before. Comparison of the hematological data of this patient with those of homozygotes for either the Sicilian or Spanish types of G gamma A gamma (delta beta)zero-thalassemia showed no differences; all homozygotes have a moderate anemia which is accentuated by the relatively high oxygen affinity of the Hb F containing erythrocytes.
In an ongoing effort to identify point mutations causing beta-thalassaemia, we have found two previously unreported mutations which are located in the Poly A site of the beta-globin gene. The screening programme used amplified DNA and dot-blot hybridization with several 32P-labelled oligonucleotide probes. DNA samples which remained unidentified by this methodology were subjected to sequencing with 32P-labelled primers and modified T7 DNA polymerase. The newly discovered mutations were confirmed by the dot-blot hybridization technique. One type concerned an AATAAA----AATGAA mutation in the polyadenylation site and was found in one family from Yugoslavia (including one patient with the C----T mutation at codon 29 in trans), one from Bulgaria (the patient had the G----A mutation at IVS-I-110 in trans), and one from Greece (this patient had the C----G mutation at IVS-II-745 in trans). Haematological data for three simple heterozygotes suggested a rather mild beta(+)-thalassemia. The second type involved an AATAAA----AATAGA mutation and was found in one family from Malaysia. The propositus had the beta E mutation on the other chromosome, was originally diagnosed as mild Hb E-beta(+)-thalassaemia, and had Hb A and Hb E percentages which were nearly the same.
This study concerned the identification of the beta-thalassaemia mutations that were present in 27 Malay patients with Hb E-beta-thalassaemia and seven Malay patients with thalassaemia major who were from West Malaysia. Nearly 50% of all beta-thalassaemia chromosomes carried the G----C substitution at nucleotide 5 of IVS-I; the commonly occurring Chinese anomalies such as the frameshift at codons 41 and 42, the nonsense mutation A----T at codon 17, the A----G substitution at position -28 of the promoter region, and the C----T substitution at position 654 of the second intron, were rare or absent. Two new thalassaemia mutations were discovered. The first involves a frameshift at codon 35 (-C) that was found in two patients with Hb E-beta zero-thalassaemia and causes a beta zero-thalassaemia because a stop codon is present at codon 60. The second is an AAC----AGC mutation in codon 19 that was present on six chromosomes. This substitution results in the production of an abnormal beta chain (beta-Malay) that has an Asn----Ser substitution at position beta 19. Hb Malay is a 'Hb Knossos-like' beta +-thalassaemia abnormality; the A----G mutation at codon 19 likely creates an alternate splicing site between codons 17 and 18, reducing the efficiency of the normal donor splice site at IVS-I to about 60%.
Following complete DNA characterisation patients with Hb H disease were assigned into two groups: deletional (alpha +/alpha o) and non deletional (HbCS/alpha o). Earlier studies have indicated that the group with (HbCS/alpha o) has more severe clinical problems. The serum malonyldialdehyde (MDA) levels, a secondary product of lipid peroxidation were within the normal range, though significantly higher levels of MDA were seen in the non-deletional type of Hb H disease when compared with the deletional type. Markedly low vitamin E levels were also seen in the former group. There were no significant differences in clinical severity may be attributed to an interplay of the accelerated destruction of damaged mature red blood cells secondary to the oxidative denaturation of Hb H and inclusion precipitation; higher levels of Hb H and more inclusion precipitation were seen in the group with (HbCS/alpha o). Low levels of vitamin E in the (HbCS/alpha o) group being due to its consumption in the neutralisation of free radicals formed with the oxidation of globin chains.
Thalassemia is known as a diverse single gene disorder, which is prevalent worldwide. The molecular chaperones are set of proteins that help in two important processes while protein synthesis and degradation include folding or unfolding and assembly or disassembly, thereby helping in cell homeostasis. This review recaps current knowledge regarding the role of molecular chaperones in thalassemia, with a focus on beta thalassemia.
BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.